Search Results

Search found 2101 results on 85 pages for 'c str'.

Page 74/85 | < Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >

  • How do you invoke a python script inside a jar file using python ?

    - by Trevor
    I'm working on an application that intersperses a bunch of jython and java code. Due to the nature of the program (using wsadmin) we are really restricted to Python 2.1 We currently have a jar containing both java source and .py modules. The code is currently invoked using java, but I'd like to remove this in favor of migrating as much functionality as possible to jython. The problem I have is that I want to either import or execute python modules inside the existing jar file from a calling jython script. I've tried a couple of different ways without success. My directory structure looks like: application.jar |-- com |--example |-- action |-- MyAction.class |-- pre_myAction.py The 1st approach I tried was to do imports from the jar. I added the jar to my sys.path and tried to import the module using both import com.example.action.myAction and import myAction. No success however, even when I put init.py files into the directory at each level. The 2nd approach I tried was to load the resource using the java class. So I wrote the below code: import sys import os import com.example.action.MyAction as MyAction scriptName = str(MyAction.getResource('/com/example/action/myAction.py')) scriptStr = MyAction.getResourceAsStream('/com/example/action/myAction.py') try: print execfile(scriptStr) except: print "failed 1" try: print execfile(scriptName) except: print "failed 2" Both of these failed. I'm at a bit of a loss now as to how I should proceed. Any ideas ? cheers, Trevor

    Read the article

  • How to handle custom Java exception in Flex app.

    - by mico
    Hello, we are using BlazeDS as a proxy between Flex and Java. The approach is the same as in (http://www.flexpasta.com/index.php/2008/05/16/exception-handling-with-blazeds-and-flex/) Java exception declaration: public class FlexException extends RuntimeException { private String name = 'John'; public FlexException(String message) { super(message); } public String getName() { return name; } } Then, we are throwing it: public void testMethod(String str) throws Exception { throw new FlexException("Custom exception"); } Flex part: private function faultHandler(event:FaultEvent):void { var errorMessage:ErrorMessage = event.message as ErrorMessage; trace("error++"); } and remote object is instantiated here: <mx:RemoteObject id="mySample" destination="mySample" channelSet="{cs1}" fault="faultHandler(event)" /> But in event.fault I get "Server.Processing" and event.faultString equals "There was an unhandled failure on the server. Custom exception" How can I receive the data is specified in exception props ? BlazeDS log is similar to the log that was mentioned in the comment [BlazeDS] 11:28:13.906 [DEBUG] Serializing AMF/HTTP response Version: 3 (Message #0 targetURI=/2/onStatus, responseUR|-) (Typed Object #0 ‘flex.messaging.messages.ErrorMessage’) headers = (Object #1) rootCause = null body = null correlationId = “2F1126D7-5658-BE40-E27C-7B43F3C5DCDD” faultDetail = null faultString = “Login required before authorization can proceed.” clientId = “C4F0E77C-3208-ECDD-1497-B8D070884830? timeToLive = 0.0 destination = “books” timestamp = 1.204658893906E12 extendedData = null faultCode = “Client.Authentication” messageId = “C4F0E77C-321E-6FCE-E17D-D9F1C16600A8? So the quesion is why rootClause is null? How can I get that Exception object not just a string 'Custom exception'?

    Read the article

  • What does this code from AuthKit do? (where are these functions and methods defined?)

    - by Beau Simensen
    I am trying to implement my own authentication method for AuthKit and am trying to figure out how some of the built-in methods work. In particular, I'm trying to figure out how to update the REMOTE_USER for environ correctly. This is how it is handled inside of authkit.authenticate.basic but it is pretty confusing. I cannot find anyplace where REMOTE_USER and AUTH_TYPE are defined. Is there something strange going on here and if so, what is it? def __call__(self, environ, start_response): environ['authkit.users'] = self.users result = self.authenticate(environ) if isinstance(result, str): AUTH_TYPE.update(environ, 'basic') REMOTE_USER.update(environ, result) return self.application(environ, start_response) There are actually a number of all uppercase things like this that I cannot find a definition for. For example, where does AUTHORIZATION come from below: def authenticate(self, environ): authorization = AUTHORIZATION(environ) if not authorization: return self.build_authentication() (authmeth, auth) = authorization.split(' ',1) if 'basic' != authmeth.lower(): return self.build_authentication() auth = auth.strip().decode('base64') username, password = auth.split(':',1) if self.authfunc(environ, username, password): return username return self.build_authentication() I feel like maybe I am missing some special syntax handling for the environ dict, but it is possible that there is something else really weird going on here that isn't immediately obvious to someone as new to Python as myself.

