Search Results

Search found 36242 results on 1450 pages for 'value converter'.

Page 731/1450 | < Previous Page | 727 728 729 730 731 732 733 734 735 736 737 738  | Next Page >

  • How to exclude rows where matching join is in an SQL tree

    - by Greg K
    Sorry for the poor title, I couldn't think how to concisely describe this problem. I have a set of items that should have a 1-to-1 relationship with an attribute. I have a query to return those rows where the data is wrong and this relationship has been broken (1-to-many). I'm gathering these rows to fix them and restore this 1-to-1 relationship. This is a theoretical simplification of my actual problem but I'll post example table schema here as it was requested. item table: +------------+------------+-----------+ | item_id | name | attr_id | +------------+------------+-----------+ | 1 | BMW 320d | 20 | | 1 | BMW 320d | 21 | | 2 | BMW 335i | 23 | | 2 | BMW 335i | 34 | +------------+------------+-----------+ attribute table: +---------+-----------------+------------+ | attr_id | value | parent_id | +---------+-----------------+------------+ | 20 | SE | 21 | | 21 | M Sport | 0 | | 23 | AC | 24 | | 24 | Climate control | 0 | .... | 34 | Leather seats | 0 | +---------+-----------------+------------+ A simple query to return items with more than one attribute. SELECT item_id, COUNT(DISTINCT(attr_id)) AS attributes FROM item GROUP BY item_id HAVING attributes > 1 This gets me a result set like so: +-----------+------------+ | item_id | attributes | +-----------+------------+ | 1 | 2 | | 2 | 2 | | 3 | 2 | -- etc. -- However, there's an exception. The attribute table can hold a tree structure, via parent links in the table. For certain rows, parent_id can hold the ID of another attribute. There's only one level to this tree. Example: +---------+-----------------+------------+ | attr_id | value | parent_id | +---------+-----------------+------------+ | 20 | SE | 21 | | 21 | M Sport | 0 | .... I do not want to retrieve items in my original query where, for a pair of associated attributes, they related like attributes 20 & 21. I do want to retrieve items where: the attributes have no parent for two or more attributes they are not related (e.g. attributes 23 & 34) Example result desired, just the item ID: +------------+ | item_id | +------------+ | 2 | +------------+ How can I join against attributes from items and exclude these rows? Do I use a temporary table or can I achieve this from a single query? Thanks.

    Read the article

  • Why can't you return a List from a Compiled Query?

    - by Andrew
    I was speeding up my app by using compiled queries for queries which were getting hit over and over. I tried to implement it like this: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id) End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, List(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ (From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u).ToList()) This did not work and I got this error message: Type : System.ArgumentNullException, mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089 Message : Value cannot be null. Parameter name: value However, when I changed my compiled query to return IQueryable instead of List like so: Function Select(ByVal fk_id As Integer) As List(SomeEntity) Using db As New DataContext() db.ObjectTrackingEnabled = False Return CompiledSelect(db, fk_id).ToList() End Using End Function Shared CompiledSelect As Func(Of DataContext, Integer, IQueryable(Of SomeEntity)) = _ CompiledQuery.Compile(Function(db As DataContext, fk_id As Integer) _ From u In db.SomeEntities _ Where u.SomeLinkedEntity.ID = fk_id _ Select u) It worked fine. Can anyone shed any light as to why this is? BTW, compiled queries rock! They sped up my app by a factor of 2.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • PHP - uninitialized array offset

    - by kimmothy16
    Hey everyone, I am using PHP to create a form with an array of fields. Basically you can add an unlimited number of 'people' to the form and each person has a first name, last name, and phone number. The form requires that you add a phone number for the first person only. If you leave the phone number field blank on any others, the handler file is supposed to be programmed to use the phone number from the first person. So, my fields are: person[] - a hidden field with a value that is this person's primary key. fname[] - an input field lname[] - an input field phone[] - an input field my form handler looks like this: $people = $_POST['person'] $counter = 0; foreach($people as $person): if(phone[$counter] == '') { // use $phone[0]'s phone number } else { // use $phone[$counter] number } $counter = $counter + 1; endforeach; PHP doesn't like this though, it is throwing me an Notice: Uninitialized string offset error. I debugged it by running the is_array function on people, fname, lname, and phone and it returns true to being an array. I can also manually echo out $phone[2], etc. and get the correct value. I've also ran is_int on the $counter variable and it returned true, so I'm unsure why this isn't working as intended? Any help would be great!

