Search Results

Search found 10046 results on 402 pages for 'repository pattern'.

Page 74/402 | < Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >

  • Creating a dynamic linq query

    - by Bas
    I have the following query: from p in dataContext.Repository<IPerson>() join spp1 in dataContext.Repository<ISportsPerPerson>() on p.Id equals spp1.PersonId join s1 in dataContext.Repository<ISports>() on spp1.SportsId equals s1.Id join spp2 in dataContext.Repository<ISportsPerPerson>() on p.Id equals spp2.PersonId join s2 in dataContext.Repository<ISports>() on spp2.SportsId equals s2.Id where s1.Name == "Soccer" && s2.Name == "Tennis" select new { p.Id }; It selects all the person who play Soccer and Tennis. On runtime the user can select other tags to add to the query, for instance: "Hockey". now my question is, how could I dynamically add "Hockey" to the query? If "Hockey" is added to the query, it would look like this: from p in dataContext.Repository<IPerson>() join spp1 in dataContext.Repository<ISportsPerPerson>() on p.Id equals spp1.PersonId join s1 in dataContext.Repository<ISports>() on spp1.SportsId equals s1.Id join spp2 in dataContext.Repository<ISportsPerPerson>() on p.Id equals spp2.PersonId join s2 in dataContext.Repository<ISports>() on spp2.SportsId equals s2.Id join spp3 in dataContext.Repository<ISportsPerPerson>() on p.Id equals spp3.PersonId join s3 in dataContext.Repository<ISports>() on spp3.SportsId equals s3.Id where s1.Name == "Soccer" && s2.Name == "Tennis" && s3.Name == "Hockey" select new { p.Id }; It would be preferable if the query is build up dynamically like: private void queryTagBuilder(List<string> tags) { IDataContext dataContext = new LinqToSqlContext(new L2S.DataContext()); foreach(string tag in tags) { //Build the query? } } Anyone has an idea on how to set this up correctly? Thanks in advance!

    Read the article

  • How to set up a linux user that can only access a repository via ssh?

    - by GJ
    I have a mercurial repository on a secure server, to which I want to grant secure access to an external user. I added for him a user account and publickey ssh authentication so that now he could push/pull changesets via ssh. My question is: how can I make this new user account completely disabled from doing anything or accessing any data on the server other than accessing the repository? E.g. he shouldn't even have the possibility to enter an interactive shell session. Thanks

    Read the article

  • How I do VCS

    - by Wes McClure
    After years of dabbling with different version control systems and techniques, I wanted to share some of what I like and dislike in a few blog posts.  To start this out, I want to talk about how I use VCS in a team environment.  These come in a series of tips or best practices that I try to follow.  Note: This list is subject to change in the future. Always use some form of version control for all aspects of software development. Development is an evolution.  Looking back at where we were is an invaluable asset in that process.  This includes data schemas and documentation. Reverting / reapplying changes is absolutely critical for efficient development. The tools I use: Code: Hg (preferred), SVN Database: TSqlMigrations Documents: Sometimes in code repository, also SharePoint with versioning Always tag a commit (changeset) with comments This is a quick way to describe to someone else (or your future self) what the changeset entails. Be brief but courteous. One or two sentences about the task, not the actual changes. Use precommit hooks or setup the central repository to reject changes without comments. Link changesets to documentation If your project management system integrates with version control, or has a way to externally reference stories, tasks etc then leave a reference in the commit.  This helps locate more information about the commit and/or related changesets. It’s best to have a precommit hook or system that requires this information, otherwise it’s easy to forget. Ability to work offline is required, including commits and history Yes this requires a DVCS locally but doesn’t require the central repository to be a DVCS.  I prefer to use either Git or Hg but if it isn’t possible to migrate the central repository, it’s still possible for a developer to push / pull changes to that repository from a local Hg or Git repository. Never lock resources (files) in a central repository… Rude! We have merge tools for a reason, merging sucked a long time ago, it doesn’t anymore… stop locking files! This is unproductive, rude and annoying to other team members. Always review everything in your commit. Never ever commit a set of files without reviewing the changes in each. Never add a file without asking yourself, deep down inside, does this belong? If you leave to make changes during a review, start the review over when you come back.  Never assume you didn’t touch a file, double check. This is another reason why you want to avoid large, infrequent commits. Requirements for tools Quickly show pending changes for the entire repository. Default action for a resource with pending changes is a diff. Pluggable diff & merge tool Produce a unified diff or a diff of all changes.  This is helpful to bulk review changes instead of opening each file. The central repository is not your own personal dump yard.  Breaking this rule is a sure fire way to get the F bomb dropped in front of your name, multiple times. If you turn on Visual Studio’s commit on closing studio option, I will personally break your fingers. By the way, the person(s) in charge of this feature should be fired and never be allowed near programming, ever again. Commit (integrate) to the central repository / branch frequently I try to do this before leaving each day, especially without a DVCS.  One never knows when they might need to work from remote the following day. Never commit commented out code If it isn’t needed anymore, delete it! If you aren’t sure if it might be useful in the future, delete it! This is why we have history. If you don’t know why it’s commented out, figure it out and then either uncomment it or delete it. Don’t commit build artifacts, user preferences and temporary files. Build artifacts do not belong in VCS, everything in them is present in the code. (ie: bin\*, obj\*, *.dll, *.exe) User preferences are your settings, stop overriding my preferences files! (ie: *.suo and *.user files) Most tools allow you to ignore certain files and Hg/Git allow you to version this as an ignore file.  Set this up as a first step when creating a new repository! Be polite when merging unresolved conflicts. Count to 10, cuss, grab a stress ball and realize it’s not a big deal.  Actually, it’s an opportunity to let you know that someone else is working in the same area and you might want to communicate with them. Following the other rules, especially committing frequently, will reduce the likelihood of this. Suck it up, we all have to deal with this unintended consequence at times.  Just be careful and GET FAMILIAR with your merge tool.  It’s really not as scary as you think.  I personally prefer KDiff3 as its merging capabilities rock. Don’t blindly merge and then blindly commit your changes, this is rude and unprofessional.  Make sure you understand why the conflict occurred and which parts of the code you want to keep.  Apply scrutiny when you commit a manual merge: review the diff! Make sure you test the changes (build and run automated tests) Become intimate with your version control system and the tools you use with it. Avoid trial and error as much as is possible, sit down and test the tool out, read some tutorials etc.  Create test repositories and walk through common scenarios. Find the most efficient way to do your work.  These tools will be used repetitively, so inefficiencies will add up. Sometimes this involves a mix of tools, both GUI and CLI. I like a combination of both Tortoise Hg and hg cli to get the job efficiently. Always tag releases Create a way to find a given release, whether this be in comments or an explicit tag / branch.  This should be readily discoverable. Create release branches to patch bugs and then merge the changes back to other development branch(es). If using feature branches, strive for periodic integrations. Feature branches often cause forked code that becomes irreconcilable.  Strive to re-integrate somewhat frequently with the branch this code will ultimately be merged into.  This will avoid merge conflicts in the future. Feature branches are best when they are mutually exclusive of active development in other branches. Use and abuse local commits , at least one per task in a story. This builds a trail of changes in your local repository that can be pushed to a central repository when the story is complete. Never commit a broken build or failing tests to the central repository. It’s ok for a local commit to break the build and/or tests.  In fact, I encourage this if it helps group the changes more logically.  This is one of the main reasons I got excited about DVCS, when I wanted more than one changeset for a set of pending changes but some files could be grouped into both changesets (like solution file / project file changes). If you have more than a dozen outstanding changed resources, there should probably be more than one commit involved. Exceptions when maintaining code bases that require shotgun surgery, in this case, it’s a design smell :) Don’t version sensitive information Especially usernames / passwords   There is one area I haven’t found a solution I like yet: versioning 3rd party libraries and/or code.  I really dislike keeping any assemblies in the repository, but seems to be a common practice for external libraries.  Please feel free to share your ideas about this below.    -Wes

    Read the article

  • Is event sourcing ready for prime time?

    - by Dakotah North
    Event Sourcing was popularized by LMAX as a means to provide speed, performance scalability, transparent persistence and transparent live mirroring. Before being rebranded as Event Sourcing, this type of architectural pattern was known as System Prevalence but yet I was never familiar with this pattern before the LMAX team went public. Has this pattern proved itself in numerous production systems and therefore even conservative individuals should feel empowered to embrace this pattern or is event sourcing / system prevalence an exotic pattern that is best left for the fearless?

    Read the article

  • Best Practices for High Volume CPA Import Operations with ebXML in B2B 11g

    - by Shub Lahiri, A-Team
    Background B2B 11g supports ebXML messaging protocol, where multiple CPAs can be imported via command-line utilities.  This note highlights one aspect of the best practices for import of CPA, when large numbers of CPAs in the excess of several hundreds are required to be maintained within the B2B repository. Symptoms The import of CPA usually is a 2-step process, namely creating a soa.zip file using b2bcpaimport utility based on a CPA properties file and then using b2bimport to import the b2b repository.  The commands are provided below: ant -f ant-b2b-util.xml b2bcpaimport -Dpropfile="<Path to cpp_cpa.properties>" -Dstandard=true ant -f ant-b2b-util.xml b2bimport -Dlocalfile=true -Dexportfile="<Path to soa.zip>" -Doverwrite=true Usually the first command completes fairly quickly regardless of the number of CPAs in the repository. However, as the number of trading partners within the repository goes up, the time to complete the second command could go up to ~30 secs per operation. So, this could add up to a significant amount, if there is a need to import hundreds of CPA in a production system within a limited downtime, maintenance window.  Remedy In situations, where there is a large number of entries to be imported, it is best to setup a staging environment and go through the import operation of each individual CPA in an empty repository. Since, this will be done in an empty repository, the time taken for completion should be reasonable.  After all the partner profiles have been imported, a full repository export can be taken to capture the metadata for all the entries in one file.  If this single file with all the partner entries is imported in a loaded repository, the total time taken for import of all the CPAs should see a dramatic reduction. Results Let us take a look at the numbers to see the benefit of this approach. With a pre-loaded repository of ~400 partners, the individual import time for each entry takes ~30 secs. So, if we had to import another 100 partners, the individual entries will take ~50 minutes (100 times ~30 secs). On the other hand, if we prepare the repository export file of the same 100 partners from a staging environment earlier, the import takes about ~5 mins. The total processing time for the loading of metadata, specially in a production environment, can thus be shortened by almost a factor of 10. Summary The following diagram summarizes the entire approach and process. Acknowledgements The material posted here has been compiled with the help from B2B Engineering and Product Management teams.

    Read the article

  • Replace with wildcard, in SQL

    - by Jay
    I know MS T-SQL does not support regular expression, but I need similar functionality. Here's what I'm trying to do: I have a varchar table field which stores a breadcrumb, like this: /ID1:Category1/ID2:Category2/ID3:Category3/ Each Category name is preceded by its Category ID, separated by a colon. I'd like to select and display these breadcrumbs but I want to remove the Category IDs and colons, like this: /Category1/Category2/Category3/ Everything between the leading slash (/) up to and including the colon (:) should be stripped out. I don't have the option of extracting the data, manipulating it externally, and re-inserting back into the table; so I'm trying to accomplish this in a SELECT statement. I also can't resort to using a cursor to loop through each row and clean each field with a nested loop, due to the number of rows returned in the SELECT. Can this be done? Thanks all - Jay

    Read the article

  • Javascript regex URL matching

    - by Blondie
    I have this so far: chrome.tabs.getSelected(null, function(tab) { var title = tab.title; var btn = '<a href="' + tab.url + '" onclick="save(\'' + title + '\');"> ' + title + '</a>'; if(tab.url.match('/http:\/\/www.mydomain.com\/version.php/i')) { document.getElementById('link').innerHTML = '<p>' + btn + '</p>'; } }); Basically it should match the domain within this: http://www.mydomain.com/version.php?* Anything that matches that even when it includes something like version.php?ver=1, etc When I used the code above of mine, it doesn't display anything, but when I remove the if statement, it's fine but it shows on other pages which it shouldn't only on the matched URL.

    Read the article

  • Very simple regex not working

    - by Thomas Wanner
    I have read that to match a word inside of a string using Regular expressions (in .NET), I can use the word boundary specifier (\b) within the regex. However, none of these calls result in any matches Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\b@p1\b"); Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\bINSERT\b"); Is there anything I am doing wrong ?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Can anyone explain UriMatcher (Android SDK)?

    - by mobibob
    I have been tasked with designing my web services client code to use the utility class UriMatcher in the Android SDK. Unfortunately, the example in the Dev Guide does not relate to anything in my mind. I know I am missing some fundamental points to the functionality and possibly about Uri itself. If you can tie it to some web APIs that are accessible with HTTP POST request, that would be ideal.

    Read the article

  • Dependency injection and factory

    - by legenden
    Trying to figure out how to best handle the following scenario: Assume a RequestContext class which has a dependency to an external service, such as: public class RequestContext : IRequestContext { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContext(ServiceFactory<IWeatherService> weatherService, UserLocation location, string query) { _weatherService = weatherService; ... What sort of dependency should I require in the class that will ultimately instantiate RequestContext? It could be ServiceFactory<IWeatherService>, but that doesn't seem right, or I could create an IRequestContextFactory for it along the lines of: public class RequestContextFactory : IRequestContextFactory { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContextFactory(ServiceFactory<IWeatherService> weatherService) { _weatherService = weatherService; } public RequestContext Create(UserLocation location, string query) { return new RequestContext(_weatherService, location, query); } } And then pass the IRequestContextFactory through constructor injection. This seems like a good way to do it, but the problem with this approach is that I think it hinders discoverability (devs must know about the factory and implement it, which is not really apparent). Is there a better/more discoverable way that I'm missing?

    Read the article

< Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >