Search Results

Search found 18803 results on 753 pages for 'c link'.

Page 707/753 | < Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >

• Search row with highest number of cells in a row with colspan

  - by user593029

  What is the efficient way to search highest number of cells in big table with numerous colspan (merge cells ** colspan should be ignored so in below example highest number of cells is 4 in first row). Is it js/jquery with reg expression or just the loop with bubble sorting. I got one link as below explainig use of regex is it ideal way ... can someone suggest pseudo code for this. High cpu consumption due to a jquery regex patch <table width="156" height="84" border="0" > <tbody> <tr style="height:10px"> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px" colspan="2"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px" colspan="2"/> </tr> <tr style="height:10px"> <td width="10" style="width:10px; height:10px" colspan="2"/> <td width="10" style="width:10px; height:10px"/> <td width="10" style="width:10px; height:10px"/> </tr> </tbody> </table>

  Read the article

• How to make html image clickable inside a TextView

  - by Gonan

  I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

  Read the article

• Wierdness debugging Visual Studio C++ 2008

  - by Jeff Dege

  I have a legacy C++ app, that in its most incarnation we've been building with makefiles and VS2003's command-line tool. I'm trying to get it to build using VS2008 and MsBuild. The build is working OK, but I'm getting errors where I'd never seen errors, before, and stepping through in VS2008's debugger only confuses me. The app links a number of static libraries, which fall into two categories: those that are part of the same application suite, and those that are shared between a number of application suites. Originally, I had a .csproj file for each static library, and two .sln files, one for the application suite (including the suite-specific libraries) and one for the non-suite-specific shared libraries. The shared libraries were included in the link, their projects were not included in the application suite .sln. The application instantiates an object from a class that is defined in one of the shared libraries. The class has a member object of a class that wraps a linked list. The constructor of the linked list class sets its "head" pointer to null. When I run the app, and try to add an element to the linked list, I get an error - the head pointer contains the value 0xCCCCCCCC. So I step through with the debugger. And see weirdness. When the current line in the debugger is in a source file belonging to the static library, the head pointer contains 0x00000000. When I step into the constructor, I can see the pointer being set to that value, and when I'm stepped into any other method of the class, I can see that the head pointer still contains 0x00000000. But when I step out into methods that are defined in the application suite .sln, it contains 0xCCCCCCCC. It's not like it's being overwritten. It changes back and forth depending upon which source file I am currently debugging. So I included the shared library's project in the application suite .sln, and now I see the head pointer containing 0xCCCCCCCC all the time. It looks like the constructor of the linked list class is not being called. So now, I'm entirely confused. Anyone have any ideas?

  Read the article

• Is it possible to create a service like Feed My Inbox on my own server?

  - by Mark Bowen

  I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

  Read the article

• Thoughts on streamlining multiple .Net apps

  - by John Virgolino

  We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• preload image with jquery

  - by robertdd

  Updated: firs append a empty image and a span with some text hide the loading image, after it's load it's show the image var pathimg = "path/to/image" + "?" + (new Date()).getTime(); $('#somediv').append('<div><span>loading..</span><img id="idofimage" src="" alt="" ></div>') jQuery("#idofimage").hide().attr({"src":pathimg}) .load(function() { jQuery(this).show(); }); old post ok, I spent 2 days trying to preloaded images but no succes! i have this function: jQuery.getlastimage = function(id) { $.getjs(); $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id).html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>'); }); }; lastimg is the name of the image while the image loading i want to appear a gif or a text "Loading...". the function will get something like this: <div class="upimage"> <ul class="thumbs" id="upimagesQueue"> **<li id="#upimagesRIFDIB"> <a href="uploads/0001.jpg?1271800088379"> <img src="uploads/0001.jpg?1271800088379" alt="0001.jpg" id="RIFDIB" class="thumbs"> </a> </li>** <li> .... </li> </ul> </div> i tried like this: ... $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id) .html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>') .hide() .load(function() { $(this).show(); }); ... but all the <li> will hide and after is loading the image appear, i want the <li> to apear with a gif or a text in it and after the image is loaded the link and the image to apear! How to do this? Anyone have an idea? Thanks!

  Read the article

• C++ DLL creation for C# project - No functions exported

  - by Yeti

  I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

  Read the article

• Memory Leak with jQuery UI inside UpdatePanel in ie7

  - by Ryan

  I have a fairly complex asp.net page based on UpdatePanels and jQuery UI. Unfortunately, when the panels update, the jQuery UI widgets leak memory like crazy in ie7, even if I manually 'destroy' them. Does anyone know a technique/patch to prevent these leaks? I've created a simple example page with a slider inside an UpdatePanel. Just click the 'Leak' button and refresh the page to see the leak in sieve. <%@ Page Language="C#" AutoEventWireup="true" CodeFile="Leak2.aspx.cs" Inherits="Leak2" %> <%@ Register Assembly="System.Web.Extensions, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35" Namespace="System.Web.UI" TagPrefix="asp" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title>Leak</title> <link type="text/css" href="/jquery/css/custom-theme/jquery-ui-1.7.2.custom.css" rel="Stylesheet" /> <script type="text/javascript" src="/jquery/js/jquery-1.3.2.min.js"></script> <script type="text/javascript" src="/jquery/js/jquery-ui-1.7.2.custom.min.js"></script> </head> <body> <form id="form1" runat="server"> <div> <script type="text/javascript"> function initializeSlider() { $(".slider").slider({ min: 0, max: 100, value: 100, step: 5 }); } $(document).ready(function() { initializeSlider(); Sys.WebForms.PageRequestManager.getInstance().add_endRequest(function() { initializeSlider(); }); }); </script> <asp:ScriptManager ID="ScriptManager1" runat="server"></asp:ScriptManager> <asp:UpdatePanel ID="UpdatePanel1" runat="server"> <ContentTemplate> <div style="width: 300px;"> <div class="slider"></div> <asp:Button ID="Button1" runat="server" OnClick="Button1_Click" Text="Leak" /> </div> </ContentTemplate> </asp:UpdatePanel> </div> </form> </body> </html>

  Read the article

• [CakePHP] I am so confused. What should I write in the default.ctp

  - by kwokwai

  Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

  Read the article

• meteor mongodb _id changing after insert (and UUID property as well)

  - by lommaj

  I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

  Read the article

• text in textbox shows up as circles instead of regular characters?

  - by BlueMonster

  When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

  Read the article

• Issues in Ajax based applications

  - by Sinuhe

  I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

  Read the article

• Making Visual C++ DLL from C++ class

  - by prosseek

  I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

  Read the article

• How to use a LinkButton inside gridview to delete selected username in the code-behind file?

  - by jenifer

  I have a "UserDetail" table in my "JobPost.mdf". I have a "Gridview1" showing the column from "UserDetail" table,which has a primary key "UserName". This "UserName" is originally saved using Membership class function. Now I add a "Delete" linkbutton to the GridView1. This "Delete" is not autogenerate button,I dragged inside the column itemtemplate from ToolBox. The GridView1's columns now become "Delete_LinkButton"+"UserName"(within the UserDetail table)+"City"(within the UserDetail table)+"IsAdmin"(within the UserDetail table) What I need is that by clicking this "delete_linkButton",it will ONLY delete the entire User Entity on the same row (link by the corresponding "UserName") from the "UserDetail" table,as well as delete all information from the AspNetDB.mdf (User,Membership,UserInRole,etc). I would like to fireup a user confirm,but not mandatory. At least I am trying to make it functional in the correct way. for example: Command UserName City IsAdmin delete ken Los Angles TRUE delete jim Toronto FALSE When I click "delete" on the first row, I need all the record about "ken" inside the "UserDetail" table to be removed. Meanwhile, all the record about "ken" in the AspNetDB.mdf will be gone, including UserinRole table. I am new to asp.net, so I don't know how to pass the commandargument of the "Delete_LinkButton" to the code-behind file LinkButton1_Click(object sender, EventArgs e), because I need one extra parameter "UserName". My partial code is listed below: <asp:TemplateField> <ItemTemplate> <asp:LinkButton ID="Delete_LinkButton" runat="server" onclick="LinkButton1_Click1" CommandArgument='<%# Eval("UserName","{0}") %>'>LinkButton</asp:LinkButton> </ItemTemplate> </asp:TemplateField> protected void Delete_LinkButton_Click(object sender, EventArgs e) { ((LinkButton) GridView1.FindControl("Delete_LinkButton")).Attributes.Add("onclick", "'return confirm('Are you sure you want to delete {0} '" + UserName); Membership.DeleteUser(UserName); JobPostDataContext db = new JobPostDataContext(); var query = from u in db.UserDetails where u.UserName == UserName select u; for (var Item in query) { db.UserDetails.DeleteOnSubmit(Item); } db.SubmitChanges(); } Please do help! Thanks in advance.

