Search Results

Search found 15115 results on 605 pages for 'state pattern'.

Page 74/605 | < Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >

  • Is the usage of Isolated Storage in Silverlight 3 a security concern

    - by Prashant
    I am using Silverlight 3 on my website. I have a Login Page for role based authentication, that routes users with different privileges to different parts of the website. I want to use something analogous to the Session Variables available in standard ASP.Net applications. I intend to use Isolated Storage to achieve this. But I am skeptical about security in this option, as the Isolated Storage exists on the client side, and can be manipulated on client side. I am new to the Isolated Storage concept and don't know about the security options provided by it in terms of Encryption and server-side validation etc. If any of you have used it or are aware of the security provided in this case, could you please shed some light on the same. Thanks

    Read the article

  • How can I write a clean Repository without exposing IQueryable to the rest of my application?

    - by Simucal
    So, I've read all the Q&A's here on SO regarding the subject of whether or not to expose IQueryable to the rest of your project or not (see here, and here), and I've ultimately decided that I don't want to expose IQueryable to anything but my Model. Because IQueryable is tied to certain persistence implementations I don't like the idea of locking myself into this. Similarly, I'm not sure how good I feel about classes further down the call chain modifying the actual query that aren't in the repository. So, does anyone have any suggestions for how to write a clean and concise Repository without doing this? One problem I see, is my Repository will blow up from a ton of methods for various things I need to filter my query off of. Having a bunch of: IEnumerable GetProductsSinceDate(DateTime date); IEnumberable GetProductsByName(string name); IEnumberable GetProductsByID(int ID); If I was allowing IQueryable to be passed around I could easily have a generic repository that looked like: public interface IRepository<T> where T : class { T GetById(int id); IQueryable<T> GetAll(); void InsertOnSubmit(T entity); void DeleteOnSubmit(T entity); void SubmitChanges(); } However, if you aren't using IQueryable then methods like GetAll() aren't really practical since lazy evaluation won't be taking place down the line. I don't want to return 10,000 records only to use 10 of them later. What is the answer here? In Conery's MVC Storefront he created another layer called the "Service" layer which received IQueryable results from the respository and was responsible for applying various filters. Is this what I should do, or something similar? Have my repository return IQueryable but restrict access to it by hiding it behind a bunch of filter classes like GetProductByName, which will return a concrete type like IList or IEnumerable?

    Read the article

  • Using C# and Repository Factory and the error: The requested database is not defined in configurati

    - by odiseh
    hi I am using Repository factory for visual studio 2008 for a personal project. It generated a class called ProductRepository which inherits from Repository. The ProductRepository has a constructor which gets a database name as string and passes it to its base (I mean Repository ). So when I try to debug my project step by step, I pass my database name to ProductRepository but it raises the following error: The requested database is not defined in configuration. What's wrong?

    Read the article

  • Forms Authentication logs out very quickly , locally works fine !!!

    - by user319075
    Hello to all, There's a problem that i am facing with my hosting company, I use a project that uses FormsAuthentication and the problem is that though it successfully logs in, it logs out VERY QUICKLY, and i don't know what could be the cause of that, so in my web.config file i added those lines: <authentication mode="Forms" > <forms name="Nadim" loginUrl="Login.aspx" defaultUrl="Default.aspx" protection="All" path="/" requireSSL="false"/> </authentication> <authorization> <deny users ="?" /> </authorization> <sessionState mode="StateServer" stateConnectionString="tcpip=localhost:42424" cookieless="false" timeout="1440"> </sessionState> and this is the code i use in my custom login page : protected void PasswordCustomValidator_ServerValidate(object source, ServerValidateEventArgs args) { try { UsersSqlDataSource.SelectParameters.Clear(); UsersSqlDataSource.SelectCommand = "Select * From Admins Where AdminID='" + IDTextBox.Text + "' and Password='" + PassTextBox.Text + "'"; UsersSqlDataSource.SelectCommandType = SqlDataSourceCommandType.Text; UsersSqlDataSource.DataSourceMode = SqlDataSourceMode.DataReader; reader = (SqlDataReader)UsersSqlDataSource.Select(DataSourceSelectArguments.Empty); if (reader.HasRows) { reader.Read(); if (RememberCheckBox.Checked == true) Page.Response.Cookies["Admin"].Expires = DateTime.Now.AddDays(5); args.IsValid = true; string userData = "ApplicationSpecific data for this user."; FormsAuthenticationTicket ticket1 = new FormsAuthenticationTicket(1, IDTextBox.Text, System.DateTime.Now, System.DateTime.Now.AddMinutes(30), true, userData, FormsAuthentication.FormsCookiePath); string encTicket = FormsAuthentication.Encrypt(ticket1); Response.Cookies.Add(new HttpCookie(FormsAuthentication.FormsCookieName, encTicket)); Response.Redirect(FormsAuthentication.GetRedirectUrl(IDTextBox.Text, RememberCheckBox.Checked)); //FormsAuthentication.RedirectFromLoginPage(IDTextBox.Text, RememberCheckBox.Checked); } else args.IsValid = false; } catch (SqlException ex) { ErrorLabel.Text = ex.Message; } catch (InvalidOperationException) { args.IsValid = false; } catch (Exception ex) { ErrorLabel.Text = ex.Message; } Also you will find that line of code: FormsAuthentication.RedirectFromLoginPage(IDTextBox.Text, RememberCheckBox.Checked); is commented because i thought there might be something wrong with the ticket when i log in , so i created it manually , every thing i know i tried but nothing worked, so does anyone have any idea what is the problem ? Thanks in advance, Baher.

