Search Results

Search found 18803 results on 753 pages for 'c link'.

Page 707/753 | < Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >

  • Can't figure out the color of an svg element

    - by yass
    I have a very simple HTML page, viewable on gh-pages with the following code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head> <meta http-equiv="content-type" content="text/html; charset=UTF-8"> <link href="style.css" media="screen" rel="stylesheet" type="text/css"> <script src='http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js'> </script> </head> <body> <div id="page"> <div id="content"> <div id="heatmap"> <svg style="margin-left: 80px; color: rgb(255, 255, 255);" width="800" height="880"> <g transform="translate(80,80)"> <rect style="color: rgb(255, 255, 255);" height="720" width="720"> </rect> </g> </svg> </div> </div> </div> </body> </html> with the following CSS: body { background-color: #FFFFFF; font-family: Arial, Helvetica, sans-serif; font-size: 14px; color: #FFFFFF; } #wrapper { margin: 0 auto; padding: 0; } #page { width: 1000px; margin: 0 auto; padding: 40px 0px 0px 0px; } #content { float: left; width: 660px; padding: 0px 0px 0px 0px; background: #FFFFFF; } I expect the rectangle, 'svg rect' to be the color #FFFFFF, or white. But it shows up as some other color. I opened it up in firebug, and it shows the computed color to be #FFFFF:

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Simple html page using Bootstrap

    - by Athashri
    I am writing a simple HTML page using the Twitter Bootstrap. But the navbar and links are rendered as normal HTML on the browser. I have referred to multiple sites but the same steps are given everywhere. I am not sure where I am going wrong. Code: <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <link rel= "stylesheet" href= "css/bootstrap.css" type="text/css"> <title> Bootstrap example</title> </head> <body> <script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.0/jquery.min.js"></script> <script src="js/bootstrap.js"></script> <h1>Hello, world!</h1> <div class ="container"> <h1><a href="#">Bootstrap Site</a></h1> <div class="navbar"> <div class="navbar-inner"> <div class="container"> <ul class="nav"> <li class="active"><a href="#">Home</a></li> <li><a href="#">Projects</a></li> <li><a href="#">Services</a></li> <li><a href="#">Downloads</a></li> <li><a href="#">About</a></li> <li><a href="#">Contact</a></li> </ul> </div> </div> </div> </div> </body> </html>

    Read the article

  • preload image with jquery

    - by robertdd
    Updated: firs append a empty image and a span with some text hide the loading image, after it's load it's show the image var pathimg = "path/to/image" + "?" + (new Date()).getTime(); $('#somediv').append('<div><span>loading..</span><img id="idofimage" src="" alt="" ></div>') jQuery("#idofimage").hide().attr({"src":pathimg}) .load(function() { jQuery(this).show(); }); old post ok, I spent 2 days trying to preloaded images but no succes! i have this function: jQuery.getlastimage = function(id) { $.getjs(); $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id).html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>'); }); }; lastimg is the name of the image while the image loading i want to appear a gif or a text "Loading...". the function will get something like this: <div class="upimage"> <ul class="thumbs" id="upimagesQueue"> **<li id="#upimagesRIFDIB"> <a href="uploads/0001.jpg?1271800088379"> <img src="uploads/0001.jpg?1271800088379" alt="0001.jpg" id="RIFDIB" class="thumbs"> </a> </li>** <li> .... </li> </ul> </div> i tried like this: ... $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id) .html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>') .hide() .load(function() { $(this).show(); }); ... but all the <li> will hide and after is loading the image appear, i want the <li> to apear with a gif or a text in it and after the image is loaded the link and the image to apear! How to do this? Anyone have an idea? Thanks!