  Read the article

• Jquery-UI tabs : Double loading of the default tab with

  - by Stephane

  I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

  Read the article

• Jquery - Loading a page with .load and selector doesn't execute script?

  - by PirateKitten

  I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

  Read the article

• User has many computers, computers have many attributes in different tables, best way to JOIN?

  - by krismeld

  I have a table for users: USERS: ID | NAME | ---------------- 1 | JOHN | 2 | STEVE | a table for computers: COMPUTERS: ID | USER_ID | ------------------ 13 | 1 | 14 | 1 | a table for processors: PROCESSORS: ID | NAME | --------------------------- 27 | PROCESSOR TYPE 1 | 28 | PROCESSOR TYPE 2 | and a table for harddrives: HARDDRIVES: ID | NAME | ---------------------------| 35 | HARDDRIVE TYPE 25 | 36 | HARDDRIVE TYPE 90 | Each computer can have many attributes from the different attributes tables (processors, harddrives etc), so I have intersection tables like this, to link the attributes to the computers: COMPUTER_PROCESSORS: C_ID | P_ID | --------------| 13 | 27 | 13 | 28 | 14 | 27 | COMPUTER_HARDDRIVES: C_ID | H_ID | --------------| 13 | 35 | So user JOHN, with id 1 owns computer 13 and 14. Computer 13 has processor 27 and 28, and computer 13 has harddrive 35. Computer 14 has processor 27 and no harddrive. Given a user's id, I would like to retrieve a list of that user's computers with each computers attributes. I have figured out a query that gives me a somewhat of a result: SELECT computers.id, processors.id AS p_id, processors.name AS p_name, harddrives.id AS h_id, harddrives.name AS h_name, FROM computers JOIN computer_processors ON (computer_processors.c_id = computers.id) JOIN processors ON (processors.id = computer_processors.p_id) JOIN computer_harddrives ON (computer_harddrives.c_id = computers.id) JOIN harddrives ON (harddrives.id = computer_harddrives.h_id) WHERE computers.user_id = 1 Result: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | HARDDRIVE TYPE 25 | But this has several problems... Computer 14 doesnt show up, because it has no harddrive. Can I somehow make an OUTER JOIN to make sure that all computers show up, even if there a some attributes they don't have? Computer 13 shows up twice, with the same harddrive listet for both. When more attributes are added to a computer (like 3 blocks of ram), the number of rows returned for that computer gets pretty big, and it makes it had to sort the result out in application code. Can I somehow make a query, that groups the two returned rows together? Or a query that returns NULL in the h_name column in the second row, so that all values returned are unique? EDIT: What I would like to return is something like this: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | NULL | 14 | 27 | PROCESSOR TYPE 1 | NULL | NULL | Or whatever result that make it easy to turn it into an array like this [13] => [P_NAME] => [0] => PROCESSOR TYPE 1 [1] => PROCESSOR TYPE 2 [H_NAME] => [0] => HARDDRIVE TYPE 25 [14] => [P_NAME] => [0] => PROCESSOR TYPE 1