    Read the article

  • C# Client to Consume Google App Engine RESTful Webservice (rpc XML)

    - by Ngu Soon Hui
    I think I hit a problem when using C# client to consume Google App Engine Webservice. The Google App Engine code I use is here. This is how the python script on server would look like: from google.appengine.ext import webapp from google.appengine.ext.webapp.util import run_wsgi_app import logging from StringIO import StringIO import traceback import xmlrpclib from xmlrpcserver import XmlRpcServer class Application: def __init__(self): pass def getName(self,meta): return 'example' class XMLRpcHandler(webapp.RequestHandler): rpcserver = None def __init__(self): self.rpcserver = XmlRpcServer() app = Application() self.rpcserver.register_class('app',app) def post(self): request = StringIO(self.request.body) request.seek(0) response = StringIO() try: self.rpcserver.execute(request, response, None) except Exception, e: logging.error('Error executing: '+str(e)) for line in traceback.format_exc().split('\n'): logging.error(line) finally: response.seek(0) rstr = response.read() self.response.headers['Content-type'] = 'text/xml' self.response.headers['Content-length'] = "%d"%len(rstr) self.response.out.write(rstr) application = webapp.WSGIApplication( [('/xmlrpc/', XMLRpcHandler)], debug=True) def main(): run_wsgi_app(application) if __name__ == "__main__": main() The client side ( in Python) is this: import xmlrpclib s = xmlrpclib.Server('http://localhost:8080/xmlrpc/') print s.app.getName() I have no problem in using Python client to retrieve values from Google App Engine, but I do have difficulties in using a C# client to retrieve the values. The error I got was 404 method not found when I am trying to GetResponse from the web request. This is my code var request = (HttpWebRequest)WebRequest.Create("http://localhost:8080/xmlrpc/app"); request.Method = "GET"; request.ContentLength = 0; request.ContentType = "text/xml"; using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) //404 method not found error here. { } I think it must be that the url is wrong, but I don't know how to get it right. Any idea?

    Read the article

  • How do I compose an existing Moose role into a class at runtime?

    - by Oesor
    Say I define an abstract My::Object and concrete role implementations My::Object::TypeA and My::Object::TypeB. For maintainability reasons, I'd like to not have a hardcoded table that looks at the object type and applies roles. As a DWIMmy example, I'm looking for something along these lines in My::Object: has => 'id' (isa => 'Str', required => 1); sub BUILD { my $self = shift; my $type = $self->lookup_type(); ## Returns 'TypeB' {"My::Object::$type"}->meta->apply($self); } Letting me get a My::Object with My::Object::TypeB role applied by doing the following: my $obj = My::Object(id = 'foo') Is this going to do what I want or am I on the entirely wrong track? Edit: I simplified this too much; I don't want to have to know the type when I instantiate the object, I want the object to determine its type and apply the correct role's methods appropriately. I've edited my question to make this clearer.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Reordering arguments using recursion (pro, cons, alternatives)

    - by polygenelubricants
    I find that I often make a recursive call just to reorder arguments. For example, here's my solution for endOther from codingbat.com: Given two strings, return true if either of the strings appears at the very end of the other string, ignoring upper/lower case differences (in other words, the computation should not be "case sensitive"). Note: str.toLowerCase() returns the lowercase version of a string. public boolean endOther(String a, String b) { return a.length() < b.length() ? endOther(b, a) : a.toLowerCase().endsWith(b.toLowerCase()); } I'm very comfortable with recursions, but I can certainly understand why some perhaps would object to it. There are two obvious alternatives to this recursion technique: Swap a and b traditionally public boolean endOther(String a, String b) { if (a.length() < b.length()) { String t = a; a = b; b = t; } return a.toLowerCase().endsWith(b.toLowerCase()); } Not convenient in a language like Java that doesn't pass by reference Lots of code just to do a simple operation An extra if statement breaks the "flow" Repeat code public boolean endOther(String a, String b) { return (a.length() < b.length()) ? b.toLowerCase().endsWith(a.toLowerCase()) : a.toLowerCase().endsWith(b.toLowerCase()); } Explicit symmetry may be a nice thing (or not?) Bad idea unless the repeated code is very simple ...though in this case you can get rid of the ternary and just || the two expressions So my questions are: Is there a name for these 3 techniques? (Are there more?) Is there a name for what they achieve? (e.g. "parameter normalization", perhaps?) Are there official recommendations on which technique to use (when)? What are other pros/cons that I may have missed?

    Read the article

  • How to use SQLAlchemy to dump an SQL file from query expressions to bulk-insert into a DBMS?

    - by Mahmoud Abdelkader
    Please bear with me as I explain the problem, how I tried to solve it, and my question on how to improve it is at the end. I have a 100,000 line csv file from an offline batch job and I needed to insert it into the database as its proper models. Ordinarily, if this is a fairly straight-forward load, this can be trivially loaded by just munging the CSV file to fit a schema, but I had to do some external processing that requires querying and it's just much more convenient to use SQLAlchemy to generate the data I want. The data I want here is 3 models that represent 3 pre-exiting tables in the database and each subsequent model depends on the previous model. For example: Model C --> Foreign Key --> Model B --> Foreign Key --> Model A So, the models must be inserted in the order A, B, and C. I came up with a producer/consumer approach: - instantiate a multiprocessing.Process which contains a threadpool of 50 persister threads that have a threadlocal connection to a database - read a line from the file using the csv DictReader - enqueue the dictionary to the process, where each thread creates the appropriate models by querying the right values and each thread persists the models in the appropriate order This was faster than a non-threaded read/persist but it is way slower than bulk-loading a file into the database. The job finished persisting after about 45 minutes. For fun, I decided to write it in SQL statements, it took 5 minutes. Writing the SQL statements took me a couple of hours, though. So my question is, could I have used a faster method to insert rows using SQLAlchemy? As I understand it, SQLAlchemy is not designed for bulk insert operations, so this is less than ideal. This follows to my question, is there a way to generate the SQL statements using SQLAlchemy, throw them in a file, and then just use a bulk-load into the database? I know about str(model_object) but it does not show the interpolated values. I would appreciate any guidance for how to do this faster. Thanks!

    Read the article

  • Read line and change the line that not consist of certain words and not end with dot

    - by igo
    I wanna read some text files in a folder line by line. for example of 1 txt : Fast and Effective Text Mining Using Linear-time Document Clustering Bjornar Larsen WORD2 Chinatsu Aone SRA International AK, Inc. 4300 Fair Lakes Cow-l Fairfax, VA 22033 {bjornar-larsen, WORD1 I wanna remove line that does not contain of words = word, word2, word3, and does not end with dot . so. from the example, the result will be : Bjornar Larsen WORD2 Chinatsu Aone SRA International, Inc. {bjornar-larsen, WORD1 I am confused, hw to remove the line? it that possible? or can we replace them with a space? here's the code : $url = glob($savePath.'*.txt'); foreach ($url as $file => $files) { $handle = fopen($files, "r") or die ('can not open file'); $ori_content= file_get_contents($files); foreach(preg_split("/((\r?\n)|(\r\n?))/", $ori_content) as $buffer){ $pos1 = stripos($buffer, $word1); $pos2 = stripos($buffer, $word2); $pos3 = stripos($buffer, $word3); $last = $str[strlen($buffer)-1];//read the las character if (true !== $pos1 OR true !== $pos2 OR true !==$pos3 && $last != '.'){ //how to remove } } } please help me, thank you so much :)

    Read the article

  • Using perl to split a line that may contain whitespace

    - by Tommy Fisk
    Okay, so I'm using perl to read in a file that contains some general configuration data. This data is organized into headers based on what they mean. An example follows: [vars] # This is how we define a variable! $var = 10; $str = "Hello thar!"; # This section contains flags which can be used to modify module behavior # All modules read this file and if they understand any of the flags, use them [flags] Verbose = true; # Notice the errant whitespace! [path] WinPath = default; # Keyword which loads the standard PATH as defined by the operating system. Append with additonal values. LinuxPath = default; Goal: Using the first line as an example "$var = 10;", I'd like to use the split function in perl to create an array that contains the characters "$var" and "10" as elements. Using another line as an example: Verbose = true; # Should become [Verbose, true] aka no whitespace is present This is needed because I will be outputting these values to a new file (which a different piece of C++ code will read) to instantiate dictionary objects. Just to give you a little taste of what it might look like (just making it up as I go along): define new dictionary name: [flags] # Start defining keys => values new key name: Verbose new value val: 10 # End dictionary Oh, and here is the code I currently have along with what it is doing (incorrectly): sub makeref($) { my @line = (split (/=/)); # Produces ["Verbose", " true"]; }

    Read the article

  • C# Why can't I find Sum() of this HashSet. says "Arithmetic operation resulted in an overflow."

    - by user2332665
    I was trying to solve this problem projecteuler,problem125 this is my solution in python(just for understanding the logic) import math lim=10**8 found=set() for start in xrange(1,int(math.sqrt(lim))): sos = start*start for i in xrange(start+1,int(math.sqrt(lim))): sos += (i*i) if sos >= lim: break s=str(int(sos)) if s==s[::-1]: found.add(sos) print sum(found) the same code I wrote in C# is as follows using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { public static bool isPalindrome(string s) { string temp = ""; for (int i=s.Length-1;i>=0;i-=1){temp+=s[i];} return (temp == s); } static void Main(string[] args) { int lim = Convert.ToInt32(Math.Pow(10,8)); var found = new HashSet<int>(); for (int start = 1; start < Math.Sqrt(lim); start += 1) { int s = start *start; for (int i = start + 1; start < Math.Sqrt(lim); i += 1) { s += i * i; if (s > lim) { break; } if (isPalindrome(s.ToString())) { found.Add(s); } } } Console.WriteLine(found.Sum()); } } } the code debugs fine until it gives an exception at Console.WriteLine(found.Sum()); (line31). Why can't I find Sum() of the set found

    Read the article

  • HttpError 502 with Google Wave Active Robot API fetch_wavelet()

    - by Drew LeSueur
    I am trying to use the Google Wave Active Robot API fetch_wavelet() and I get an HTTP 502 error example: from waveapi import robot import passwords robot = robot.Robot('gae-run', 'http://images.com/fake-image.jpg') robot.setup_oauth(passwords.CONSUMER_KEY, passwords.CONSUMER_SECRET, server_rpc_base='http://www-opensocial.googleusercontent.com/api/rpc') wavelet = robot.fetch_wavelet('googlewave.com!w+dtuZi6t3C','googlewave.com!conv+root') robot.submit(wavelet) self.response.out.write(wavelet.creator) But the error I get is this: Traceback (most recent call last): File "/base/python_runtime/python_lib/versions/1/google/appengine/ext/webapp/__init__.py", line 511, in __call__ handler.get(*groups) File "/base/data/home/apps/clstff/gae-run.342467577023864664/main.py", line 23, in get robot.submit(wavelet) File "/base/data/home/apps/clstff/gae-run.342467577023864664/waveapi/robot.py", line 486, in submit res = self.make_rpc(pending) File "/base/data/home/apps/clstff/gae-run.342467577023864664/waveapi/robot.py", line 251, in make_rpc raise IOError('HttpError ' + str(code)) IOError: HttpError 502 Any ideas? Edit: When [email protected] is not a member of the wave I get the correct error message Error: RPC Error500: internalError: [email protected] is not a participant of wave id: [WaveId:googlewave.com!w+Pq1HgvssD] wavelet id: [WaveletId:googlewave.com!conv+root]. Unable to apply operation: {'method':'robot.fetchWave','id':'655720','waveId':'googlewave.com!w+Pq1HgvssD','waveletId':'googlewave.com!conv+root','blipId':'null','parameters':{}} But when [email protected] is a member of the wave I get the http 502 error. IOError: HttpError 502

    Read the article

  • Python: Networked IDLE/Redo IDLE front-end while using the same back-end?

    - by Rosarch
    Is there any existing web app that lets multiple users work with an interactive IDLE type session at once? Something like: IDLE 2.6.4 Morgan: >>> letters = list("abcdefg") Morgan: >>> # now, how would you iterate over letters? Jack: >>> for char in letters: print "char %s" % char char a char b char c char d char e char f char g Morgan: >>> # nice nice If not, I would like to create one. Is there some module I can use that simulates an interactive session? I'd want an interface like this: def class InteractiveSession(): ''' An interactive Python session ''' def putLine(line): ''' Evaluates line ''' pass def outputLines(): ''' A list of all lines that have been output by the session ''' pass def currentVars(): ''' A dictionary of currently defined variables and their values ''' pass (Although that last function would be more of an extra feature.) To formulate my problem another way: I'd like to create a new front end for IDLE. How can I do this? UPDATE: Or maybe I can simulate IDLE through eval()? UPDATE 2: What if I did something like this: I already have a simple GAE Python chat app set up, that allows users to sign in, make chat rooms, and chat with each other. Instead of just saving incoming messages to the datastore, I could do something like this: def putLine(line, user, chat_room): ''' Evaluates line for the session used by chat_room ''' # get the interactive session for this chat room curr_vars = InteractiveSession.objects.where("chatRoom = %s" % chat_room).get() result = eval(prepared_line, curr_vars.state, {}) curr_vars.state = curr_globals curr_vars.lines.append((user, line)) if result: curr_vars.lines.append(('SELF', result.__str__())) curr_vars.put() The InteractiveSession model: def class InteractiveSession(db.Model): # a dictionary mapping variables to values # it looks like GAE doesn't actually have a dictionary field, so what would be best to use here? state = db.DictionaryProperty() # a transcript of the session # # a list of tuples of the form (user, line_entered) # # looks something like: # # [('Morgan', '# hello'), # ('Jack', 'x = []'), # ('Morgan', 'x.append(1)'), # ('Jack', 'x'), # ('SELF', '[1]')] lines = db.ListProperty() Could this work, or am I way off/this approach is infeasible/I'm duplicating work when I should use something already built?

    Read the article

  • Regular Expression doesn't match

    - by dododedodonl
    Hi All, I've got a string with very unclean HTML. Before I parse it, I want to convert this: <TABLE><TR><TD width="33%" nowrap=1><font size="1" face="Arial"> NE </font> </TD> <TD width="33%" nowrap=1><font size="1" face="Arial"> DEK </font> </TD> <TD width="33%" nowrap=1><font size="1" face="Arial"> 143 </font> </TD> </TR></TABLE> in NE DEK 143 so it is a bit easier to parse. I've got this regular expression (RegexKitLite): NSString *str = [dataString stringByReplacingOccurrencesOfRegex:@"<TABLE><TR><TD width=\"33%\" nowrap=1><font size=\"1\" face=\"Arial\">(.+?)<\\/font> <\\/TD>(.+?)<TD width=\"33%\" nowrap=1><font size=\"1\" face=\"Arial\">(.+?)<\\/font> <\\/TD>(.+?)<TD width=\"33%\" nowrap=1><font size=\"1\" face=\"Arial\">(.+?)<\\/font> <\\/TD>(.+?)<\\/TR><\\/TABLE>" withString:@"$1 $3 $5"]; I'm no an expert in Regex. Can someone help me out here? Regards, dodo

    Read the article

  • dynamically created radiobuttonlist

    - by Janet
    Have a master page. The content page has a list with hyperlinks containing request variables. You click on one of the links to go to the page containing the radiobuttonlist (maybe). First problem: When I get to the new page, I use one of the variables to determine whether to add a radiobuttonlist to a placeholder on the page. I tried to do it in page)_load but then couldn't get the values selected. When I played around doing it in preInit, the first time the page is there, I can't get to the page's controls. (Object reference not set to an instance of an object.) I think it has something to do with the MasterPage and page content? The controls aren't instantiated until later? (using vb by the way) Second problem: Say I get that to work, once I hit a button, can I still access the passed request variable to determine the selected item in the radiobuttonlist? Protected Sub Page_PreInit(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.PreInit 'get sessions for concurrent Dim Master As New MasterPage Master = Me.Master Dim myContent As ContentPlaceHolder = CType(Page.Master.FindControl("ContentPlaceHolder1"), ContentPlaceHolder) If Request("str") = "1" Then Dim myList As dsSql = New dsSql() ''''instantiate the function to get dataset Dim ds As New Data.DataSet ds = myList.dsConSessionTimes(Request("eid")) If ds.Tables("conSessionTimes").Rows.Count > 0 Then Dim conY As Integer = 1 CType(myContent.FindControl("lblSidCount"), Label).Text = ds.Tables("conSessionTimes").Rows.Count.ToString Sorry to be so needy - but maybe someone could direct me to a page with examples? Maybe seeing it would help it make sense? Thanks....JB

    Read the article

  • Trying to build the basic python extension example fails (windows)

    - by Alexandros
    Hello, I have Python 2.6 and Visual Studio 2008 running on a Win7 x64 machine. When I try to build the basic python extension example in c "example_nt" as found in the python 2.6 sources distribution, it fails: python setup.py build And this results in: running build running build_ext building 'aspell' extension Traceback (most recent call last): File "setup.py", line 7, in <module> ext_modules = [module1]) File "C:\Python26\lib\distutils\core.py", line 152, in setup dist.run_commands() File "C:\Python26\lib\distutils\dist.py", line 975, in run_commands self.run_command(cmd) File "C:\Python26\lib\distutils\dist.py", line 995, in run_command cmd_obj.run() File "C:\Python26\lib\distutils\command\build.py", line 134, in run self.run_command(cmd_name) File "C:\Python26\lib\distutils\cmd.py", line 333, in run_command self.distribution.run_command(command) File "C:\Python26\lib\distutils\dist.py", line 995, in run_command cmd_obj.run() File "C:\Python26\lib\distutils\command\build_ext.py", line 343, in run self.build_extensions() File "C:\Python26\lib\distutils\command\build_ext.py", line 469, in build_extensions self.build_extension(ext) File "C:\Python26\lib\distutils\command\build_ext.py", line 534, in build_extension depends=ext.depends) File "C:\Python26\lib\distutils\msvc9compiler.py", line 448, in compile self.initialize() File "C:\Python26\lib\distutils\msvc9compiler.py", line 358, in initialize vc_env = query_vcvarsall(VERSION, plat_spec) File "C:\Python26\lib\distutils\msvc9compiler.py", line 274, in query_vcvarsall raise ValueError(str(list(result.keys()))) ValueError: [u'path'] What can I do to fix this? Any help will be appreciated

    Read the article

  • Why is python decode replacing more than the invalid bytes from an encoded string?

    - by dangra
    Trying to decode an invalid encoded utf-8 html page gives different results in python, firefox and chrome. The invalid encoded fragment from test page looks like 'PREFIX\xe3\xabSUFFIX' >>> fragment = 'PREFIX\xe3\xabSUFFIX' >>> fragment.decode('utf-8', 'strict') ... UnicodeDecodeError: 'utf8' codec can't decode bytes in position 6-8: invalid data What follows is the summary of replacement policies used to handle decoding errors by python, firefox and chrome. Note how the three differs, and specially how python builtin removes the valid S (plus the invalid sequence of bytes). by Python The builtin replace error handler replaces the invalid \xe3\xab plus the S from SUFFIX by U+FFFD >>> fragment.decode('utf-8', 'replace') u'PREFIX\ufffdUFFIX' >>> print _ PREFIX?UFFIX The python implementation builtin replace error handler looks like: >>> python_replace = lambda exc: (u'\ufffd', exc.end) As expected, trying this gives same result than builtin: >>> codecs.register_error('python_replace', python_replace) >>> fragment.decode('utf-8', 'python_replace') u'PREFIX\ufffdUFFIX' >>> print _ PREFIX?UFFIX by Firefox Firefox replaces each invalid byte by U+FFFD >>> firefox_replace = lambda exc: (u'\ufffd', exc.start+1) >>> codecs.register_error('firefox_replace', firefox_replace) >>> test_string.decode('utf-8', 'firefox_replace') u'PREFIX\ufffd\ufffdSUFFIX' >>> print _ PREFIX??SUFFIX by Chrome Chrome replaces each invalid sequence of bytes by U+FFFD >>> chrome_replace = lambda exc: (u'\ufffd', exc.end-1) >>> codecs.register_error('chrome_replace', chrome_replace) >>> fragment.decode('utf-8', 'chrome_replace') u'PREFIX\ufffdSUFFIX' >>> print _ PREFIX?SUFFIX The main question is why builtin replace error handler for str.decode is removing the S from SUFFIX. Also, is there any unicode's official recommended way for handling decoding replacements?

    Read the article

  • Am I correctly extracting JPEG binary data from this mysqldump?

    - by Glenn
    I have a very old .sql backup of a vbulletin site that I ran around 8 years ago. I am trying to see the file attachments that are stored in the DB. The script below extracts them all and is verified to be JPEG by hex dumping and checking the SOI (start of image) and EOI (end of image) bytes (FFD8 and FFD9, respectively) according to the JPEG wiki page. But when I try to open them with evince, I get this message "Error interpreting JPEG image file (JPEG datastream contains no image)" What could be going on here? Some background info: sqldump is around 8 years old vbulletin 2.x was the software that stored the info most likely php 4 was used most likely mysql 4.0, possibly even 3.x the column datatype these attachments are stored in is mediumtext My Python 3.1 script: #!/usr/bin/env python3.1 import re trim_l = re.compile(b"""^INSERT INTO attachment VALUES\('\d+', '\d+', '\d+', '(.+)""") trim_r = re.compile(b"""(.+)', '\d+', '\d+'\);$""") extractor = re.compile(b"""^(.*(?:\.jpe?g|\.gif|\.bmp))', '(.+)$""") with open('attachments.sql', 'rb') as fh: for line in fh: data = trim_l.findall(line)[0] data = trim_r.findall(data)[0] data = extractor.findall(data) if data: name, data = data[0] try: filename = 'files/%s' % str(name, 'UTF-8') ah = open(filename, 'wb') ah.write(data) except UnicodeDecodeError: continue finally: ah.close() fh.close() update The JPEG wiki page says FF bytes are section markers, with the next byte indicating the section type. I see some that are not listed in the wiki page (specifically, I see a lot of 5C bytes, so FF5C). But the list is of "common markers" so I'm trying to find a more complete list. Any guidance here would also be appreciated.

    Read the article

  • Aggregating, restructuring hourly time series data in R

    - by Advait Godbole
    I have a year's worth of hourly data in a data frame in R: > str(df.MHwind_load) # compactly displays structure of data frame 'data.frame': 8760 obs. of 6 variables: $ Date : Factor w/ 365 levels "2010-04-01","2010-04-02",..: 1 1 1 1 1 1 1 1 1 1 ... $ Time..HRs. : int 1 2 3 4 5 6 7 8 9 10 ... $ Hour.of.Year : int 1 2 3 4 5 6 7 8 9 10 ... $ Wind.MW : int 375 492 483 476 486 512 421 396 456 453 ... $ MSEDCL.Demand: int 13293 13140 12806 12891 13113 13802 14186 14104 14117 14462 ... $ Net.Load : int 12918 12648 12323 12415 12627 13290 13765 13708 13661 14009 ... While preserving the hourly structure, I would like to know how to extract a particular month/group of months the first day/first week etc of each month all mondays, all tuesdays etc of the year I have tried using "cut" without result and after looking online think that "lubridate" might be able to do so but haven't found suitable examples. I'd greatly appreciate help on this issue.

    Read the article

  • python calendar to calculate month backwards

    - by Suhail
    Hi, we are trying to create a calendar function in python. we have created a small content management system, the requirement is, there will be a drop down list on the top right hand corner of the website, which will give the options - Months - 1 month, 2 months, 3 months and so on..., if the user selects 8 months then it should show the postscount for the last 8 months. the issue is we tried to write a small code which would do the month calculations, but the bug is that it does not consider the months beyond the current year, it shows the postscount only for months of the current year. for example: if the user selects 3 months, it will show the count for the l 3 months i.e present month and the previous 2 months, but if the user selects option more than 4 months, it does not consider the months from previous year, it still shows the month of the present year only. I am pasting the code below:- def __getSpecifiedMailCount__(request, value): dbconnector= DBConnector() CdateList= "select cdate from mail_records" DateNow= datetime.datetime.today() DateNow= DateNow.strftime("%Y-%m") DateYear= datetime.datetime.today() DateYear= DateYear.strftime("%Y") DateMonth= datetime.datetime.today() DateMonth= DateMonth.strftime("%m") #print DateMonth def getMonth(value): valueDic= {"01": "Jan", "02": "Feb", "03": "Mar", "04": "Apr", "05": "May", "06": "Jun", "07": "Jul", "08": "Aug", "09": "Sep", "10": "Oct", "11": "Nov", "12": "Dec"} return valueDic[value] def getMonthYearandCount(yearmonth): MailCount= "select count(*) as mailcount from mail_records where cdate like '%s%s'" % (yearmonth, "%") MailCountResult= MailCount[0]['mailcount'] return MailCountResult MailCountList= [] MCOUNT= getMonthYearandCount(DateNow) MONTH= getMonth(DateMonth) MailCountDict= {} MailCountDict['monthyear']= MONTH + ' ' + DateYear MailCountDict['mailcount']= MCOUNT var_monthyear= MONTH + ' ' + DateYear var_mailcount= MCOUNT MailCountList.append(MailCountDict) i=1 k= int(value) hereMONTH= int(DateMonth) while (i < k): hereMONTH= int(hereMONTH) - 1 if (hereMONTH < 10): hereMONTH = '0' + str(hereMONTH) if (hereMONTH == '00') or (hereMONTH == '0-1'): break else: PMONTH= getMonth(hereMONTH) hereDateNow= DateYear + '-' + PMONTH hereDateNowNum= DateYear + '-' + hereMONTH PMCOUNT= getMonthYearandCount(hereDateNowNum) MailCountDict= {} MailCountDict['monthyear']= PMONTH + ' ' + DateYear MailCountDict['mailcount']= PMCOUNT var_monthyear= PMONTH + ' ' + DateYear var_mailcount= PMCOUNT MailCountList.append(MailCountDict) i = i + 1 #print MailCountList MailCountDict= {'monthmailcount': MailCountList} reportdata = MailCountDict['monthmailcount'] #print reportdata return render_to_response('test.html', locals())

    Read the article

  • How can I use R (Rcurl/XML packages ?!) to scrap this webpage ?

    - by Tal Galili
    Hi all, I have a (somewhat complex) webscraping challenge that I wish to accomplish and would love for some direction (to whatever level you feel like sharing) here goes: I would like to go through all the "species pages" present in this link: http://gtrnadb.ucsc.edu/ So for each of them I will go to: The species page link (for example: http://gtrnadb.ucsc.edu/Aero_pern/) And then to the "Secondary Structures" page link (for example: http://gtrnadb.ucsc.edu/Aero_pern/Aero_pern-structs.html) Inside that link I wish to scrap the data in the page so that I will have a long list containing this data (for example): chr.trna3 (1-77) Length: 77 bp Type: Ala Anticodon: CGC at 35-37 (35-37) Score: 93.45 Seq: GGGCCGGTAGCTCAGCCtGGAAGAGCGCCGCCCTCGCACGGCGGAGGcCCCGGGTTCAAATCCCGGCCGGTCCACCA Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.... Where each line will have it's own list (inside the list for each "trna" inside the list for each animal) I remember coming across the packages Rcurl and XML (in R) that can allow for such a task. But I don't know how to use them. So what I would love to have is: 1. Some suggestion on how to build such a code. 2. And recommendation for how to learn the knowledge needed for performing such a task. Thanks for any help, Tal

    Read the article

  • Syntax Error with John Resig's Micro Templating.

    - by optician
    I'm having a bit of trouble with John Resig's Micro templating. Can anyone help me with why it isn't working? This is the template <script type="text/html" id="row_tmpl"> test content {%=id%} {%=name%} </script> And the modified section of the engine str .replace(/[\r\t\n]/g, " ") .split("{%").join("\t") .replace(/((^|%>)[^\t]*)'/g, "$1\r") .replace(/\t=(.*?)%>/g, "',$1,'") .split("\t").join("');") .split("%}").join("p.push('") .split("\r").join("\\'") + "');}return p.join('');"); and the javascript var dataObject = { "id": "27", "name": "some more content" }; var html = tmpl("row_tmpl", dataObject); and the result, as you can see =id and =name seem to be in the wrong place? Apart from changing the template syntax blocks from <% % to {% %} I haven't changed anything. This is from Firefox. Error: syntax error Line: 30, Column: 89 Source Code: var p=[],print=function(){p.push.apply(p,arguments);};with(obj){p.push(' test content ');=idp.push(' ');=namep.push(' ');}return p.join('');

    Read the article

  • Django stupid mark_safe?

    - by Mark
    I wrote this little function for writing out HTML tags: def html_tag(tag, content=None, close=True, attrs={}): lst = ['<',tag] for key, val in attrs.iteritems(): lst.append(' %s="%s"' % (key, escape_html(val))) if close: if content is None: lst.append(' />') else: lst.extend(['>', content, '</', tag, '>']) else: lst.append('>') return mark_safe(''.join(lst)) Which worked great, but then I read this article on efficient string concatenation (I know it doesn't really matter for this, but I wanted consistency) and decided to update my script: def html_tag(tag, body=None, close=True, attrs={}): s = StringIO() s.write('<%s'%tag) for key, val in attrs.iteritems(): s.write(' %s="%s"' % (key, escape_html(val))) if close: if body is None: s.write(' />') else: s.write('>%s</%s>' % (body, tag)) else: s.write('>') return mark_safe(s.getvalue()) But now my HTML get escaped when I try to render it from my template. Everything else is exactly the same. It works properly if I replace the last line with return mark_safe(unicode(s.getvalue())). I checked the return type of s.getvalue(). It should be a str, just like the first function, so why is this failing?? Also fails with SafeString(s.getvalue()) but succeeds with SafeUnicode(s.getvalue()). I'd also like to point out that I used return mark_safe(s.getvalue()) in a different function with no odd behavior.

    Read the article

  • Python byte per byte XOR decryption

    - by neurino
    I have an XOR encypted file by a VB.net program using this function to scramble: Public Class Crypter ... 'This Will convert String to bytes, then call the other function. Public Function Crypt(ByVal Data As String) As String Return Encoding.Default.GetString(Crypt(Encoding.Default.GetBytes(Data))) End Function 'This calls XorCrypt giving Key converted to bytes Public Function Crypt(ByVal Data() As Byte) As Byte() Return XorCrypt(Data, Encoding.Default.GetBytes(Me.Key)) End Function 'Xor Encryption. Private Function XorCrypt(ByVal Data() As Byte, ByVal Key() As Byte) As Byte() Dim i As Integer If Key.Length <> 0 Then For i = 0 To Data.Length - 1 Data(i) = Data(i) Xor Key(i Mod Key.Length) Next End If Return Data End Function End Class and saved this way: Dim Crypter As New Cryptic(Key) 'open destination file Dim objWriter As New StreamWriter(fileName) 'write crypted content objWriter.Write(Crypter.Crypt(data)) Now I have to reopen the file with Python but I have troubles getting single bytes, this is the XOR function in python: def crypto(self, data): 'crypto(self, data) -> str' return ''.join(chr((ord(x) ^ ord(y)) % 256) \ for (x, y) in izip(data.decode('utf-8'), cycle(self.key)) I had to add the % 256 since sometimes x is 256 i.e. not a single byte. This thing of two bytes being passed does not break the decryption because the key keeps "paired" with the following data. The problem is some decrypted character in the conversion is wrong. These chars are all accented letters like à, è, ì but just a few of the overall accented letters. The others are all correctly restored. I guess it could be due to the 256 mod but without it I of course get a chr exception... Thanks for your support

    Read the article

  • In Python BeautifulSoup How to move tags

    - by JJ
    I have a partially converted XML document in soup coming from HTML. After some replacement and editing in the soup, the body is essentially - <Text...></Text> # This replaces <a href..> tags but automatically creates the </Text> <p class=norm ...</p> <p class=norm ...</p> <Text...></Text> <p class=norm ...</p> and so forth. I need to "move" the <p> tags to be children to <Text> or know how to suppress the </Text>. I want - <Text...> <p class=norm ...</p> <p class=norm ...</p> </Text> <Text...> <p class=norm ...</p> </Text> I've tried using item.insert and item.append but I'm thinking there must be a more elegant solution. for item in soup.findAll(['p','span']): if item.name == 'span' and item.has_key('class') and item['class'] == 'section': xBCV = short_2_long(item._getAttrMap().get('value','')) if currentnode: pass currentnode = Tag(soup,'Text', attrs=[('TypeOf', 'Section'),... ]) item.replaceWith(currentnode) # works but creates end tag elif item.name == 'p' and item.has_key('class') and item['class'] == 'norm': childcdatanode = None for ahref in item.findAll('a'): if childcdatanode: pass newlink = filter_hrefs(str(ahref)) childcdatanode = Tag(soup, newlink) ahref.replaceWith(childcdatanode) Thanks

    Read the article

< Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >