Search Results

Search found 19385 results on 776 pages for 'canonical link'.

Page 730/776 | < Previous Page | 726 727 728 729 730 731 732 733 734 735 736 737  | Next Page >

  • jquery show hidden div

    - by Fahad
    Firstly, I'm sort of embarrassed asking about this, so many people have already asked this question but even after having gone through so many posts, I'm unable to achieve what I want. Basically, a div, initially hidden, has to be displayed on a button click. I tried hiding the div using display:none and hide() and then displaying it using show(), toggle(), and css("display","block"). Using all sorts of combinations of the above, I was still unable to get the result. Code: <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <link href="css/smoothness/jquery-ui-1.9.2.custom.min.css" rel="stylesheet" type="text/css" /> <script src="jQuery/jquery-1.8.3.min.js" type="text/javascript"></script> <script src="jQuery/jquery-ui-1.9.2.custom.min.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function () { $('#one').hide(); $('#Button1').click(function () { $('#one').toggle(500); }); }); </script> </head> <body> <form id="form1" runat="server"> <div id="one" style="height: 20px;width:200px; background-color: Red; "> </div> <asp:Button ID="Button1" runat="server" Text="Show" /> </form> </body> </html> On button click, the div is shown for a brief second before it disappears again. The same thing happens if I use show() instead of toggle() in the above code. Again the same thing if I set style="display:none" to the div instead of using hide() and then use show() or toggle(). I also tried using $('#one').css("display","block"); but again, the same result. Can anyone please tell me where I'm going wrong. Just started learning jQuery and it is really frustrating when something apparently so simple will not work. Thanks in advance. :)

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • Converting Multiple files to zip and saving them in ownCloud

    - by user1055380
    I wanted to convert an array with some css, js and html files into a zip file and save them in ownCloud (it has it's own framework but it's knowledge is not required.) What I am saving is an infinite loop of zip files, as in, a zip inside a zip so I can't even check that the code is working correctly or not. Please help. Here is the link to the code. <?php /* creates a compressed zip file */ $filename = $_GET["filename"]; function create_zip($files = array(),$destination = '',$overwrite = false) { //if the zip file already exists and overwrite is false, return false if(file_exists($destination) && !$overwrite) { return false; } //vars $valid_files = array(); //if files were passed in... if(is_array($files)) { //cycle through each file foreach($files as $file => $local) { //make sure the file exists if(file_exists($file)) { $valid_files[$file] = $local; } } } //if we have good files... if(count($valid_files)) { //create the archive $zip = new ZipArchive(); if($zip->open($destination,$overwrite ? ZIPARCHIVE::OVERWRITE : ZIPARCHIVE::CREATE) !== true) { return false; } //add the files foreach($valid_files as $file => $local) { $zip->addFile($file, $local); } //debug //echo 'The zip archive contains ',$zip->numFiles,' files with a status of ',$zip->status; //close the zip -- done! $zip->close(); //check to make sure the file exists return file_exists($destination); } else { return false; } } $files_to_zip = array( 'apps/impressionist/css/mappingstyle.css' => '/css/mappingstyle.css', 'apps/impressionist/css/style.css' => '/css/style.css', 'apps/impressionist/js/jquery.js' => '/scripts/jquery.js', 'apps/impressionist/js/impress.js' => '/scripts/impress.js', realpath('apps/impressionist/output/'.$filename.'.html') => $filename.'.html' ); //if true, good; if false, zip creation failed $result = create_zip($files_to_zip, $filename.'.zip'); $save_file = OC_App::getStorage('impressionist'); $save_file ->file_put_contents($filename.'.zip',$files_to_zip); ?>

    Read the article

  • [CakePHP] I am so confused. What should I write in the default.ctp

    - by kwokwai
    Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • Flexslider position of previous and next slides