  Read the article

• Wordpress Events List Date Problem

  - by Roger

  Hi, I'm having a problem displaying events in the correct order in wordpress. I think the problem is because wordpress is treating the date as a string and ordering it by the day because it's in british date format. The goal is to display a list of future events with the most current event at the top of the list. But I must use the british date format of dd/mm/yyyy. Do I need to go back to the drawing board or is there a way of converting the date to achieve the result I need? Thanks in advance :) <ul> <?php // Get today's date in the right format $todaysDate = date('d/m/Y');?> <?php query_posts('showposts=50&category_name=Training&meta_key=date&meta_compare=>=&meta_value=' . $todaysDate . '&orderby=meta_value&order=ASC'); ?> <?php if (have_posts()) : while (have_posts()) : the_post(); ?> <li> <h3><a href="<?php the_permalink(); ?>"> <?php the_title(); ?> </a></h3> <?php $getDate = get_post_meta($post->ID, 'date', TRUE); $dateArray = explode('/', $getDate); ?> <?php if($getDate != '') { ?> <div class="coursedate rounded"><?php echo date('d F Y', mktime(0, 0, 0, $dateArray[1], $dateArray[0], $dateArray[2])); ?></div> <?php } ?> <p><?php get_clean_excerpt(140, get_the_content()); ?>...</p> <p><strong><a class="link" href="<?php the_permalink(); ?>">For further details and booking click here</a></strong></p> </li> <?php endwhile; ?> <?php else : ?> <li>Sorry, no upcoming events!</li> <?php endif; ?>

  Read the article

• Layout issue regarding a JQuery smoothDivScroll

  - by MichaelMcCabe

  Hi all. I have been scratching my head for a while on this one. I dont really play around with HTML formatting that often. I have a smoothDivScroll using JQuery (http://maaki.com/thomas/SmoothDivScroll/) to scroll through dynamically generated images. What I want it for, is to have multiple small images lined up right next to each other, and each image has a section of writting underneath. about 25 images, 140px width each in a 7560px span. I acheived this great by putting a table inside the div, and each image inside a<td>.This works problem i have, is that i need the slider to start from the furthest RIGHT image, and slide automatically left. This is acheived by (if you look at the link above) - startAtElementId: But if I am using a table inside the div, it is taking the TABLE as a element and not the TD... so it doesnt work. I know this because if I change every image to be inside tables (i.e 25 tables), it works... but obviously then the formatting is not how I want. Can anyone think of a way I can use this slider (modifications to the js code or not), with 25 images that NEED to be right next to each other, no gap. I guess this is more of a formatting question, than about the slider. Because I only know ONE way of doing what I want, and thats to have below which will not alow me to set startAtElementId. <div class="scrollableArea"> <table width="7560px" class="index-body"> <tr> <td width="140px"><center><a onclick="__doPostBack('getEarlierDate');" ><img src="../images/olderGraphs.gif" width="140" height="60"></a>Click for more</center></td> <td width="300px"><center><a onclick="__doPostBack('chartClicked25');" ><cewolf:img chartid="verticalbar25" renderer="cewolf" width="300" height="60"/></a><c:out value="${date25}"/></center></td> <td width="300px"><center><a onclick="__doPostBack('chartClicked24');" ><cewolf:img chartid="verticalbar24" renderer="cewolf" width="300" height="60"/></a><c:out value="${date24}"/></center></td> and so on

  Read the article

• jquery use of :last and val()

  - by dole doug

  I'm trying to run the code from http://jsfiddle.net/ddole/AC5mP/13/ on my machine and the approach I've use is below or here. Do you know why that code doesn't work on my machine. Firebug doesn't help me and I can't solve the problem. I think that I need another pair of eyes :((( <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <title>jQuery UI Dialog - Modal form</title> <link type="text/css" href="css/ui-lightness/jquery-ui-1.8.21.custom.css" rel="stylesheet" /> <script type="text/javascript" src="js/jquery-1.7.2.min.js"></script> <script type="text/javascript" src="js/jquery-ui-1.8.21.custom.min.js"></script> <script type="text/javascript" > jQuery(function($) { $('.helpDialog').hide(); $('.helpButton').each(function() { $.data(this, 'dialog', $(this).next('.helpDialog').dialog({ autoOpen: false, modal: true, width: 300, height: 250, buttons: { "Save": function() { alert($('.helpText:last').val()); $(this).dialog( "close" ); }, Cancel: function() { $(this).dialog( "close" ); } } }) ); }).click(function() { $.data(this, 'dialog').dialog('open'); return false; }); }); </script> </head> <body> <span class="helpButton">Button</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 2</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 3</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 4</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 5</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> </body>

  Read the article

• CodeIgniter Third party class not loading

  - by Jatin Soni

  I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

  Read the article

• Sliding panel in the middle of the page. Z-index given not working

  - by Nehal Rupani

  Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

  Read the article

• Dragging Custom Node in JavaFX

  - by Karussell

  I cannot get it working although I am very close to an acceptable solution. I can drag the Dock if it is only a rectangle. But if I add a node (e.g. an image) to this dock I am not able to get a working solution. Do you have a code snippet, link or other advices for me? Here is my code: public class Dock extends CustomNode { // initialize this with an 64x64 image of your choice // via ImageView { image: Image {..}} public var content: Node[]; public var width = 64; public var height = 64; public var xOffset: Number = 0; public var yOffset: Number = 0; var imgX: Number = 0; var imgY: Number = 0; var distX: Number; var distY: Number; public var rasterX = function (n: Number): Number { var MAX = 4 * 64; if (n < 0) { return 0 } else if (n > MAX) { return MAX } else return n } public var rasterY = rasterX; override protected function create(): Node { Group { // if we place the translate here then the whole dock will flicker //translateX: bind imgX; //translateY: bind imgY; content: [ Rectangle { // ... and here 'content' won't be dragged translateX: bind imgX; translateY: bind imgY; height: bind height width: bind width fill: Color.LIGHTGRAY strokeWidth: 4 stroke: Color.BLACK }, content] onMousePressed: function (e: MouseEvent): Void { xOffset = e.x; yOffset = e.y; // Calculate the distance of the mouse point from the image // top-left corner which will always come out as positive value distX = e.x - imgX; distY = e.y - imgY; } onMouseDragged: function (e: MouseEvent): Void { // Find out the new image postion by subtracting the distance // part from the mouse point. imgX = rasterX(e.x - distX); imgY = rasterY(e.y - distY); } } }

  Read the article

• Configuring a html page from an original demo page

  - by Wold

  I forked into rainyday.js through github, an awesome javascript program made by maroslaw at this link: https://github.com/maroslaw/rainyday.js. Basically I tried taking his demo page and my own photo city.jpg and changed the applicable fields so that I could run it on my own site, but only the picture loads and the script itself doesn't start to run. I'm pretty new to html and javascript so I'm probably omitting something very simple, but here is the script for the demo code: <script src="rainyday.js"></script> <script> function getURLParameter(name) { return decodeURIComponent((new RegExp('[?|&]' + name + '=' + '([^&;]+?)(&|#|;|$)').exec(location.search)||[,''])[1].replace(/\+/g, '%20'))||null; } function demo() { var image = document.getElementById('background'); image.onload = function () { var engine = null; var preset = getURLParameter('preset') || '1'; if (preset === '1') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.rain([ [1, 2, 8000] ]); engine.rain([ [3, 3, 0.88], [5, 5, 0.9], [6, 2, 1] ], 100); } else if (preset === '2') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.VARIABLE_GRAVITY_ANGLE = Math.PI / 8; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 50); } else if (preset === '3') { engine = new RainyDay({ element: 'background', blur: 10, opacity: 1, fps: 30, speed: 30 }); engine.trail = engine.TRAIL_SMUDGE; engine.rain([ [0, 2, 0.5], [4, 4, 1] ], 100); } }; image.crossOrigin = 'anonymous'; if (getURLParameter('imgur')) { image.src = 'http://i.imgur.com/' + getURLParameter('imgur') + '.jpg'; } else if (getURLParameter('img')) { image.src = getURLParameter('img') + '.jpg'; } var youtube = getURLParameter('youtube'); if (youtube) { var div = document.getElementById('sound'); var player = document.createElement('iframe'); player.frameborder = '0'; player.height = '1'; player.width = '1'; player.src = 'https://youtube.com/embed/' + youtube + '?autoplay=1&controls=0&showinfo=0&autohide=1&loop=1'; div.appendChild(player); } } </script> This is where I am naming my background and specifying the photo from within the directory. <body onload="demo();"> <div id="sound" style="z-index: -1;"></div> <div id="parent"> <img id='background' alt="background" src="city.jpg" /> </div> </body> The actual code for the whole entire rainyday.js script can be found here: https://github.com/maroslaw/rainyday.js/blob/master/rainyday.js Thanks in advance for any help and advice!

  Read the article

< Previous Page | 703 704 705 706 707 708 709 710 711 712 713 714  | Next Page >