    Read the article

  • Very simple regex not working

    - by Thomas Wanner
    I have read that to match a word inside of a string using Regular expressions (in .NET), I can use the word boundary specifier (\b) within the regex. However, none of these calls result in any matches Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\b@p1\b"); Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\bINSERT\b"); Is there anything I am doing wrong ?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • In NHIbernate, why does SaveOrUpdate() update the Version, but SaveOrUpdateCopy() doesn't?

    - by Daniel T.
    I have a versioned entity, and this is what happens when I use SaveOrUpdate() vs. SaveOrUpdateCopy(): // create new entity var entity = new Entity{ Id = Guid.Empty }); Console.WriteLine(entity.Version); // prints out 0 // save the new entity GetNewSession(); entity.SaveOrUpdate(); Console.WriteLine(entity.Version); // prints out 1 GetNewSession(); // loads the persistent entity into the session, so we have to use // SaveOrUpdateCopy() to merge the following transient entity var dbEntity = Database.GetAll<Entity>(); // new, transient entity used to update the persistent entity in the session var newEntity = new Entity{ Id = Guid.Empty }); newEntity.SaveOrUpdateCopy(); Console.WriteLine(entity.Version); // prints out 1, but should be 2 Why is the version number is not updated for SaveOrUpdateCopy()? As I understand it, the transient entity is merged with the persistent entity. The SQL calls confirm that the data is updated. At this point, shouldn't newEntity become persistent, and the version number incremented?

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • Tabular (X)HTML forms

    - by detly
    I have a set of items that can be in various states. I want to allow a user to use an (X)HTML form to change the state, and easily view the state of a group of objects ...so to this end, I'd like a layout like: | item1 | radio button for state 1 | radio for state 2 | ... | [update button] | | item2 | radio button for state 1 | radio for state 2 | ... | [update button] | etc. I prefer the radio buttons to list boxes so that it's easy for a user to visually scan for things in a certain state. It seemed like perfectly tabular data to me. The only problem is, you can't have forms inside a table that cross table cells (ie. <tr> <form> <td> ... is invalid). I thought, "hey, I could have one giant form wrapping a table, and make the [update button] value contain the IDs for each row!" Turns out certain versions of IE send ALL THE SUBMIT BUTTON VALUES on any single form. So I thought perhaps to to lay it out with <div>s and place the forms inside a single <td>. But then they break a line on each <div>. So I fixed their width and made them float: left. But then they wrap inside the table cells if the table row is wider than the page, and the radio controls don't line up with the headings. Is it possible to lay this out as I intend? The XHTML below shows the intended structure. Observe what happens if you resize the browser window below the width of the table (ideally, the name would break or the table would show a scroll bar). <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en"> <head><title>Test</title> <style type="text/css"> .state-select, .thing-state-name, .update { float: left; width: 8em; } .state-select { text-align: center; } </style> </head> <body> <table> <thead> <tr> <th class="thing-name-header">Thing</th> <th> <div class="thing-state-name">Present</div> <div class="thing-state-name">Absent</div> <div class="thing-state-name">Haven't looked</div> </th> </tr> </thead> <tbody> <tr> <td>Apple</td> <td> <form action="something" method="post"> <input type="hidden" name="id" value="1" /> <div class="state-select"><input type="radio" name="presence" value="present" checked="checked" /></div> <div class="state-select"><input type="radio" name="presence" value="absent" /></div> <div class="state-select"><input type="radio" name="presence" value="unknown" /></div> <div class="update"><input type="submit" value="Update" /></div> </form> </td></tr> <tr> <td>Orange</td> <td> <form action="something" method="post"> <input type="hidden" name="id" value="2" /> <div class="state-select"><input type="radio" name="presence" value="present" /></div> <div class="state-select"><input type="radio" name="presence" value="absent" checked="checked" /></div> <div class="state-select"><input type="radio" name="presence" value="unknown" /></div> <div class="update"><input type="submit" value="Update" /></div> </form> </td></tr> <tr> <td>David Bowie</td> <td> <form action="something" method="post"> <input type="hidden" name="id" value="3" /> <div class="state-select"><input type="radio" name="presence" value="present" /></div> <div class="state-select"><input type="radio" name="presence" value="absent" /></div> <div class="state-select"><input type="radio" name="presence" value="unknown" checked="checked" /></div> <div class="update"><input type="submit" value="Update" /></div> </form> </td></tr> </tbody> </table> </body> </html>

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Maintaining session information between 2 asp.net calls programmatically?

    - by Santhosh
    Hi, I'm not sure if I'll be clear enough in my explaination to make you guys understand, but I'll try. Here's my problem: We have an external site which the users in our company connect to by giving their corresponding username and password. The external site is an ASP.NET website. We want to integrate this website into our intranet portal so that the users don't have to enter their UN/Pwd to login to the website. Since the target website has no provision for SSO, we are simulating the POST request to login. So far so good. We are now required to perform an action after the initial login is done, on an another page. We can simulate the corresponding POST request as well. But the problem is since we are not maintaining any session information in our initial POST request, it always redirects to the login screen! Is there any way to maintain ASP.NET session information between multiple calls done programmatically? Can we create an ASP.NET session id cookie programmatically and then pass it along with our initial request? Or this is not possible at all? Any comments are appreciated. Thanks for your help. Regards.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Session Objects not Updating ASP.NET

    - by davemackey
    I set a session object at one juncture in my code: Session("my_name") = "Dave" Later in my code I give the user a chance to update this object: Session("my_name") = TextBox1.Text I reload my page and display a little hello statement like this: Label1.Text = "Hello" & CStr(Session("my_name")) The result is: "Hello Dave" no matter what I change Session("my_name") too.

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • storing session data in mysql using php is not retrieving the data properly from the tables.

    - by Ronedog
    I have a problem retrieving some data from the $_SESSION using php and mysql. I've commented out the line in php.ini that tells the server to use the "file" to store the session info so my database will be used. I have a class that I use to write the information to the database and its working fine. When the user passes their credentials the class gets instantiated and the $_SESSION vars get set, then the user gets redirected to the index page. The index.php page includes the file where the db session class is, which when instantiated calles session_start() and the session variables should be in $_SESSION, but when I do var_dump($_SESSION) there is nothing in the array. However, when I look at the data in mysql, all the session information is in there. Its acting like session_start() has not been called, but by instantiating the class it is. Any idea what could be wrong? Here's the HTML: <?php include_once "classes/phpsessions_db/class.dbsession.php"; //used for sessions var_dump($_SESSION); ?> <html> . . . </html> Here's the dbsession class: <?php error_reporting(E_ALL); class dbSession { function dbSession($gc_maxlifetime = "", $gc_probability = "", $gc_divisor = "") { // if $gc_maxlifetime is specified and is an integer number if ($gc_maxlifetime != "" && is_integer($gc_maxlifetime)) { // set the new value @ini_set('session.gc_maxlifetime', $gc_maxlifetime); } // if $gc_probability is specified and is an integer number if ($gc_probability != "" && is_integer($gc_probability)) { // set the new value @ini_set('session.gc_probability', $gc_probability); } // if $gc_divisor is specified and is an integer number if ($gc_divisor != "" && is_integer($gc_divisor)) { // set the new value @ini_set('session.gc_divisor', $gc_divisor); } // get session lifetime $this->sessionLifetime = ini_get("session.gc_maxlifetime"); //Added by AARON. cancel the session's auto start,important, without this the session var's don't show up on next pg. session_write_close(); // register the new handler session_set_save_handler( array(&$this, 'open'), array(&$this, 'close'), array(&$this, 'read'), array(&$this, 'write'), array(&$this, 'destroy'), array(&$this, 'gc') ); register_shutdown_function('session_write_close'); // start the session @session_start(); } function stop() { $new_sess_id = $this->regenerate_id(true); session_unset(); session_destroy(); return $new_sess_id; } function regenerate_id($return_val=false) { // saves the old session's id $oldSessionID = session_id(); // regenerates the id // this function will create a new session, with a new id and containing the data from the old session // but will not delete the old session session_regenerate_id(); // because the session_regenerate_id() function does not delete the old session, // we have to delete it manually //$this->destroy($oldSessionID); //ADDED by aaron // returns the new session id if($return_val) { return session_id(); } } function open($save_path, $session_name) { // global $gf; // $gf->debug_this($gf, "GF: Opening Session"); // change the next values to match the setting of your mySQL database $mySQLHost = "localhost"; $mySQLUsername = "user"; $mySQLPassword = "pass"; $mySQLDatabase = "sessions"; $link = mysql_connect($mySQLHost, $mySQLUsername, $mySQLPassword); if (!$link) { die ("Could not connect to database!"); } $dbc = mysql_select_db($mySQLDatabase, $link); if (!$dbc) { die ("Could not select database!"); } return true; } function close() { mysql_close(); return true; } function read($session_id) { $result = @mysql_query(" SELECT session_data FROM session_data WHERE session_id = '".$session_id."' AND http_user_agent = '".$_SERVER["HTTP_USER_AGENT"]."' AND session_expire > '".time()."' "); // if anything was found if (is_resource($result) && @mysql_num_rows($result) > 0) { // return found data $fields = @mysql_fetch_assoc($result); // don't bother with the unserialization - PHP handles this automatically return unserialize($fields["session_data"]); } // if there was an error return an empty string - this HAS to be an empty string return ""; } function write($session_id, $session_data) { // global $gf; // first checks if there is a session with this id $result = @mysql_query(" SELECT * FROM session_data WHERE session_id = '".$session_id."' "); // if there is if (@mysql_num_rows($result) > 0) { // update the existing session's data // and set new expiry time $result = @mysql_query(" UPDATE session_data SET session_data = '".serialize($session_data)."', session_expire = '".(time() + $this->sessionLifetime)."' WHERE session_id = '".$session_id."' "); // if anything happened if (@mysql_affected_rows()) { // return true return true; } } else // if this session id is not in the database { // $gf->debug_this($gf, "inside dbSession, trying to write to db because session id was NOT in db"); $sql = " INSERT INTO session_data ( session_id, http_user_agent, session_data, session_expire ) VALUES ( '".serialize($session_id)."', '".$_SERVER["HTTP_USER_AGENT"]."', '".$session_data."', '".(time() + $this->sessionLifetime)."' ) "; // insert a new record $result = @mysql_query($sql); // if anything happened if (@mysql_affected_rows()) { // return an empty string return ""; } } // if something went wrong, return false return false; } function destroy($session_id) { // deletes the current session id from the database $result = @mysql_query(" DELETE FROM session_data WHERE session_id = '".$session_id."' "); // if anything happened if (@mysql_affected_rows()) { // return true return true; } // if something went wrong, return false return false; } function gc($maxlifetime) { // it deletes expired sessions from database $result = @mysql_query(" DELETE FROM session_data WHERE session_expire < '".(time() - $maxlifetime)."' "); } } //End of Class $session = new dbsession(); ?>

    Read the article

  • A tool or framework extension or code snippet for logging the internal state of objects?

    - by George Mauer
    When spiking on how something works or when my unit test behave in an unpredictable manner I usually have to drop into debug mode. 99% of my time in debug mode is spent checking the values of fields on objects to verify its state. I already have log4net set up, it would seem that if I could easily add a line of code to log out the state of objects I could remove most of my need to start up the bulky debugger. The problem is of course that to expose object state implicitly you need to manually override each object's ToString() method. What I would like to be able to do is the ability to do logger.LogState(someObject) and have logged out the object state including at least a formatted list of all the private variables, references (to some arbitrary depth), and collections. Does anyone know a tool/framework/code snippet that can be used to generate a string of the internal state of any object? I could of course write one myself but its a non-trivial problem and I'd prefer something someone has put some thought into.

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

< Previous Page | 70 71 72 73 74 75 76 77 78 79 80 81  | Next Page >