    - by TJ15
    I am using the basic flexslider, I wantto display some of the previous and next , so if slide 2 is showing you will see part of slide 1 to the left and part of slide 3 to the right. <!DOCTYPE html> <head> <link rel="stylesheet" href="flexslider.css" type="text/css"> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.6.2/jquery.min.js"></script> <style> .container {overflow: hidden; width: 100%} .flexslider {max-width: 500px; width: 500px; margin: 0 auto} .content {background: #f2f2f2; max-width: 500px; display: block; margin: 0 auto} .flex-viewport {overflow: visible !important} </style> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <div class="container"> <div class="flexslider"> <ul class="slides"> <li><img src="785.jpg" /></li> <li><img src="785.jpg" /></li> <li><img src="785.jpg" /></li> <li><img src="785.jpg" /></li> </ul> </div> </div> <script src="jquery.flexslider.js"></script> <script> jQuery(document).ready(function($) { // You can use the locally-scoped $ in here as an alias to jQuery. $(window).load(function() { $('.flexslider').flexslider(); }); }); </script> </body> </html> I have reduced the image to 70% and positioned it in the middle of the page. I want to have the next and previous slides visible on either side of the main pic but no idea where to make the appropriate changes (I assume in the js file). I thought this was a margin issue but setting this to 0 in styles makes no difference. Has anyone done this and can provide some advice?

    Read the article

  • Sliding panel in the middle of the page. Z-index given not working

    - by Nehal Rupani
    Hi all, I am implementing sliding panel element but problem is when i slide out other div element is floating down. I guess and tried to give z-index to element which i am sliding but it doesn't seems to work. Let me put code for both div. <div class="vrcontrol"> <div class="slide-out-div"> <a class="handle" href="http://link-for-non-js-users.html">Content</a> <h3>Contact me</h3> <p>Thanks for checking out my jQuery plugin, I hope you find this useful. </p> <p>This can be a form to submit feedback, or contact info</p> </div> This is div which i am sliding in and out and beneath is code of effective div. <div class="askform"> <p class="titletext">Ask an Expert Trade Forum</p> <p class="detailtext">WD-40’s leading source for DIY tips and tricks.</p> <span> <form id="askform" name="askform" action="" method="post"> <span class="left"><input name="input" type="text" class="askinputbox"/></span><span class="marginleft"><input type="image" src="images/search_icon.gif" /></span> </form> </span> <div class="followus"> <span class="followtext">Follow us on</span><span class="right"><img src="images/bookmark.jpg" width="121" height="45" alt="Bookmark" /></span> </div> </div> Sliding div is in left portion of the page and effective div is in right portion of the page. I guess something with z-index, positioning element and overflow properties will do something.

    Read the article

  • jquery use of :last and val()

    - by dole doug
    I'm trying to run the code from http://jsfiddle.net/ddole/AC5mP/13/ on my machine and the approach I've use is below or here. Do you know why that code doesn't work on my machine. Firebug doesn't help me and I can't solve the problem. I think that I need another pair of eyes :((( <!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <title>jQuery UI Dialog - Modal form</title> <link type="text/css" href="css/ui-lightness/jquery-ui-1.8.21.custom.css" rel="stylesheet" /> <script type="text/javascript" src="js/jquery-1.7.2.min.js"></script> <script type="text/javascript" src="js/jquery-ui-1.8.21.custom.min.js"></script> <script type="text/javascript" > jQuery(function($) { $('.helpDialog').hide(); $('.helpButton').each(function() { $.data(this, 'dialog', $(this).next('.helpDialog').dialog({ autoOpen: false, modal: true, width: 300, height: 250, buttons: { "Save": function() { alert($('.helpText:last').val()); $(this).dialog( "close" ); }, Cancel: function() { $(this).dialog( "close" ); } } }) ); }).click(function() { $.data(this, 'dialog').dialog('open'); return false; }); }); </script> </head> <body> <span class="helpButton">Button</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 2</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 3</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 4</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> <span class="helpButton">Button 5</span> <div class="helpDialog"> <input type="text" class="helpText" /> </div> </body>

    Read the article

  • What variable dictates position of non-focused elements in the roundabout plugin?