    Read the article

  • How do I use curl to display a table on a page?

    - by user272899
    I want to use curl to retrieve a table from an external page. So far my code retrieves all data from the page. I have read that using preg_match or preg_replace is the way to go about it. This is my code so far: <?php $ch = curl_init() or die(curl_error()); curl_setopt($ch, CURLOPT_URL,"http://www.megaupload.com/?d=XE30L1GA&w=631&h=392"); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); $data1=curl_exec($ch) or die(curl_error()); echo "<font color=black face=verdana size=3>".$data1."</font>"; echo curl_error($ch); curl_close($ch); ?> This is the data I want to retrieve from the page: <FORM method="POST" id="captchaform"> <INPUT type="hidden" name="captchacode" value="1a589e0a53c54f937eb8"> <INPUT type="hidden" name="megavar" value="bed55b1a7a26e4bb0aa11df4188f58bda6958d72856a637ca55cbda4c24c89b97d52e39e3a2d1d26082273dec61e68416bd929d566cf63cd8441e9f6166d667618060608c5d63c9341e72fc036ea4ed1ec8d099bc488fa1f3c5df7228e10a0f79c4e5fb78fe41f0d9873194c56f94dfbcc008e4a7c8ebc58c8169d42cb98a9a86d8cb6dfbae8791b9dfcf5a3119f7941cc07e9ba48934ad9b5f865cd32e71bf6d3a3954ddc4e75925aaf2c0ec6d1dd884ccc4d299be3e41957a967e68a143af49d6b7ff7b36dac725f20214e58feb32662e09f5840ac76cff67f7d99e67ffb485d72382dd20cece80e4307dfef720a51734d7f9a4a363de0950d3d0e927423642a79b2e68ed177d2ad2d877c1c2052969ec61737749b05864b3a74d241981d6b89"> <TR> <TD>Enter this </TD> <TD width="100" align="center" height="40"><img src="http://wwwq32.megaupload.com/gencap.php?23243f17c2404dd4.gif" border="0" alt=""></TD> <TD> here:</TD> <TD><input type="text" name="captcha" id="captchafield" maxlength="4" style="border:solid 1px; border-color:#C4C4C4; background-color:#F9F9F9; width:50px; height:25px;"></TD> </TR> </FORM>

    Read the article

  • Compiling GWT 2.6.1 at Java 7 source level

    - by Neeko
    I've recently updated my GWT project to 2.6.1, and started to make use of Java 7 syntax since 2.6 now supports Java 7. However, when I attempt to compile, I'm receiving compiler errors such as [ERROR] Line 42: '<>' operator is not allowed for source level below 1.7 How do I specify the GWT compiler to target 1.7? I was under the impression that it would do that by default, but I guess not. I've attempted cleaning the project, including deleting the gwt-unitCache directory but to no avail. Here is my Ant compile target. <target name="compile" depends="prepare"> <javac includeantruntime="false" debug="on" debuglevel="lines,vars,source" srcdir="${src.dir}" destdir="${build.dir}"> <classpath refid="project.classpath"/> </javac> </target> <target name="gwt-compile" depends="compile"> <java failonerror="true" fork="true" classname="com.google.gwt.dev.Compiler"> <classpath> <!-- src dir is added to ensure the module.xml file(s) are on the classpath --> <pathelement location="${src.dir}"/> <pathelement location="${build.dir}"/> <path refid="project.classpath"/> </classpath> <jvmarg value="-Xmx256M"/> <arg value="${gwt.module.name}"/> </java> </target>

    Read the article

  • Passing a outside variable into a <asp:sqldatasource> tag. ASP.NET 2.0

    - by MadMAxJr
    I'm designing some VB based ASP.NET 2.0, and I am trying to make more use of the various ASP tags that visual studio provides, rather than hand writing everything in the code-behind. I want to pass in an outside variable from the Session to identify who the user is for the query. <asp:sqldatasource id="DataStores" runat="server" connectionstring="<%$ ConnectionStrings:MY_CONNECTION %>" providername="<%$ ConnectionStrings:MY_CONNECTION.ProviderName %>" selectcommand="SELECT THING1, THING2 FROM DATA_TABLE WHERE (THING2 IN (SELECT THING2 FROM RELATED_DATA_TABLE WHERE (USERNAME = @user)))" onselecting="Data_Stores_Selecting"> <SelectParameters> <asp:parameter name="user" defaultvalue ="" /> </SelectParameters> </asp:sqldatasource> And on my code behind I have: Protected Sub Data_Stores_Selecting(ByVal sender As Object, ByVal e As System.Web.UI.WebControls.SqlDataSourceSelectingEventArgs) Handles Data_Stores.Selecting e.Command.Parameters("user").Value = Session("userid") End Sub Oracle squaks at me with ORA-01036, illegal variable name. Am I declaring the variable wrong in the query? I thought external variables share the same name with a @ prefixed. from what I understand, this should be placing the value I want into the query when it executes the select. EDIT: Okay, thanks for the advice so far, first error was corrected, I need to use : and not @ for the variable declaration in the query. Now it generates an ORA-01745 invalid host/bind variable name. EDIT AGAIN: Okay, looks like user was a reserved word. It works now! Thanks for other points of view on this one. I hadn't thought of that approach.

    Read the article

  • Image swap with a javascript onclick dropdown menu

    - by AzzyDude
    So I've got this code that has an image and when you click it a dropdown menu appears. Pretty simple. The code works fine but I'm trying to incorporate an image swap on click and I'm having difficulty. Here's the HTML and the JS (there's some CSS too, but I'll leave that out): HTML: <div id="header"> <dl class="dropdown"> <dt><a href="#"><img src="images/cogwheel_btn.png"/></a></dt> <dd> <ul> <li><a href="#">Favorites</a></li> <li><a href="#">History</a></li> </ul> </dd> </dl> </div> JS: $(document).ready(function() { $(".dropdown img.flag").addClass("flagvisibility"); $(".dropdown dt a").click(function() { $(".dropdown dd ul").toggle(); }); $(".dropdown dd ul li a").click(function() { var text = $(this).html(); $(".dropdown dt a span").html(text); $(".dropdown dd ul").hide(); $("#result").html("Selected value is: " + getSelectedValue("sample")); }); function getSelectedValue(id) { return $("#" + id).find("dt a span.value").html(); } $(document).bind('click', function(e) { var $clicked = $(e.target); if (!$clicked.parents().hasClass("dropdown")) $(".dropdown dd ul").hide(); }); $("#flagSwitcher").click(function() { $(".dropdown img.flag").toggleClass("flagvisibility"); }); });? I've tried adding lines like ("dt").empty(); and then ("dt").html("new_image") but it causes the dropdown functionality to stop working. Anyone any ideas?

    Read the article

  • Retrieving ids from MySQL query

    - by Matt Maclennan
    I am having trouble accessing the "model_id" and "brand_id" from the foreach loop that I am using. They are the right field names, because I have echoed them successfully, and I have also "var_dumped" the array, and the IDs are there. It is just a case of implementing the relevant links on each list section. Below is the code I have. <? $output = mysqli_query("SELECT * FROM bikes, bikeTypes WHERE bikes.model_id = bikeTypes.model_id"); $result = array(); while($row = mysqli_fetch_array($output)) { $result[$row['model']][] = $row; } foreach ($result as $category => $values) { echo "<li><a href='test.php?id=" . $row['model_id'] . "'>".$category.'</a><ul>'; foreach ($values as $value) { echo "<li><a href='details.php?id=" . $row['brand_id'] . "'>" . $value['bikeName'] . "</a></li>"; } echo '</ul>'; echo '</li>'; } ?>

    Read the article

  • How can I unit test my custom validation attribute

    - by MightyAtom
    I have a custom asp.net mvc class validation attribute. My question is how can I unit test it? It would be one thing to test that the class has the attribute but this would not actually test that the logic inside it. This is what I want to test. [Serializable] [EligabilityStudentDebtsAttribute(ErrorMessage = "You must answer yes or no to all questions")] public class Eligability { [BooleanRequiredToBeTrue(ErrorMessage = "You must agree to the statements listed")] public bool StatementAgree { get; set; } [Required(ErrorMessage = "Please choose an option")] public bool? Income { get; set; } .....removed for brevity } [AttributeUsage(AttributeTargets.Class)] public class EligabilityStudentDebtsAttribute : ValidationAttribute { // If AnyDebts is true then // StudentDebts must be true or false public override bool IsValid(object value) { Eligability elig = (Eligability)value; bool ok = true; if (elig.AnyDebts == true) { if (elig.StudentDebts == null) { ok = false; } } return ok; } } I have tried to write a test as follows but this does not work: [TestMethod] public void Eligability_model_StudentDebts_is_required_if_AnyDebts_is_true() { // Arrange var eligability = new Eligability(); var controller = new ApplicationController(); // Act controller.ModelState.Clear(); controller.ValidateModel(eligability); var actionResult = controller.Section2(eligability,null,string.Empty); // Assert Assert.IsInstanceOfType(actionResult, typeof(ViewResult)); Assert.AreEqual(string.Empty, ((ViewResult)actionResult).ViewName); Assert.AreEqual(eligability, ((ViewResult)actionResult).ViewData.Model); Assert.IsFalse(((ViewResult)actionResult).ViewData.ModelState.IsValid); } The ModelStateDictionary does not contain the key for this custom attribute. It only contains the attributes for the standard validation attributes. Why is this? What is the best way to test these custom attributes? Thanks

    Read the article

  • Have something loaded only when JList item is visibile

    - by elvencode
    Hello, i'm implementing a Jlist populated with a lot of elements. Each element corresponds to a image so i'd like to show a resized preview of them inside each row of the list. I've implemented a custom ImageCellRenderer extending the Jlabel and on getListCellRendererComponent i create the thumbnail if there'snt any for that element. Each row corresponds to a Page class where i store the path of the image and the icon applied to the JLabel. Each Page object is put inside a DefaultListModel to populate the JList. The render code is something like this: public Component getListCellRendererComponent( JList list, Object value, int index, boolean isSelected, boolean cellHasFocus) { Page page = (Page) value; if (page.getImgIcon() == null) { System.out.println(String.format("Creating thumbnail of %s", page.getImgFilename())); ImageIcon icon = new ImageIcon(page.getImgFilename()); int thumb_width = icon.getIconWidth() > icon.getIconHeight() ? 128 : ((icon.getIconWidth() * 128) / icon.getIconHeight()); int thumb_height = icon.getIconHeight() > icon.getIconWidth() ? 128 : ((icon.getIconHeight() * 128) / icon.getIconWidth()); icon.setImage(getScaledImage(icon.getImage(), thumb_width, thumb_height)); page.setImgIcon(icon); } setIcon(page.getImgIcon()); } I was thinking that only a certain item is visibile in the List the cell renderer is called but i'm seeing that all the thumnails are created when i add the Page object to the list model. I've tried to load the items and after set the model in the JList or set the model first and after starting appending the items but the results are the same. Is there any way to load the data only when necessary or do i need to create a custom control like a JScrollPanel with stacked items inside where i check myself the visibility of each elements? Thanks

    Read the article

  • Tomcat does not pick up the class file - the JSP file is not displayed

    - by blueSky
    I have a Java code which is a controller for a jsp page, called: HomeController.java. Code is as follows: @Controller public class HomeController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/mypage") public String home() { System.out.println("HomeController: Passing through..."); return "home"; } } There is nothing especial in the jsp page: home.jsp. If I go to this url: http://localhost:8080/adcopyqueue/mypage I can view mypage and everything works fine. Also in the tomcat Dos page I can see the comment: HomeController: Passing through... As expected. Now under the same directory that I have HomeController.java, I've created another file called: LoginController.java. Following is the code: @Controller public class LoginController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/loginpage") public String login() { System.out.println("LoginController: Passing through..."); return "login"; } } And under the same place which I have home.jsp, I've created login.jsp. Also under tomcat folders, LoginController.class exists under the same folder that HomeController.class exists and login.jsp exists under the same folder which home.jsp exists. But when I go to this url: http://localhost:8080/adcopyqueue/loginpage Nothing is displayed! I think tomcat does not pick up LoginController.class b/c on the tomcat Dos window, I do NOT see this comment: LoginController: Passing through... Instead I see following which I do not know what do they mean? [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:34) got manifest [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:36) manifest entrie s 8 The structure and the code for HomeController.java and LoginController.java plus the jsp files match. I have no idea why tomcat sees one of the files and not the other? Clean build did not help. Does anybody have any idea? Any help is greatly appraciated.

    Read the article

  • Deleting elements from stl set while iterating through it does not invalidate the iterators.

    - by pedromanoel
    I need to go through a set and remove elements that meet a predefined criteria. This is the test code I wrote: #include <set> #include <algorithm> void printElement(int value) { std::cout << value << " "; } int main() { int initNum[] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 }; std::set<int> numbers(initNum, initNum + 10); // print '0 1 2 3 4 5 6 7 8 9' std::for_each(numbers.begin(), numbers.end(), printElement); std::set<int>::iterator it = numbers.begin(); // iterate through the set and erase all even numbers for (; it != numbers.end(); ++it) { int n = *it; if (n % 2 == 0) { // wouldn't invalidate the iterator? numbers.erase(it); } } // print '1 3 5 7 9' std::for_each(numbers.begin(), numbers.end(), printElement); return 0; } At first, I thought that erasing an element from the set while iterating through it would invalidate the iterator, and the increment at the for loop would have undefined behavior. Even though, I executed this test code and all went well, and I can't explain why. My question: Is this the defined behavior for std sets or is this implementation specific? I am using gcc 4.3.3 on ubuntu 10.04 (32-bit version), by the way. Thanks!

    Read the article

  • Loading child entities with JPA on Google App Engine

    - by Phil H
    I am not able to get child entities to load once they are persisted on Google App Engine. I am certain that they are saving because I can see them in the datastore. For example if I have the following two entities. public class Parent implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.IDENTITY) @Extension(vendorName="datanucleus", key="gae.encoded-pk", value="true") private String key; @OneToMany(cascade=CascadeType.ALL) private List<Child> children = new ArrayList<Child>(); //getters and setters } public class Child implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.IDENTITY) @Extension(vendorName="datanucleus", key="gae.encoded-pk", value="true") private String key; private String name; @ManyToOne private Parent parent; //getters and setters } I can save the parent and a child just fine using the following: Parent parent = new Parent(); Child child = new Child(); child.setName("Child Object"); parent.getChildren().add(child); em.persist(parent); However when I try to load the parent and then try to access the children (I know GAE lazy loads) I do not get the child records. //parent already successfully loaded parent.getChildren.size(); // this returns 0 I've looked at tutorial after tutorial and nothing has worked so far. I'm using version 1.3.3.1 of the SDK. I've seen the problem mentioned on various blogs and even the App Engine forums but the answer is always JDO related. Am I doing something wrong or has anyone else had this problem and solved it for JPA?

    Read the article

  • Easiest way to remove Keys from a 2D Array?

    - by dbemerlin
    Hi, I have an Array that looks like this: array( 0 => array( 'key1' => 'a', 'key2' => 'b', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key2' => 'b', 'key3' => 'a' ), ... ) I need a function to get an array containing just a (variable) number of keys, i.e. reduce_array(array('key1', 'key3')); should return: array( 0 => array( 'key1' => 'a', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key3' => 'a' ), ... ) What is the easiest way to do this? If possible without any additional helper function like array_filter or array_map as my coworkers already complain about me using too many functions. The source array will always have the given keys so it's not required to check for existance. Bonus points if the values are unique (the keys will always be related to each other, meaning that if key1 has value a then the other key(s) will always have value b). My current solution which works but is quite clumsy (even the name is horrible but can't find a better one): function get_unique_values_from_array_by_keys(array $array, array $keys) { $result = array(); $found = array(); if (count($keys) > 0) { foreach ($array as $item) { if (in_array($item[$keys[0]], $found)) continue; array_push($found, $item[$keys[0]]); $result_item = array(); foreach ($keys as $key) { $result_item[$key] = $item[$key]; } array_push($result, $result_item); } } return $result; } Addition: PHP Version is 5.1.6.

    Read the article

  • Flex Tree with infinite parents and children

    - by Tempname
    I am working on a tree component and I am having a bit of the issue with populating the data-provider for this tree. The data that I get back from my database is a simple array of value objects. Each value object has 2 properties. ObjectID and ParentID. For parents the ParentID is null and for children the ParentID is the ObjectID of the parent. Any help with this is greatly appreciated. Essentially the tree should look something like this: Parent1 Child1 Child1 Child2 Child1 Child2 Parent2 Child1 Child2 Child3 Child1 This is the current code that I am testing with: public function setDataProvider(data:Array):void { var tree:Array = new Array(); for(var i:Number = 0; i < data.length; i++) { // do the top level array if(!data[i].parentID) { tree.push(data[i], getChildren(data[i].objectID, data)); } } function getChildren(objectID:Number, data:Array):Array { var childArr:Array = new Array(); for(var k:Number = 0; k < data.length; k++) { if(data[k].parentID == objectID) { childArr.push(data[k]); //getChildren(data[k].objectID, data); } } return childArr; } trace(ObjectUtil.toString(tree)); } Here is a cross section of my data: ObjectID ParentID 1 NULL 10 NULL 8 NULL 6 NULL 4 6 3 6 9 6 2 6 11 7 7 8 5 8

    Read the article

  • C++ arrays as parameters, subscript vs. pointer

    - by awshepard
    Alright, I'm guessing this is an easy question, so I'll take the knocks, but I'm not finding what I need on google or SO. I'd like to create an array in one place, and populate it inside a different function. I define a function: void someFunction(double results[]) { for (int i = 0; i<100; ++i) { for (int n = 0; n<16; ++n) //note this iteration limit { results[n] += i * n; } } } That's an approximation to what my code is doing, but regardless, shouldn't be running into any overflow or out of bounds issues or anything. I generate an array: double result[16]; for(int i = 0; i<16; i++) { result[i] = -1; } then I want to pass it to someFunction someFunction(result); When I set breakpoints and step through the code, upon entering someFunction, results is set to the same address as result, and the value there is -1.000000 as expected. However, when I start iterating through the loop, results[n] doesn't seem to resolve to *(results+n) or *(results+n*sizeof(double)), it just seems to resolve to *(results). What I end up with is that instead of populating my result array, I just get one value. What am I doing wrong?

    Read the article

  • Prolog singleton variables in Python

    - by Rubens
    I'm working on a little set of scripts in python, and I came to this: line = "a b c d e f g" a, b, c, d, e, f, g = line.split() I'm quite aware of the fact that these are decisions taken during implementation, but shouldn't (or does) python offer something like: _, _, var_needed, _, _, another_var_needed, _ = line.split() as well as Prolog does offer, in order to exclude the famous singleton variables. I'm not sure, but wouldn't it avoid unnecessary allocation? Or creating references to the result of the split call does not count up as overhead? EDIT: Sorry, my point here is: in Prolog, as far as I'm concerned, in an expression like: test(L, N) :- test(L, 0, N). test([], N, N). test([_|T], M, N) :- V is M + 1, test(T, V, N). The variable represented by _ is not accessible, for what I suppose the reference to the value that does exist in the list [_|T] is not even created. But, in Python, if I use _, I can use the last value assigned to _, and also, I do suppose the assignment occurs for each of the variables _ -- which may be considered an overhead. My question here is if shouldn't there be (or if there is) a syntax to avoid such unnecessary attributions.

    Read the article

  • Please help with C++ syntax for const accessor by reference.

    - by Hamish Grubijan
    Right not my implementation returns the thing by value. The member m_MyObj itself is not const - it's value changes depending on what the user selects with a Combo Box. I am no C++ guru, but I want to do this right. If I simply stick a & in front of GetChosenSourceSystem in both decl. and impl., I get one sort of compiler error. If I do one but not another - another error. If I do return &m_MyObj;. I will not list the errors here for now, unless there is a strong demand for it. I assume that an experienced C++ coder can tell what is going on here. I could omit constness or reference, but I want to make it tight and learn in the process as well. Thanks! // In header file MyObj GetChosenThingy() const; // In Implementation file. MyObj MyDlg::GetChosenThingy() const { return m_MyObj; }

    Read the article

  • re.sub emptying list

    - by jmau5
    def process_dialect_translation_rules(): # Read in lines from the text file specified in sys.argv[1], stripping away # excess whitespace and discarding comments (lines that start with '##'). f_lines = [line.strip() for line in open(sys.argv[1], 'r').readlines()] f_lines = filter(lambda line: not re.match(r'##', line), f_lines) # Remove any occurances of the pattern '\s*<=>\s*'. This leaves us with a # list of lists. Each 2nd level list has two elements: the value to be # translated from and the value to be translated to. Use the sub function # from the re module to get rid of those pesky asterisks. f_lines = [re.split(r'\s*<=>\s*', line) for line in f_lines] f_lines = [re.sub(r'"', '', elem) for elem in line for line in f_lines] This function should take the lines from a file and perform some operations on the lines, such as removing any lines that begin with ##. Another operation that I wish to perform is to remove the quotation marks around the words in the line. However, when the final line of this script runs, f_lines becomes an empty lines. What happened? Requested lines of original file: ## English-Geek Reversible Translation File #1 ## (Moderate Geek) ## Created by Todd WAreham, October 2009 "TV show" <=> "STAR TREK" "food" <=> "pizza" "drink" <=> "Red Bull" "computer" <=> "TRS 80" "girlfriend" <=> "significant other"

    Read the article

  • How to write a simple Lexer/Parser with antlr 2.7?

    - by Burkhard
    Hello, I have a complex grammar (in antlr 2.7) which I need to extend. Having never used antlr before, I wanted to write a very simple Lexer and Parser first. I found a very good explanation for antlr3 and tried to adapt it: header{ #include <iostream> using namespace std; } options { language="Cpp"; } class P2 extends Parser; /* This will be the entry point of our parser. */ eval : additionExp ; /* Addition and subtraction have the lowest precedence. */ additionExp : multiplyExp ( "+" multiplyExp | "-" multiplyExp )* ; /* Multiplication and addition have a higher precedence. */ multiplyExp : atomExp ( "*" atomExp | "/" atomExp )* ; /* An expression atom is the smallest part of an expression: a number. Or when we encounter parenthesis, we're making a recursive call back to the rule 'additionExp'. As you can see, an 'atomExp' has the highest precedence. */ atomExp : Number | "(" additionExp ")" ; /* A number: can be an integer value, or a decimal value */ number : ("0".."9")+ ("." ("0".."9")+)? ; /* We're going to ignore all white space characters */ protected ws : (" " | "\t" | "\r" | "\n") { newline(); } ; It does generate four files without errors: P2.cpp, P2.hpp, P2TokenTypes.hpp and P2TokenTypes.txt. But now what? How do I create a working programm with that? I tried to add these files to a VS2005-WinConsole-Project but it does not compile: p2.cpp(277) : fatal error C1010: unexpected end of file while looking for precompiled header. Did you forget to add '#include "stdafx.h"' to your source?

    Read the article

  • jQuery: If, Else with buttons error

    - by Wipqozn
    I'm running into an odd error. I'm working in Django 1.2, and have implemented the commenting framework. I'm trying to attach a hide/show button to each comment field, but whenever click on a hide/show button, it behaves as if each hide/show button beneath it on the page was clicked. Here's the jQuery code: <input type="Button" id="hideShow" name="hide/show" value="Hide"></input> <script> $("#hideShow").click(function() { if($(this).val() == "Hide") { $("textarea").hide("fast"); $(this).val("Show"); } else { $("textarea").show("fast"); $(this).val( "Hide"); } }); </script> So, when I click the Hide/show button, it will perform the action for each button beneath the clicked button + once for the button itself. So If I click a button, and there are two buttons beneath it, and value=hide it will first hide the 'textarea', than show the text area, than finally hide it again. I'm new to jQuery (although I do have experience in other languages), and I have an -idea- why it's not working: that whenever an action is performed jQuery jumps to the first one, than continues down the page looking for any other actions performed, and responds to each one. So it comes to my first button, sets it as being clicked, and so when jQuery comes across the other buttons it views them all as being 'clicked' and performs actions accordingly. I've thought of a semi-solution to my problem, putting in a variable which tracks how many times it has gone through, and than acting based on -that- action. But I would rather not do that, since it's not really a solution to the problem at hand but a work around. Any input is appreciated.

    Read the article

  • How to capture strings using * or ? with groups in python regular expressions

    - by user1334085
    When the regular expression has a capturing group followed by "*" or "?", there is no value captured. Instead if you use "+" for the same string, you can see the capture. I need to be able to capture the same value using "?" >>> str1='This string has 29 characters' >>> re.search(r'(\d+)*', str1).group(0) '' >>> re.search(r'(\d+)*', str1).group(1) >>> >>> re.search(r'(\d+)+', str1).group(0) '29' >>> re.search(r'(\d+)+', str1).group(1) '29' More specific question is added below for clarity: I have str1 and str2 below, and I want to use just one regexp which will match both. In case of str1, I also want to be able to capture the number of QSFP ports >>> str1='''4 48 48-port and 6 QSFP 10GigE Linecard 7548S-LC''' >>> str2='''4 48 48-port 10GigE Linecard 7548S-LC''' >>> When I do not use a metacharacter, the capture works: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP).*-LC', str1, re.I|re.M).group(1) '6' >>> It works even when I use the "+" to indicate one occurrence: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)+.*-LC', str1, re.I|re.M).group(1) '6' >>> But when I use "?" to match for 0 or 1 occurrence, the capture fails even for str1: >>> re.search(r'^4\s+48\s+.*(?:(\d+)\s+QSFP)?.*-LC', str1, re.I|re.M).group(1) >>>

    Read the article

  • Greasemonkey failing to GM_setValue()

    - by HonoredMule
    I have a Greasemonkey script that uses a Javascript object to maintain some stored objects. It covers quite a large volume of information, but substantially less than it successfully stored and retrieved prior to encountering my problem. One value refuses to save, and I can not for the life of me determine why. The following problem code: Works for other larger objects being maintained. Is presently handling a smaller total amount of data than previously worked. Is not colliding with any function or other object definitions. Can (optionally) successfully save the problem storage key as "{}" during code startup. this.save = function(table) { var tables = this.tables; if(table) tables = [table]; for(i in tables) { logger.log(this[tables[i]]); logger.log(JSON.stringify(this[tables[i]])); GM_setValue(tables[i] + "_" + this.user, JSON.stringify(this[tables[i]])); logger.log(tables[i] + "_" + this.user + " updated"); logger.log(GM_getValue(tables[i] + "_" + this.user)); } } The problem is consistently reproducible and the logging statments produce the following output in Firebug: Object { 54,10 = Object } // Expansion shows complete contents as expected, but there is one oddity--Firebug highlights the array keys in purple instead of the usual black for anonymous objects. {"54,10":{"x":54,"y":10,"name":"Lucky Pheasant"}} // The correctly parsed string. bookmarks_HonoredMule saved undefined I have tried altering the format of the object keys, to no effect. Further narrowing down the issue is that this particular value is successfully saved as an empty object ("{}") during code initialization, but skipping that also does not help. Reloading the page confirms that saving of the nonempty object truly failed. Any idea what could cause this behavior? I've thoroughly explored the possibility of hitting size constraints, but it doesn't appear that can be the problem--as previously mentioned, I've already reduced storage usage. Other larger objects save still, and the total number of objects, which was not high already, has further been reduced by an amount greater than the quantity of data I'm attempting to store here.

    Read the article

  • String literal recognition problem

    - by helicera
    Hello! I'm trying to recognize string literal by reading string per symbol. Here is a sample code: #region [String Literal (")] case '"': // {string literal ""} { // skipping '"' ChCurrent = Line.ElementAtOrDefault<Char>(++ChPosition); while(ChCurrent != '"') { Value.Append(ChCurrent); ChCurrent = Line.ElementAtOrDefault<Char>(++ChPosition); if(ChCurrent == '"') { // "" sequence only acceptable if(Line.ElementAtOrDefault<Char>(ChPosition + 1) == '"') { Value.Append(ChCurrent); // skip 2nd double quote ChPosition++; // move position next ChCurrent = Line.ElementAtOrDefault<Char>(++ChPosition); } } else if(default(Char) == ChCurrent) { // message: unterminated string throw new ScanningException(); } } ChPosition++; break; } #endregion When I run test: [Test] [ExpectedException(typeof(ScanningException))] public void ScanDoubleQuotedStrings() { this.Scanner.Run(@"""Hello Language Design""", default(System.Int32)); this.Scanner.Run(@"""Is there any problems with the """"strings""""?""", default(System.Int32)); this.Scanner.Run(@"""v#:';?325;.<>,|+_)""(*&^%$#@![]{}\|-_=""", default(System.Int32)); while(0 != this.Scanner.TokensCount - 1) { Assert.AreEqual(Token.TokenClass.StringLiteral, this.Scanner.NextToken.Class); } } It passes with success.. while I'm expecting to have an exception according to unmatched " mark in this.Scanner.Run(@"""v#:';?325;.<>,|+_)""(*&^%$#@![]{}\|-_=""", default(System.Int32)); Can anyone explain where is my mistake or give an advice on algorithm.

    Read the article

< Previous Page | 727 728 729 730 731 732 733 734 735 736 737 738  | Next Page >