Search Results

Search found 19103 results on 765 pages for 'foreign key'.

Page 73/765 | < Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >

  • Trouble getting NSString from NSDictionary key into UILabel

    - by Brian
    I'm attempting to put the value associated with the key called "duration" into a UILabel but I'm getting a blank or "(null)" result showing up in the UILabel. My NSDictionary object with its keys seems to be logging as being full of the data and keys I think I want, as such: the content of thisRecordingsStats is { "12:48:25 AM, April 25" = { FILEPATH = "/Users/brian/Library/Application Support/iPhone Simulator/3.1.3/Applications/97256A91-FC47-4353-AD01-15CD494060DD/Documents/12:48:25 AM, April 25.aif"; duration = "00:04"; applesCountString = 0; ...and so on. Here's the code where I'm trying to put the NSString into the UILabel: cell.durationLabel.text = [NSString stringWithFormat:@"%@",[thisRecordingsStats objectForKey:@"duration"]]; I've also tried these other permutations: cell.durationLabel.text = [thisRecordingsStats objectForKey:@"duration"]; and I've also tried this tag-based approach: label = (UILabel *)[cell viewWithTag:8]; label.text = [[thisRecordingsStats objectForKey:@"duration"] objectAtIndex:1]; and: UILabel *label; label = (UILabel *)[cell viewWithTag:8]; label.text = [NSString stringWithFormat:@"%@",[[thisRecordingsStats objectForKey:@"duration"] objectAtIndex:1]]; I've also tried creating a string from the key's paired value and see a "(null)" value or blankness using that too. What am I missing? I assume it's something with the formatting of the string. Thanks for looking!!

    Read the article

  • iPhone: Fastest way to create a binary Plist with simple key/value strings

    - by randombits
    What's the best way to create a binary plist on the iPhone with simple string based key/value pairs? I need to create a plist with a list of recipe and ingredients. I then want to be able to read this into an NSDictionary so I can do something like NSString *ingredients = [recipes objectForKey:@"apple pie"]; I'm reading in an XML data file through an HTTP request and want to parse all of the key value pairs into the plist. The XML might look something like: <recipes> <recipe> <name>apple pie</name> <ingredients>apples and pie</ingredients> </recipe> <recipe> <name>cereal</name> <ingredients>milk and some other ingredients</ingredients> </recipe> </recipes> Ideally, I'll be able to write this to a plist at runtime, and then be able to read it and turn it into an NSDictionary later at runtime as well.

    Read the article

  • Which key:value store to use with Python?

    - by Kurt
    So I'm looking at various key:value (where value is either strictly a single value or possibly an object) stores for use with Python, and have found a few promising ones. I have no specific requirement as of yet because I am in the evaluation phase. I'm looking for what's good, what's bad, what are the corner cases these things handle well or don't, etc. I'm sure some of you have already tried them out so I'd love to hear your findings/problems/etc. on the various key:value stores with Python. I'm looking primarily at: memcached - http://www.danga.com/memcached/ python clients: http://pypi.python.org/pypi/python-memcached/1.40 http://www.tummy.com/Community/software/python-memcached/ CouchDB - http://couchdb.apache.org/ python clients: http://code.google.com/p/couchdb-python/ Tokyo Tyrant - http://1978th.net/tokyotyrant/ python clients: http://code.google.com/p/pytyrant/ Lightcloud - http://opensource.plurk.com/LightCloud/ Based on Tokyo Tyrant, written in Python Redis - http://code.google.com/p/redis/ python clients: http://pypi.python.org/pypi/txredis/0.1.1 MemcacheDB - http://memcachedb.org/ So I started benchmarking (simply inserting keys and reading them) using a simple count to generate numeric keys and a value of "A short string of text": memcached: CentOS 5.3/python-2.4.3-24.el5_3.6, libevent 1.4.12-stable, memcached 1.4.2 with default settings, 1 gig memory, 14,000 inserts per second, 16,000 seconds to read. No real optimization, nice. memcachedb claims on the order of 17,000 to 23,000 inserts per second, 44,000 to 64,000 reads per second. I'm also wondering how the others stack up speed wise.

    Read the article

  • Can't submit new object to WCF DataService because of Primary Key constraint

    - by Rob
    I've got a SQL database that uses Guid's for PK's and upon insert, it generates a NewId(). I have an EF data context setup pointing to that database with the primary keys setup with the Entity key:true, Setter:private and StoreGeneratedPattern:Identity because I want the DB to manage the keys and not have code set the PK property. I have an OData (System.Web.Data.Services.DataService) endpoint to access this data (just like: Hanselman did. I have another app that has a service reference to this service. Upon trying to create a new object from this reference (i.e. Product), the ProductId Primary Key is being defaulted to Guid.Empty when doing var serviceEntities = new ServiceEntities(serviceUri); //OData endpoint var product = new Product(); product.Name = "New Product"; serviceEntities.AddToProducts(product); serviceEntities.SaveChanges(); // error happens here When debugging, I look at the Product.ProductId property and it's set to Guid.Empty. When called SaveChanges, I do not want the ProductId field to be sent to the service. The response I get is: Error processing request stream. Property 'ProductId' is a read-only property and cannot be updated. Please make sure that this property is not present in the request payload. Is there a way to do this or what can I do to get this setup correctly and still have the DB generated the keys. Here is the same setup as the Product example above.

    Read the article

  • Entity Framework - Using a lookup (picklist) table with a lookup key

    - by Dave
    I'm working on a WPF application that is working well using the Entity Framework (3.5 SP1) for complicated table structures. The problem now is I want to get a list from the EF that includes lookups into a picklist table that has multiple picklists in it. In SQL I would write a sub select as such: SELECT Name, (Select typeName from PickLists where type_id = items.type_id and picklist_key=333) as Type_desc FROM Items There are no Foreign keys for this, and the picklists table is never updated using the EF, so it is read only as far as the EF is concerned. I'm not sure the best method to put this into the model if at all. I'm displaying in a read-only datagrid on a dashboard. Thanks!

    Read the article

  • Generic Dictionary and generating a hashcode for multi-part key

    - by Andrew
    I have an object that has a multi-part key and I am struggling to find a suitable way override GetHashCode. An example of what the class looks like is. public class wibble{ public int keypart1 {get; set;} public int keypart2 {get; set;} public int keypart3 {get; set;} public int keypart4 {get; set;} public int keypart5 {get; set;} public int keypart6 {get; set;} public int keypart7 {get; set;} public single value {get; set;} } Note in just about every instance of the class no more than 2 or 3 of the keyparts would have a value greater than 0. Any ideas on how best to generate a unique hashcode in this situation? I have also been playing around with creating a key that is not unique, but spreads the objects evenly between the dictionaries buckets and then storing objects with matched hashes in a List< or LinkedList< or SortedList<. Any thoughts on this?

    Read the article

  • AES Encryption Java Invalid Key length

    - by wuntee
    I am trying to create an AES encryption method, but for some reason I keep getting a 'java.security.InvalidKeyException: Key length not 128/192/256 bits'. Here is the code: public static SecretKey getSecretKey(char[] password, byte[] salt) throws NoSuchAlgorithmException, InvalidKeySpecException{ SecretKeyFactory factory = SecretKeyFactory.getInstance("PBEWithMD5AndDES"); // NOTE: last argument is the key length, and it is 256 KeySpec spec = new PBEKeySpec(password, salt, 1024, 256); SecretKey tmp = factory.generateSecret(spec); SecretKey secret = new SecretKeySpec(tmp.getEncoded(), "AES"); return(secret); } public static byte[] encrypt(char[] password, byte[] salt, String text) throws NoSuchAlgorithmException, InvalidKeySpecException, NoSuchPaddingException, InvalidKeyException, InvalidParameterSpecException, IllegalBlockSizeException, BadPaddingException, UnsupportedEncodingException{ SecretKey secret = getSecretKey(password, salt); Cipher cipher = Cipher.getInstance("AES"); // NOTE: This is where the Exception is being thrown cipher.init(Cipher.ENCRYPT_MODE, secret); byte[] ciphertext = cipher.doFinal(text.getBytes("UTF-8")); return(ciphertext); } Can anyone see what I am doing wrong? I am thinking it may have something to do with the SecretKeyFactory algorithm, but that is the only one I can find that is supported on the end system I am developing against. Any help would be appreciated. Thanks.

    Read the article

  • Validating Application Settings Key Values in Isolated Storage for Windows Phone Applications

    - by Martin Anderson
    Hello everyone. I am very new at all this c# Windows Phone programming, so this is most probably a dumb question, but I need to know anywho... IsolatedStorageSettings appSettings = IsolatedStorageSettings.ApplicationSettings; if (!appSettings.Contains("isFirstRun")) { firstrunCheckBox.Opacity = 0.5; MessageBox.Show("isFirstRun not found - creating as true"); appSettings.Add("isFirstRun", "true"); appSettings.Save(); firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = true; } else { if (appSettings["isFirstRun"] == "true") { firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = true; } else if (appSettings["isFirstRun"] == "false") { firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = false; } else { firstrunCheckBox.Opacity = 0.5; } } I am trying to firstly check if there is a specific key in my Application Settings Isolated Storage, and then wish to make a CheckBox appear checked or unchecked depending on if the value for that key is "true" or "false". Also I am defaulting the opacity of the checkbox to 0.5 opacity when no action is taken upon it. With the code I have, I get the warnings Possible unintended reference comparison; to get a value comparison, cast the left hand side to type 'string' Can someone tell me what I am doing wrong. I have explored storing data in an Isolated Storage txt file, and that worked, I am now trying Application Settings, and will finally try to download and store an xml file, as well as create and store user settings into an xml file. I want to try understand all the options open to me, and use which ever runs better and quicker

    Read the article

  • Add new row in a databound form with a Oracle Sequence as the primary key

    - by Ranhiru
    I am connecting C# with Oracle 11g. I have a DataTable which i fill using an Oracle Data Adapter. OracleDataAdapter da; DataTable dt = new DataTable(); da = new OracleDataAdapter("SELECT * FROM Author", con); da.Fill(dt); I have few text boxes that I have databound to various rows in the data table. txtAuthorID.DataBindings.Add("Text", dt, "AUTHORID"); txtFirstName.DataBindings.Add("Text", dt, "FIRSTNAME"); txtLastName.DataBindings.Add("Text", dt, "LASTNAME"); txtAddress.DataBindings.Add("Text", dt, "ADDRESS"); txtTelephone.DataBindings.Add("Text", dt, "TELEPHONE"); txtEmailAddress.DataBindings.Add("Text", dt, "EMAIL"); I also have a DataGridView below the Text Boxes, showing the contents of the DataTable. dgvAuthor.DataSource = dt; Now when I want to add a new row, i do bm.AddNew(); where bm is defined in Form_Load as BindingManagerBase bm; bm = this.BindingContext[dt]; And when the save button is clicked after all the information is entered and validated, i do this.BindingContext[dt].EndCurrentEdit(); try { da.Update(dt); } catch (Exception ex) { MessageBox.Show(ex.Message); } However the problem comes where when I usually enter a row to the database (using SQL Plus) , I use a my_pk_sequence.nextval for the primary key. But how do i specify that when i add a new row in this method? I catch this exception ORA-01400: cannot insert NULL into ("SYSMAN".AUTHOR.AUTHORID") which is obvious because nothing was specified for the primary key. How do get around this? Thanx a lot in advance :)

    Read the article

  • Key strokes in wpf window hosted in MFC ActiveX running in Internet Explorer

    - by user310046
    We have an MFC ActiveX control created in Visual Studio 2008 with CLR support which creates a WPF grid and shows a WPF window within that grid. This ActiveX is hosted within Internet Explorer and it shows up and works nicely except that the tab key, backspace, function keys etc. does not work since they are handeled by IE instead of the WPF window. Regular characters works nicely. This is a known feature and previously when we used to have MFC based dialogs within this ActiveX we used this: http://support.microsoft.com/kb/187988. By just using this code directly the AfxGetApp()->PreTranslateMessage((LPMSG)lParam) statement will return FALSE, so I'm not able to get the key stroke to be handled by the WPF window. I beleive I need to ask the WPF application this instead of the CWinApp, but I'm not sure how and if this can be done. Does anyone have enough understanding of what's going on here to get this to work? Using XBAP instead of ActiveX is not an option as this is run in an intranet application which needs more access than the sandbox can give us. I hope this is enough information. With best regards Svein Dybvik

    Read the article

  • How To Generate Parameter Set for the Diffie-Hellman Key Agreement Algorithm in Android

    - by sebby_zml
    Hello everyone, I am working on mobile/server security related project. I am now stuck in generating a Diffie-Hellman key agreement part. It works fine in server side program but it is not working in mobile side. Thus, I assume that it is not compactible with Android. I used the following class to get the parameters. It returns a comma-separated string of 3 values. The first number is the prime modulus P. The second number is the base generator G. The third number is bit size of the random exponent L. My question is is there anything wrong with the code or it is not compactible for android?What kind of changes should I do? Your suggestion and guidance would be very much help for me. Thanks a lot in advance. public static String genDhParams() { try { // Create the parameter generator for a 1024-bit DH key pair AlgorithmParameterGenerator paramGen = AlgorithmParameterGenerator.getInstance("DH"); paramGen.init(1024); // Generate the parameters AlgorithmParameters params = paramGen.generateParameters(); DHParameterSpec dhSpec = (DHParameterSpec)params.getParameterSpec(DHParameterSpec.class); // Return the three values in a string return ""+dhSpec.getP()+","+dhSpec.getG()+","+dhSpec.getL(); } catch (NoSuchAlgorithmException e) { } catch (InvalidParameterSpecException e) { } return null; } Regards, Sebby

    Read the article

  • jqGrid : "All in One" approach width jqGridEdit Class > how to set a composite primary key ?

    - by Qualliarys
    Hello, How to set a composite primary key for a "All in One" approach (grid defined in JS file, and data using jqGridEdit Class in php file) ? Please, for me a composite primary key of a table T, is a elementary primary key that is defined with some fields belong to this table T ! Here is my test, but i get no data and cannot use the CRUD operations : In my JS file i have this lines code: ... colModel":[ {"name":"index","index":"index","label":"index"}, // <= THAT'S JUST THE INDEX OF MY TABLE {"name":"user","index":"user","label":"user","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"pwd","index":"pwd","label":"pwd","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"state","index":"state","label":"state","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY ... <= AND SO ON "url":"mygrid_crud.php", "datatype":"json", "jsonReader":{repeatitems:false}, "editurl": "mygrid_crud.php", "prmNames":{"id":"index"} // <= WHAT I NEED TO WRITE HERE ??? ... In my php file (mygrid_crud.php) : ... $grid = new jqGridEdit($conn); $query = "SELECT * FROM mytable WHERE user='$user' and pwd='$pwd' and state='$state'..."; // <= SELECT * it's ok or i need to specify all fields i need ? $grid->SelectCommand = $query; $grid->dataType = "json"; $grid->table = 'mytable'; $grid->setPrimaryKeyId('index'); // <= WHAT I NEED TO WRITE HERE ??? ... $grid->editGrid(); Please, say me what is wrong, and how to do to set a composite primary key in this approach !? Thank you so much for tour responses.

    Read the article

  • Chord Chart - Skip to key with a click

    - by Juan Gonzales
    I have a chord chart app that basically can transpose a chord chart up and down throughout the keys, but now I would like to expand that app and allow someone to pick a key and automatically go to that key upon a click event using a function in javascript or jquery. Can someone help me figure this out? The logic seems simple enough, but I'm just not sure how to implement it. Here are my current functions that allow the user to transpose up and down... var match; var chords = ['C','C#','D','D#','E','F','F#','G','G#','A','A#','B','C','Db','D','Eb','E','F','Gb','G','Ab','A','Bb','B','C']; var chords2 = ['C','Db','D','Eb','E','F','Gb','G','Ab','A','Bb','B','C','C#','D','D#','E','F','F#','G','G#','A','A#','C']; var chordRegex = /(?:C#|D#|F#|G#|A#|Db|Eb|Gb|Ab|Bb|C|D|E|F|G|A|B)/g; function transposeUp(x) { $('.chord'+x).each(function(){ ///// initializes variables ///// var currentChord = $(this).text(); // gatheres each object var output = ""; var parts = currentChord.split(chordRegex); var index = 0; ///////////////////////////////// while (match = chordRegex.exec(currentChord)){ var chordIndex = chords2.indexOf(match[0]); output += parts[index++] + chords[chordIndex+1]; } output += parts[index]; $(this).text(output); }); } function transposeDown(x){ $('.chord'+x).each(function(){ var currentChord = $(this).text(); // gatheres each object var output = ""; var parts = currentChord.split(chordRegex); var index = 0; while (match = chordRegex.exec(currentChord)){ var chordIndex = chords2.indexOf(match[0],1); //var chordIndex = $.inArray(match[0], chords, -1); output += parts[index++] + chords2[chordIndex-1]; } output += parts[index]; $(this).text(output); }); } Any help is appreciated. Answer will be accepted! Thank You

    Read the article

  • Custom types as key for a map - C++

    - by Appu
    I am trying to assign a custom type as a key for std::map. Here is the type which I am using as key. struct Foo { Foo(std::string s) : foo_value(s){} bool operator<(const Foo& foo1) { return foo_value < foo1.foo_value; } bool operator>(const Foo& foo1) { return foo_value > foo1.foo_value; } std::string foo_value; }; When used with std::map, I am getting the following error. error C2678: binary '<' : no operator found which takes a left-hand operand of type 'const Foo' (or there is no acceptable conversion) c:\program files\microsoft visual studio 8\vc\include\functional 143 If I change the struct like the below, everything worked. struct Foo { Foo(std::string s) : foo_value(s) {} friend bool operator<(const Foo& foo,const Foo& foo1) { return foo.foo_value < foo1.foo_value; } friend bool operator>(const Foo& foo,const Foo& foo1) { return foo.foo_value > foo1.foo_value; } std::string foo_value; }; Nothing changed except making the operator overloads as friend. I am wondering why my first code is not working? Any thoughts?

    Read the article

  • TextArea being used as an itemEditor misbehaves when the enter key is pressed

    - by ChrisInCambo
    Hi, I have a TextArea inside an itemEditor component, the problem is that when typing in the TextArea if the enter key is pressed the itemEditor resets itself rather moving the caret to the next line as expected: <mx:List width="100%" editable="true" > <mx:dataProvider> <mx:ArrayCollection> <mx:Array> <mx:Object title="Stairway to Heaven" /> </mx:Array> </mx:ArrayCollection> </mx:dataProvider> <mx:itemRenderer> <mx:Component> <mx:Text height="100" text="{data.title}"/> </mx:Component> </mx:itemRenderer> <mx:itemEditor> <mx:Component> <mx:TextArea height="100" text="{data.title}"/> </mx:Component> </mx:itemEditor> </mx:List> </mx:Application> Could anyone advise how I can get around this strange behaviour and make the enter key behave as expected? Thanks, Chris

    Read the article

  • capture delete key in CListCtrl and do soem processing

    - by user333422
    Hi, I have a class which inherits from CListCtrl class, say class list. I have another class dlg, which inherits from CDialog. Class dlg contains an instance of class list. I have got a delete button in class dlg, on which I delete the selected item in listCtrl and do lots of other processing. I want the same functionality on delete key. I added OnKeyDown() fn is my class list, where I can capture VK_DELETE key. But my problem is that, how do I do otehr processing that I need to do in dialog class. All that processing is dlg class based not list class based. I have many such dlg classes with different data and in every dlg class processing is different. I tried capturing VK_DELETE in dialog class, but it doesn't capture it if focus is on list class. I am totally stuck and have no idea, how to do this. Please give me some idea how i can do this. Thanks, SG

    Read the article

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Load PEM encoded private RSA key in Crypto++

    - by 01100110
    Often times, user will have PEM encoded RSA private keys. Crypto++ requires that these keys be in DER format to load. I've been asking people to manually convert their PEM files to DER beforehand using openssl like this: openssl pkcs8 -in in_file.pem -out out_file.der -topk8 -nocrypt -outform der That works fine, but some people don't understand how to do that nor do they want to. So I would like to convert PEM files to DER files automatically within the program. Is it as simple as striping the "-----BEGIN CERTIFICATE-----" and "-----END CERTIFICATE-----" from the PEM or is some other transformation required as well? I've been told that between those markers that it's just b64 encoded DER. Here's some code that demonstrates the issue: // load the private key CryptoPP::RSA::PrivateKey PK; CryptoPP::ByteQueue bytes; try { CryptoPP::FileSource File( rsa.c_str(), true, new CryptoPP::Base64Decoder() ); File.TransferTo( bytes ); bytes.MessageEnd(); // This line Causes BERDecodeError when a PEM encoded file is used PK.Load( bytes ); } catch ( CryptoPP::BERDecodeErr ) { // Convert PEM to DER and try to load the key again } I'd like to avoid making system calls to openssl and do the transformation entirely in Crypto++ so that users can provide either format and things "just work". Thanks for any advice.

    Read the article

  • Use MySQL trigger to update another table when duplicate key found

    - by Jason
    Been scratching my head on this one, hoping one of you kind people and direct me towards solving this problem. I have a mysql table of customers, it contains a lot of data, but for the purpose of this question, we only need to worry about 4 columns 'ID', 'Firstname', 'Lastname', 'Postcode' Problem is, the table contains a lot of duplicated customers. A new table is being created where each customer is unique and for us, we decide a unique customer is based on 'Firstname', 'Lastname' and 'Postcode' However, (this is the important bit) we need to ensure each new "unique" customer record also can be matched to the original multiple entries of that customer in the original table. I believe the best way to do this is to have a third table, that has 'NewUniqueID', 'OldCustomerID'. So we can search this table for 'NewUniqueID' = '123' and it would return multiple 'OldCustomerID' values where appropriate. I am hoping to make this work using a trigger and the on duplicate key syntax. So what would happen is as follows: An query is run taking the old customer table and inserting it in to the new unique table. (A standard Insert Select query) On duplicate key continue adding records, but add one entry in to the third table noting the 'NewUniqueID' that duped along with the 'OldCustomerID' of the record we were trying to insert. Hope this makes sense, my apologies if it isn't clear. I welcome and appreciate any thoughts on this one! Many thanks Jason

    Read the article

< Previous Page | 69 70 71 72 73 74 75 76 77 78 79 80  | Next Page >