    - by kristina childs
    Part of the problem here is that i'm not sure what the best language to use in order to find the solution. I search and searched so please forgive if this is already a thread somewhere. I'm using the roundabout plugin to cycle through 3 divs. Each div is 794px wide, which makes the roundabout-in-focus element 794 and the two not in focus 315.218px wide, positioned so half of each is hidden by the in-focus div. This is all well and good, however the total width of the display needs to stay within 1000px (ideally 980px, but i can fudge if need be.) Basically I want to make the non-focused divs be 3/4 hidden by the in-focus div but for the life of me can't figure out what variables i need to edit in order to do it. Unfortunately it's not one of the many easily-changed options like z-index and minScale. i tried minScale but it's clear this isn't going to work. the plugin outputs this code: <li class="roundabout-moveable-item" style="position: absolute; left: -57px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i need to find out what changes the left positioning so it's shifted closer to the center of the stage, like this: <li class="roundabout-moveable-item" style="position: absolute; left: 5px; top: 205px; width: 319.982px; height: 149.513px; opacity: 0.7; z-index: 146; font-size: 5.6px;"> i tried playing with the positioning functions of the plugin but all that did was shift everything in tandem left or right. any help is greatly appreciated. this site is going to be awesome once i figure out all this jquery stuff! here is a link to my .js file: http://avalon.eaw.com/scripts/jquery.roundabout2.js i've got an overflow:hidden on the to help guide the positioning of those no-focused items.

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • Methodology to understanding JQuery plugin & API's developed by third parties

    - by Taoist
    I have a question about third party created JQuery plug ins and API's and the methodology for understanding them. Recently I downloaded the JQuery Masonry/Infinite scroll plug in and I couldn't figure out how to configure it based on the instructions. So I downloaded a fully developed demo, then manually deleted everything that wouldn't break the functionality. The code that was left allowed me to understand the plug in much greater detail than the documentation. I'm now having a similar issue with a plug in called JQuery knob. http://anthonyterrien.com/knob/ If you look at the JQuery Knob readme file it says this is working code: <input type="text" value="75" class="dial"> $(function() { $('.dial') .trigger( 'configure', { "min":10, "max":40, "fgColor":"#FF0000", "skin":"tron", "cursor":true } ); }); But as far as I can tell it isn't at all. The read me also says the Plug in uses Canvas. I am wondering if I am suppose to wrap this code in a canvas context or if this functionality is already part of the plug in. I know this kind of "question" might not fit in here but I'm a bit confused on the assumptions around reading these kinds of documentation and thought I would post the query regardless. Curious to see if this is due to my "newbi" programming experience or if this is something seasoned coders also fight with. Thank you. Edit In response to Tyanna's reply. I modified the code and it still doesn't work. I posted it below. I made sure that I checked the Google Console to insure the basics were taken care of, such as not getting a read-error on the library. <!DOCTYPE html> <meta charset="UTF-8"> <title>knob</title> <link rel="stylesheet" href="http://ajax.googleapis.com/ajax/libs/jqueryui/1.7.2/themes/hot-sneaks/jquery-ui.css" type="text/css" /> <script type="text/javascript" src="https://ajax.googleapis.com/ajax/libs/jquery/1.7.2/jquery.js" charset="utf-8"></script> <script src="https://ajax.googleapis.com/ajax/libs/jqueryui/1.8.21/jquery-ui.min.js"></script> <script src="js/jquery.knob.js"></script> <div id="button1">test </div> <script> $(function() { $("#button1").click(function () { $('.dial').trigger( 'configure', { "min":10, "max":40, "fgColor":"#FF0000", "skin":"tron", "cursor":true } ); }); }); </script>

    Read the article

  • CSS Hidden DIV Form Submit

    - by Michael
    Using CSS, when a link is clicked it brings up a hidden DIV that contains a form. The user will then enter information and then submit the form. I'd like the hidden DIV to remain visisble, and a 'success message' to be displayed after submission. Then the user will have the option of closing the DIV. I can't get it to work without reloading the page, which causes the DIV to become hidden again. Any ideas? <body> <a href="javascript:showDiv()" style="color: #fff;">Click Me</a> <!--POPUP--> <div id="hideshow" style="visibility:hidden;"> <div id="fade"></div> <div class="popup_block"> <div class="popup"> <a href="javascript:hideDiv()"> <img src="images/icon_close.png" class="cntrl" title="Close" /> </a> <h3>Remove Camper</h3> <form method="post" onsubmit="email.php"> <p><input name="Name" type="text" /></p> <p><input name="Submit" type="submit" value="submit" /></p> </form> <div id="status" style="display:none;">success</div> </div> </div> </div> <!--END POPUP--> <script language=javascript type='text/javascript'> function hideDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'hidden'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'hidden'; } else { // IE 4 document.all.hideshow.style.visibility = 'hidden'; } } } function showDiv() { if (document.getElementById) { // DOM3 = IE5, NS6 document.getElementById('hideshow').style.visibility = 'visible'; } else { if (document.layers) { // Netscape 4 document.hideshow.visibility = 'visible'; } else { // IE 4 document.all.hideshow.style.visibility = 'visible'; } } } </script> </body>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • List of checkboxes

    - by Andrea Girardi
    Hi all, Happy New Year to all. I'm a newbie in VB.NET and ASP.NET. This is my problem: I retrieve a list of records from DB and, for every row, I need to show 4 checkboxes. I can use a checkboxlist for every rows, but it's not so clear how I can process the results after the submit. I've some object and some operations available for that object. From database I extract a list of object with all operations. For every operation I want to show a check box to enable or disable the operation. The result is something like that: OBJ1 - url - [] [x] [] OBJ2 - url - [] [x] [x] On url I've an href to another page created using the Id retrieved from DB. To create that I used this code: <td class="column-filename"> <strong> <asp:Label runat="server" Text='<%#DataBinder.Eval(Container.DataItem, "GroupName")%>'></asp:Label> </strong> </td> <td align="left"> <span style="vertical-align:middle"> <asp:CheckBoxList runat="server" ID="operations" RepeatDirection="Horizontal" RepeatLayout="Table"> <asp:ListItem Text="View"></asp:ListItem> <asp:ListItem Text="Upload"></asp:ListItem> <asp:ListItem Text="Move"></asp:ListItem> <asp:ListItem Text="Delete"></asp:ListItem> <asp:ListItem Text="Rename"></asp:ListItem> <asp:ListItem Text="Replace"></asp:ListItem> </asp:CheckBoxList> </span> </td> </asp> </asp> my problem is: how can I parse all checkboxes? could you help me or send me a link or any other resources to solve my issue? many thanks! Andrea

    Read the article

  • Jquery - Loading a page with .load and selector doesn't execute script?

    - by PirateKitten
    I'm trying to load one page into another using the .load() method. This loaded page contains a script that I want to execute when it has finished loading. I've put together a barebones example to demonstrate: Index.html: <html> <head> <title>Jquery Test</title> <script type="text/javascript" src="script/jquery-1.3.2.min.js"></script> <script type="text/javascript"> $(document).ready(function() { $('#nav a').click(function() { $('#contentHolder').load('content.html #toLoad', '', function() {}); return false; }); }); </script> </head> <body> <div id="nav"> <a href="content.html">Click me!</a> </div> <hr /> <div id="contentHolder"> Content loaded will go here </div> </body> </html> Content.html: <div id="toLoad"> This content is from content.html <div id="contentDiv"> This should fade away. </div> <script type="text/javascript"> $('#contentDiv').fadeOut('slow', function() {} ); </script> </div> When the link is clicked, the content should load and the second paragraph should fade away. However it doesn't execute. If I stick a simple alert("") in the script of content.html it doesn't execute either. However, if I do away with the #toLoad selector in the .load() call, it works fine. I am not sure why this is, as the block is clearly in the scope of the #toLoad div. I don't want to avoid using the selector, as in reality the content.html will be a full HTML page, and I'll only want a select part out of it. Any ideas? If the script from content.html was in the .load() callback, it works fine, however I obviously don't want that logic contained within index.html. I could possibly have the callback use .getScript() to load "content.html.js" afterwards and have the logic in there, that seems to work? I'd prefer to keep the script in content.html, if possible, so that it executes fine when loaded normally too. In fact, I might do this anyway, but I would like to know why the above doesn't work.

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • preload image with jquery

    - by robertdd
    Updated: firs append a empty image and a span with some text hide the loading image, after it's load it's show the image var pathimg = "path/to/image" + "?" + (new Date()).getTime(); $('#somediv').append('<div><span>loading..</span><img id="idofimage" src="" alt="" ></div>') jQuery("#idofimage").hide().attr({"src":pathimg}) .load(function() { jQuery(this).show(); }); old post ok, I spent 2 days trying to preloaded images but no succes! i have this function: jQuery.getlastimage = function(id) { $.getjs(); $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id).html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>'); }); }; lastimg is the name of the image while the image loading i want to appear a gif or a text "Loading...". the function will get something like this: <div class="upimage"> <ul class="thumbs" id="upimagesQueue"> **<li id="#upimagesRIFDIB"> <a href="uploads/0001.jpg?1271800088379"> <img src="uploads/0001.jpg?1271800088379" alt="0001.jpg" id="RIFDIB" class="thumbs"> </a> </li>** <li> .... </li> </ul> </div> i tried like this: ... $.post('operations.php', {'operation':'getli', 'id':id,}, function(lastimg){ $("#upimages" + id) .html('<a href="uploads/'+ lastimg +'?'+ (new Date()).getTime() +'"><img class="thumbs" id="' + id + '" alt="' + lastimg + '" src="uploads/' + lastimg +'?'+ (new Date()).getTime() + '" /></a>') .hide() .load(function() { $(this).show(); }); ... but all the <li> will hide and after is loading the image appear, i want the <li> to apear with a gif or a text in it and after the image is loaded the link and the image to apear! How to do this? Anyone have an idea? Thanks!

    Read the article

  • Route Angular to New Controller after Login

    - by MizAkita
    I'm kind of stuck on how to route my angular app to a new controller after login. I have a simple app, that uses 'loginservice'... after logging in, it then routes to /home which has a different template from the index.html(login page). I want to use /home as the route that displays the partial views of my flightforms controllers. What is the best way to configure my routes so that after login, /home is the default and the routes are called into that particular templates view. Seems easy but I keep getting the /login page when i click on a link which is suppose to pass the partial view into the default.html template: var app= angular.module('myApp', ['ngRoute']); app.config(['$routeProvider', function($routeProvider) { $routeProvider.when('/login', { templateUrl: 'partials/login.html', controller: 'loginCtrl' }); $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); }]); flightforms.config(['$routeProvider', function($routeProvider){ //sub pages $routeProvider.when('/home', { templateUrl: 'partials/default.html', controller: 'defaultCtrl' }); $routeProvider.when('/status', { templateUrl: 'partials/subpages/home.html', controller: 'statusCtrl' }); $routeProvider.when('/observer-ao', { templateUrl: 'partials/subpages/aobsrv.html', controller: 'obsvaoCtrl' }); $routeProvider.when('/dispatch', { templateUrl: 'partials/subpages/disp.html', controller: 'dispatchCtrl' }); $routeProvider.when('/fieldmgr', { templateUrl: 'partials/subpages/fieldopmgr.html', controller: 'fieldmgrCtrl' }); $routeProvider.when('/obs-backoffice', { templateUrl: 'partials/subpages/obsbkoff.html', controller: 'obsbkoffCtrl' }); $routeProvider.when('/add-user', { templateUrl: 'partials/subpages/users.html', controller: 'userCtrl' }); $routeProvider.otherwise({ redirectTo: '/status' }); }]); app.run(function($rootScope, $location, loginService) { var routespermission=['/home']; //route that require login $rootScope.$on('$routeChangeStart', function(){ if( routespermission.indexOf($location.path()) !=-1) { var connected=loginService.islogged(); connected.then(function(msg) { if(!msg.data) $location.path('/login'); }); } }); }); and my controllers are simple. Here's a sample of what they look like: var flightformsControllers = angular.module('flightformsController', []); flightforms.controller('fieldmgrCtrl', ['$scope','$http','loginService', function($scope,loginService) { $scope.txt='You are logged in'; $scope.logout=function(){ loginService.logout(); } }]); Any ideas on how to get my partials to display in the /home default.html template would be appreciated.

    Read the article

  • Where can I find sample XHTML5 source codes?

    - by Bytecode Ninja
    Where can I find sample *X*HTML 5 pages? I mainly want to know if it is possible to mix and match XHTML 5 with other XML languages just like XHTML 1 or not. For example is something like this valid in XHTML 5? <!DOCTYPE html PUBLIC "WHAT SHOULD BE HERE?" "WHAT SHOULD BE HERE?"> <html xmlns="WHAT SHOULD BE HERE?" xmlns:ui="http://java.sun.com/jsf/facelets"> <head> <title><ui:insert name="title">Default title</ui:insert></title> <link rel="stylesheet" type="text/css" href="./css/main.css"/> </head> <body> <div id="header"> <ui:insert name="header"> <ui:include src="header.xhtml"/> </ui:insert> </div> <div id="left"> <ui:insert name="navigation" > <ui:include src="navigation.xhtml"/> </ui:insert> </div> <div id="center"> <br /> <span class="titleText"> <ui:insert name="title" /> </span> <hr /> <ui:insert name="content"> <div> <ui:include src="content.xhtml"/> </div> </ui:insert> </div> <div id="right"> <ui:insert name="news"> <ui:include src="news.xhtml"/> </ui:insert> </div> <div id="footer"> <ui:insert name="footer"> <ui:include src="footer.xhtml"/> </ui:insert> </div> </body> </html> Thanks in advance.

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • CodeIgniter Third party class not loading

    - by Jatin Soni
    I am trying to implement Dashboard widget class (found here: http://harpanet.com/programming/php/codeigniter/dashboard/index#installation) but it is giving me error Unable to load the requested class I have tried to add this class in autoload as well as menually to my controller $this->load->library('dash') but this also giving the same error. I have checked dash.php and found below method private function __example__() but can't understand what the developer is saying in comment. class Dash { private function __example__() { /* * This function is purely to show an example of a dashboard method to place * within your own controller. */ // load third_party hArpanet dashboard library $this->load->add_package_path(APPPATH.'third_party/hArpanet/hDash/'); $dash =& $this->load->library('dash'); $this->load->remove_package_path(APPPATH.'third_party/hArpanet/hDash/'); // configure dashboard widgets - format: type, src, title, cols, alt (for images) $dash->widgets = array( array('type'=>'oop', 'src'=>'test_dash', 'title'=>'Test OOP Widget', 'cols'=>3), // if 'title' is set to FALSE, the title block is omitted entirely // note: this is an 'html' widget but is being fed content from a local method array('type'=>'html', 'src'=>self::test_method(), 'title'=>false, 'cols'=>3), array('type'=>'file', 'src'=>'saf_inv.htm', 'title'=>'Safety Investigation'), // multi-content widget - set widget title in outer array (also note use of CI anchor to create a link) array('title'=>anchor('tz', 'TARGET ZERO'), // sub-content follows same array format as single content widget // 'img' content can also have an 'alt' text array('type'=>'img', 'src'=>'saf_tzout.gif', 'alt'=>'Action Completed'), array('type'=>'file', 'src'=>'saf_tz.htm'), array('type'=>'file', 'src'=>'ave_close.htm', 'title'=>'Average Time to Close') ), array('type'=>'file', 'src'=>'saf_meet.htm', 'title'=>'Safety Meeting'), array('type'=>'file', 'src'=>'saf_acc.htm', 'title'=>'Accident Investigation'), array('type'=>'file', 'src'=>'saf_hazmat.htm', 'title'=>anchor('hazmat', 'HAZMAT')), array('type'=>'file', 'src'=>'saf_cont.htm', 'title'=>'Loss of Containment'), array('type'=>'file', 'src'=>'saf_worksinfo.htm', 'title'=>'Works Information'), // an action widget - 'clear' will generate a blank widget with a style of clear:both array('type'=>'clear'), // multi-content widget - width can be set using the 'cols' param in outer array array('title'=>'RAG Report', 'cols' => 2, array('type'=>'file', 'src'=>'saf_rag.htm'), array('type'=>'img', 'src'=>'ProcSaf.gif')), array('type'=>'file', 'src'=>'saf_chrom.htm', 'title'=>'Chrome checks'), ); // populate the view variable $widgets = $dash->build('safety'); // render the dashboard $this->load->view('layout_default', $widgets); } ................... } // end of Dash class Installation path is root/application/third_party/hArpanet/hDash/libraries/dash.php How can I load this class to my system and use widgets?

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • How can I progrommatically change the target framework from 4.0 to 3.5 of a project/solution?

    - by scott
    Edit 3: After more googling it looks like you can't have the TargetFrameworkMoniker property in a .NET 3.5 application. So I guess I should be asking a different question. How do I change the Target framework from 4.0 to 3.5? Unfortunately, I can only find stuff on how to go the other way. or better yet how do i progrommatically set the target framework version of a project to something other than 4.0? Original question: I just switched to vs2010. I have an application that uses .net 3.5. It loads plugins which are generated by a different app. The plugins are using .net 4 and there for cannot be loaded. I'm using EnvDTE.Project to create a project and set the settings. I can't find what setting needs to be set for this. Edit 1: I'm generating code for about 50 solutions. When I made the switch from vs2005 to vs2010 the projects in those solutions are defaulting to .NET Framework 4.0. So I need to set the .NET Framework to 3.5 when I am generating the code for these solutions. Edit 2: After a lot of googling I found this. so then I tried this: loProp = vsGetProperty("TargetFrameworkMoniker"); vsSetValue(loProp, ".NETFramework,Version=v3.5"); the definitions for those two methods are below. as far as I can tell they do the same this as project.Properties.Item("TargetFrameworkMoniker").Value = ".NETFramework,Version=v4.0,Profile=Client"; I start getting an Property Unavailable Exception later in the code. When I remove the new lines everything works except the projects target framework is still 4.0. The code generators target framework is 3.5 so I can't use the FrameworkName class like shown in the second example in that link. here is vsGetProperty protected Property vsGetProperty(string aProperty) { bool lbDone = false; int liCount = 0; Property loProp; while (!lbDone && liCount < pMaxRetries) { try { loProp = pProject.Properties.Item(aProperty); lbDone = true; return loProp; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } return null; } and vsSetValue protected void vsSetValue(Property aProperty, string aValue) { bool lbDone = false; int liCount = 0; while (!lbDone && liCount < pMaxRetries) { try { aProperty.Value = aValue; lbDone = true; } catch (System.Runtime.InteropServices.COMException loE) { liCount++; if ((uint)loE.ErrorCode == 0x80010001) { // RPC_E_CALL_REJECTED - sleep half sec then try again System.Threading.Thread.Sleep(pDelayBetweenRetry); } } } }

    Read the article

  • Making Visual C++ DLL from C++ class

    - by prosseek
    I have the following C++ code to make dll (Visual Studio 2010). class Shape { public: Shape() { nshapes++; } virtual ~Shape() { nshapes--; }; double x, y; void move(double dx, double dy); virtual double area(void) = 0; virtual double perimeter(void) = 0; static int nshapes; }; class __declspec(dllexport) Circle : public Shape { private: double radius; public: Circle(double r) : radius(r) { }; virtual double area(void); virtual double perimeter(void); }; class __declspec(dllexport) Square : public Shape { private: double width; public: Square(double w) : width(w) { }; virtual double area(void); virtual double perimeter(void); }; I have the __declspec, class __declspec(dllexport) Circle I could build a dll with the following command CL.exe /c example.cxx link.exe /OUT:"example.dll" /DLL example.obj When I tried to use the library, Square* square; square->area() I got the error messages. What's wrong or missing? example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall ... Square::area(void)" (?area@Square@@UAENXZ) ADDED Following wengseng's answer, I modified the header file, and for DLL C++ code, I added #define XYZLIBRARY_EXPORT However, I still got errors. example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Circle::Circle(double)" (__imp_??0Circle@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2019: unresolved external symbol "__declspec(dllimport) public: __th iscall Square::Square(double)" (__imp_??0Square@@QAE@N@Z) referenced in function "protected: virtual void __thiscall TestOne::SetUp(void)" (?SetUp@TestOne@@MAEXXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::area(void)" (?area@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Square::perimeter(void)" (?perimeter@Square@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::area(void)" (?area@Circle@@UAENXZ) example_unittest.obj : error LNK2001: unresolved external symbol "public: virtual double __thiscall Circle::perimeter(void)" (?perimeter@Circle@@UAENXZ)

    Read the article

< Previous Page | 726 727 728 729 730 731 732 733 734 735 736 737  | Next Page >