    Read the article

  • session management: problem displaying username in the header

    - by aeonsleo
    hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • div "top" bug IE and everything else. Big problem

    - by Victor
    Hi everyone. I am new in CSS so please help me in this problem. I hope to describe it wright. I am making div named content where my site content is. I made it with z-index:-1; so an image to be over this div. But in Chrome, FF and safari, content became inactive. I cant select text , click on link and write in the forms. So I tried with positive states in the z-index but IE don't know what this means. Damn. So I decided to make conditional div. Here is the code: .content { background:#FFF; width:990px; position:relative; float:left; top:50px; } .content_IE { background:#FFF; width:990px; position:relative; float:left; top: 50px; z-index:-1; } and here is the HTML: <!--[if IE 7]> <div class="content_IE" style="height:750px;"> <![endif]--> <div class="content" style="height:550px;"> Everything is fine with the z-index but the problem is that if there is no top in .content class everything looks fine in IE but there is no space in the other browsers. If i put back the top:50px; there onother 50px like padding in the .content_IE class. I mean that the page looks like I've put top:50px; and padding-top=50px;. I've try everything like margin-top:-50px; padding-top:-50px; and stuff like this but I am still in the circle. It look fine only if there is no top option in .content class. Please help.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • How to use a LinkButton inside gridview to delete selected username in the code-behind file?

    - by jenifer
    I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

    Read the article

  • How do I make a full screen scrolling messagebox or window?

    - by chobo2
    Hi First let me start of saying I know absolutely nothing about c++ and I am really just more interested in getting this to work then learning c++(I got enough on my plate to learn). So basically I am trying to make a terms of service for my windows mobile 6 professional application but it seems I need to use c++ to do it. After hours of searching I found a solution but it developed for windows mobile standard. So they somehow used c++ to make a message box and on standard devices(ie non touch screen phones) the message box can have like scrolling. For some reason this is not the case with professional devices(touch screen devices). So my message box goes off the page and you can never accept or decline the terms. So your stuck and on the screen forever till you do some sort of soft restart. http://www.mobilepractices.com/2008/10/setupdll-sample-and-walkthrough-terms.html The above link is the tutorial but here is the actual file that seems to display the message. #include "stdafx.h" #include "ce_setup.h" // This is a variable containing the text to be displayed // in the Terms & Conditions dialog TCHAR Message[] = _T("TERMS & CONDITIONS\r\n ") _T("Selecting YES you're accepting our terms & conditions.\r\n") _T("This is just a sample application.\r\n") _T("From http://www.mobilepractices.com\r\n") _T("You can replace this text with your own.\r\n") _T("We're using a setup.dll to show this dialog.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Extra line to force vertical scrollbar.\r\n") _T("Last line.\r\n") ; // This function will be called when the user // tries to install the cab. According to its return // value the installation continues or is cancelled. // As this could be called more than once // (i.e. if there is not enough space on the target) // we should take care about fFirstCall parameter // to show the dialog only once. codeINSTALL_INIT Install_Init( HWND hwndParent, BOOL fFirstCall, BOOL fPreviouslyInstalled, LPCTSTR pszInstallDir ) { if (!fFirstCall || ::MessageBoxW(0, Message, _T("SplashScreenSample") , MB_YESNO) == IDYES) return codeINSTALL_INIT_CONTINUE; else return codeINSTALL_INIT_CANCEL; } So I want to change this to something that can scroll. Can I use like a panel control since I know what has scroll or something else? Thanks

    Read the article

  • fancybox image sometimes renders outside box

    - by Colleen
    I have the following django template: <script type="text/javascript" src="{{ STATIC_URL }}js/ jquery.fancybox-1.3.4.pack.js"></script> <link rel="stylesheet" href="{{ STATIC_URL }}css/ jquery.fancybox-1.3.4.css" type="text/css" media="screen" /> {% include "submission-form.html" with section="photos" %} <div class="commentables"> {% load thumbnail %} {% for story in objects %} <div class="image {% if forloop.counter|add:"-1"| divisibleby:picsinrow %}left{% else %}{% if forloop.counter| divisibleby:picsinrow %}right{% else %}middle{% endif %}{% endif %}"> {% if story.image %} {% thumbnail story.image size crop="center" as full_im %} <a rel="gallery" href="{% url post slug=story.slug %}"> <img class="preview" {% if story.title %} alt="{{ story.title }}" {% endif %} src="{{ full_im.url }}" full- image="{% if story.image_url %}{{ story.image_url }}{% else %} {{ story.image.url }}{% endif %}"> </a> {% endthumbnail %} {% else %} {% if story.image_url %} {% thumbnail story.image_url size crop="center" as full_im %} <a rel="gallery" href="{% url post slug=story.slug %}"> <img class="preview" {% if story.title %} alt="{{ story.title }}" {% endif %} src="{{ full_im.url }}" full- image="{{ story.image_url }}"> </a> {% endthumbnail %} {% endif %} {% endif %} </div> {% endfor %} {% if rowid != "last" %} <br style="clear: both" /> {% endif %} {% if not no_more_button %} <p style="text-align: right;" class="more-results"><a href="{% url images school_slug tag_slug %}">more...</a></p> {% endif %} </div> <script> $(document).ready(function(){ function changeattr(e){ var f = $(e.clone()); $(f.children()[0]).attr('src', $(f.children() [0]).attr("full-image")); $(f.children()[0]).attr('height', '500px'); return f[0].outerHTML; } $('.image a').each(function(idx, elem) { var e = $(elem); e.fancybox({ title: $(e.children()[0]).attr('alt'), content: changeattr(e) }); }); }); </script> and I'm occasionally getting weird display errors where the box will either not render anything at all (so it will show up as just a thin white bar, basically) or it will render only about 30 px wide, and position itself halfway down the page. In both cases, if I inspect element, I can see the "shadow" of the full picture, at the right size, with the right url. Image source doesnt' seem to make a difference, I'm getting no errors, and this is happening in both chrome and firefox. Does anyone have any ideas?

    Read the article

  • Tag Cloud JS + Flash. Not clickable?

    - by Alex
    Hello all, I've implemented a tag cloud on a site of mine, and I'm using a JS script to populate it, but for some reason, the actual text in the tag cloud is not clickable. It displays and works correctly, but the actual text of the cloud is not getting treated as a link for some odd reason. My question is: In my script below, do you see anything that I need to fix in order to make my tag cloud's text actually be links? The site I've implemented it on is a stackexhange site that I run, it is supposed to be a cloud of the "recent tags." CloudPopulator.js <script type="text/javascript"> var divRecentTags = document.getElementById("recent-tags"); if (divRecentTags) { var cloud = new SWFObject("https://kynetx-images.s3.amazonaws.com/tagcloud.swf", "tagcloudflash", "200", "200", "9", "#ffffff"); cloud.addParam("allowScriptAccess", "always"); cloud.addVariable("tcolor", "0x0a94d6"); cloud.addVariable("tcolor2", "0xC0C0C0"); cloud.addVariable("hicolor", "0x000000"); cloud.addVariable("tspeed", "150"); cloud.addVariable("distr", "true"); cloud.addVariable("mode", "tags"); var aTags = divRecentTags.getElementsByTagName("a"); var tagHtml = ""; for(var i = 0; i < aTags.length; i++) { var hrefText = aTags[i].getAttribute("href"); var cssText = aTags[i].className; var tagName = $(aTags[i]).text(); var styleText = "style=\'font-size: 8pt;\'"; if (cssText == "post-tag pop1") { var styleText = "style=\'font-size: 15pt;\'"; } else if (cssText == "post-tag pop2") { var styleText = "style=\'font-size: 22pt;\'"; } var newLinkText = "<a href=\'"+hrefText+"\'"+styleText+">"+tagName+"</a>"; tagHtml = tagHtml + newLinkText; } cloud.addVariable("tagcloud", escape("<tags>" + tagHtml + "</tags>")); cloud.write("recent-tags"); }

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • CSS Hidden DIV Form Submit

    - by Michael
    Using CSS, when a link is clicked it brings up a hidden DIV that contains a form. The user will then enter information and then submit the form. I'd like the hidden DIV to remain visisble, and a 'success message' to be displayed after submission. Then the user will have the option of closing the DIV. I can't get it to work without reloading the page, which causes the DIV to become hidden again. Any ideas? <body> <a href="javascript:showDiv()" style="color: #fff;">Click Me</a> <!--POPUP--> <div id="hideshow" style="visibility:hidden;"> <div id="fade"></div> <div class="popup_block"> <div class="popup"> <a href="javascript:hideDiv()"> <img src="images/icon_close.png" class="cntrl" title="Close" /> </a> <h3>Remove Camper</h3> <form method="post" onsubmit="email.php"> <p><input name="Name" type="text" /></p> <p><input name="Submit" type="submit" value="submit" /></p> </form> <div id="status" style="display:none;">success</div> </div> </div> </div> <!--END POPUP--> <script language=javascript type='text/javascript'> function hideDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'hidden'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'hidden'; } else { // IE 4 document.all.hideshow.style.visibility = 'hidden'; } } } function showDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'visible'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'visible'; } else { // IE 4 document.all.hideshow.style.visibility = 'visible'; } } } </script> </body>

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • Where can I find sample XHTML5 source codes?

    - by Bytecode Ninja
    Where can I find sample *X*HTML 5 pages? I mainly want to know if it is possible to mix and match XHTML 5 with other XML languages just like XHTML 1 or not. For example is something like this valid in XHTML 5? <!DOCTYPE html PUBLIC "WHAT SHOULD BE HERE?" "WHAT SHOULD BE HERE?"> <html xmlns="WHAT SHOULD BE HERE?" xmlns:ui="http://java.sun.com/jsf/facelets"> <head> <title><ui:insert name="title">Default title</ui:insert></title> <link rel="stylesheet" type="text/css" href="./css/main.css"/> </head> <body> <div id="header"> <ui:insert name="header"> <ui:include src="header.xhtml"/> </ui:insert> </div> <div id="left"> <ui:insert name="navigation" > <ui:include src="navigation.xhtml"/> </ui:insert> </div> <div id="center"> <br /> <span class="titleText"> <ui:insert name="title" /> </span> <hr /> <ui:insert name="content"> <div> <ui:include src="content.xhtml"/> </div> </ui:insert> </div> <div id="right"> <ui:insert name="news"> <ui:include src="news.xhtml"/> </ui:insert> </div> <div id="footer"> <ui:insert name="footer"> <ui:include src="footer.xhtml"/> </ui:insert> </div> </body> </html> Thanks in advance.

    Read the article

  • Making Visual C++ DLL from C++ class

    - by prosseek
    I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

    Read the article

  • SQL Cartesian product joining table to itself and inserting into existing table

    - by Emma
    I am working in phpMyadmin using SQL. I want to take the primary key (EntryID) from TableA and create a cartesian product (if I am using the term correctly) in TableB (empty table already created) for all entries which share the same value for FieldB in TableA, except where TableA.EntryID equals TableA.EntryID So, for example, if the values in TableA were: TableA.EntryID TableA.FieldB 1 23 2 23 3 23 4 25 5 25 6 25 The result in TableB would be: Primary key EntryID1 EntryID2 FieldD (Default or manually entered) 1 1 2 Default value 2 1 3 Default value 3 2 1 Default value 4 2 3 Default value 5 3 1 Default value 6 3 2 Default value 7 4 5 Default value 8 4 6 Default value 9 5 4 Default value 10 5 6 Default value 11 6 4 Default value 12 6 5 Default value I am used to working in Access and this is the first query I have attempted in SQL. I started trying to work out the query and got this far. I know it's not right yet, as I’m still trying to get used to the syntax and pieced this together from various articles I found online. In particular, I wasn’t sure where the INSERT INTO text went (to create what would be an Append Query in Access). SELECT EntryID FROM TableA.EntryID TableA.EntryID WHERE TableA.FieldB=TableA.FieldB TableA.EntryID<>TableA.EntryID INSERT INTO TableB.EntryID1 TableB.EntryID2 After I've got that query right, I need to do a TRIGGER query (I think), so if an entry changes it's value in TableA.FieldB (changing it’s membership of that grouping to another grouping), the cartesian product will be re-run on THAT entry, unless TableB.FieldD = valueA or valueB (manually entered values). I have been using the Designer Tab. Does there have to be a relationship link between TableA and TableB. If so, would it be two links from the EntryID Primary Key in TableA, one to each EntryID in TableB? I assume this would not work because they are numbered EntryID1 and EntryID2 and the name needs to be the same to set up a relationship? If you can offer any suggestions, I would be very grateful. Research: http://www.fluffycat.com/SQL/Cartesian-Joins/ Cartesian Join example two Q: You said you can have a Cartesian join by joining a table to itself. Show that! Select * From Film_Table T1, Film_Table T2;

    Read the article

  • jquery use of :last and val()

    - by dole doug
    I'm trying to run the code from http://jsfiddle.net/ddole/AC5mP/13/ on my machine and the approach I've use is below or here. Do you know why that code doesn't work on my machine. Firebug doesn't help me and I can't solve the problem. I think that I need another pair of eyes :((( <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <title>jQuery UI Dialog - Modal form</title> <link type="text/css" href="css/ui-lightness/jquery-ui-1.8.21.custom.css" rel="stylesheet" /> <script type="text/javascript" src="js/jquery-1.7.2.min.js"></script> <script type="text/javascript" src="js/jquery-ui-1.8.21.custom.min.js"></script> <script type="text/javascript" > jQuery(function($) { $('.helpDialog').hide(); $('.helpButton').each(function() { $.data(this, 'dialog', $(this).next('.helpDialog').dialog({ autoOpen: false, modal: true, width: 300, height: 250, buttons: { "Save": function() { alert($('.helpText:last').val()); $(this).dialog( "close" ); }, Cancel: function() { $(this).dialog( "close" ); } } }) ); }).click(function() { $.data(this, 'dialog').dialog('open'); return false; }); }); </script> </head> <body> <span class="helpButton">Button</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 2</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 3</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 4</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 5</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> </body>

    Read the article

  • Google Maps API - Marker not showing

    - by popnbrown
    I'm trying to add markers for every single row from a table, that sits on the page. The page is http://www.sravanks.com/first/2013ftcmap.php This is the JS code that's loading the markers: $(document).ready(function() { var mapOptions = { center: new google.maps.LatLng(39.740, -89.503), zoom: 7 }; var map = new google.maps.Map(document.getElementById("map-canvas"), mapOptions); var infowindow = new google.maps.InfoWindow(); /* City Markers */ var cityCircle = new Array(); var i = 0; $.each($('.events tr'), function(index, value) { var name = $(this).find('td:first()').html(); var address = $(this).find('.address').html(); var linkUrl = "http://www.sravanks.com/first/geocode.php?address=" + address; $.ajax({ url: linkUrl }).done(function(data){ var json = $.parseJSON(data.substring(0, data.length-1)); lat = json.results[0].geometry.location.lat; lng = json.results[0].geometry.location.lng; var latlng = new google.maps.LatLng(lat, lng); var marker = new google.maps.Marker({ position: latlng, map: map, icon: 'map-pointer-medium.gif' }); google.maps.event.addListener(marker, 'click', function() { infowindow.setContent(name); infowindow.open(map, marker); cityCircle[i] = new google.maps.Circle({strokeColor: '#00FF00', strokeOpacity: 0.8, strokeWeight: 2, fillColor: '#00FF00', fillOpacity: 0.35, map: map, center: latlng, radius: 144841}); i++; }); }); }); /*Team Markers*/ var markers = {}; var teamName, teamNumber, lat, lng, content; $.each($('.list tr'), function(index, value) { teamName = $(this).find('td.name').html(); teamNumber = $(this).find('td.number').html(); markers[teamNumber] = {}; lat = parseFloat($(this).find('td.lat').html()); lng = parseFloat($(this).find('td.lng').html()); content = "Name: " + teamName + "<br />Number: " + teamNumber; markers[teamNumber]['latlng'] = new google.maps.LatLng(lat, lng); markers[teamNumber]['marker'] = new google.maps.Marker({ position: markers[teamNumber]['latlng'], map: map }); google.maps.event.addListener(markers[teamNumber]['marker'], 'click', function() { infowindow.setContent(content); infowindow.open(map, markers[teamNumber]['marker']); }); }); google.maps.event.addListener(infowindow, 'closeclick', function() { for(var i=0;i<cityCircle.length;i++){ cityCircle[i].setMap(null); } }); }); I've got no errors, but the Team Markers do not show up. The strange thing is that the City Markers do show up. Some more info, the City Markers ajax call is just to a proxy that calls the google geocoding api. Again the link's at http://www.sravanks.com/first/2013ftcmap.php

    Read the article

  • Calling back a functions value

    - by Jason Kelly
    I need your help, I cannot, for the life of me, figure this out. I've had my head wrapped around it only to no avail. Ideally, i'd like to setup two functions. 1 function: select_date() to interact with the user to select a date from the jQuery Date picker. If the dialog is closed then return as null. Then a second function: test() to check wether or not a date was picked/selected.' Here's my delema, when the function test() is executed, an alert box pops up and says "undefined" which means, I never get to select a date and it always being "undefined" I dont see what I am doing wrong here and everything seems logical to me. <!DOCTYPE html> <html> <head> <link href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.21/themes/base/jquery-ui.css" rel="stylesheet" type="text/css"/> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.7.2/jquery.js"></script> <script src="http://ajax.googleapis.com/ajax/libs/jqueryui/1.8.21/jquery-ui.js"></script> <script type="text/javascript"> function select_date() { var sdate $('#dd').dialog({ autoOpen: true, modal: true, overlay: { opacity: 0.5, background: 'black' }, title: "title", height: 265, width: 235, draggable: false, resizable: false }); $('#d1').datepicker({ onSelect: function () { $("#dd").dialog("close"); } }); return sdate } function test() { var x = select_date() alert(x) } </script> <style type="text/css"> #d1 {font-size:64%;} </style> </head> <body> <div id="dd"> <div id="d1"> </div> </div> <a href="javascript:test()">test</a> </body> </html>

    Read the article

  • Wordpress Events List Date Problem

    - by Roger
    Hi, I'm having a problem displaying events in the correct order in wordpress. I think the problem is because wordpress is treating the date as a string and ordering it by the day because it's in british date format. The goal is to display a list of future events with the most current event at the top of the list. But I must use the british date format of dd/mm/yyyy. Do I need to go back to the drawing board or is there a way of converting the date to achieve the result I need? Thanks in advance :) <ul> <?php // Get today's date in the right format $todaysDate = date('d/m/Y');?> <?php query_posts('showposts=50&category_name=Training&meta_key=date&meta_compare=>=&meta_value=' . $todaysDate . '&orderby=meta_value&order=ASC'); ?> <?php if (have_posts()) : while (have_posts()) : the_post(); ?> <li> <h3><a href="<?php the_permalink(); ?>"> <?php the_title(); ?> </a></h3> <?php $getDate = get_post_meta($post->ID, 'date', TRUE); $dateArray = explode('/', $getDate); ?> <?php if($getDate != '') { ?> <div class="coursedate rounded"><?php echo date('d F Y', mktime(0, 0, 0, $dateArray[1], $dateArray[0], $dateArray[2])); ?></div> <?php } ?> <p><?php get_clean_excerpt(140, get_the_content()); ?>...</p> <p><strong><a class="link" href="<?php the_permalink(); ?>">For further details and booking click here</a></strong></p> </li> <?php endwhile; ?> <?php else : ?> <li>Sorry, no upcoming events!</li> <?php endif; ?>

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

< Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >