Search Results

Search found 60513 results on 2421 pages for 'parse com'.

Page 757/2421 | < Previous Page | 753 754 755 756 757 758 759 760 761 762 763 764  | Next Page >

  • Error in Decompression?

    - by user595606
    I am writing a crawler for a website. Its response is gzip encoded. I am not able to parse correctly a particular field, though the decompression is successful. I am also using htmlagilitypack to parse it, the parsed value of the field is only a part of the original value as an example : I am getting only /wEWAwKc04vTCQKb86mzBwKln/PuCg== whereas the firebug shows the actual value as much longer: /wEWBgKj7IuJCgKb86mzBwKln/PuCgLT250qAtC0+8cMAvimiNYD what does the '==' at the end means? I am assuming it that its a error on decompressors behalf?

    Read the article

  • Combining DROP USER and DROP DATABASE with SELECT .. WHERE query?

    - by zsero
    I'd like to make a very simple thing, replicate the functionality of mysql's interactive mysql_secure_installation script. My question is that is there a simple, built-in way in MySQL to combine the output of a SELECT query with the input of a DROP user or DROP database script? For example, if I'd like to drop all users with empty passwords. How could I do that with DROP USER statement? I know an obvious solution would be to run everything for example from a Python script, run a query with mysql -Bse "select..." parse the output with some program construct the drop query run it. Is there an easy way to do it in a simple SQL query? I've seen some example here, but I wouldn't call it simple: http://stackoverflow.com/a/12097567/518169 Would you recommend making a combined query, or just to parse the output using for example Python or bash scripts/sed?

    Read the article

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • dijit.form.FilteringSelectinitial initial value always null.

    - by jiggs
    I'm using QueryReadStore as data and displaying the widget using the declarative way. My store looks like this: <div style="display:none" jsId="role_store" url="some/url/here" requestMethod="post" dojoType="dojox.data.QueryReadStore"></div> My widget is like this: <input dojoType="dijit.form.FilteringSelect" id="role_id" name="role_name" required="false" store="role_store" value="100" searchAttr="description"> Scenario: store is declared inside the HTML page. widget is loaded using parse.parse in the javascript. Issue: At first click no displayed value on the widget. But at the second click, values are displayed right.

    Read the article

  • Why is this variable declared as private and also readonly?

    - by Sergio Tapia
    In the following code: public class MovieRepository : IMovieRepository { private readonly IHtmlDownloader _downloader; public MovieRepository(IHtmlDownloader downloader) { _downloader = downloader; } public Movie FindMovieById(string id) { var idUri = ...build URI...; var html = _downloader.DownloadHtml(idUri); return ...parse ID HTML...; } public Movie FindMovieByTitle(string title) { var titleUri = ...build URI...; var html = _downloader.DownloadHtml(titleUri); return ...parse title HTML...; } } I asked for something to review my code, and someone suggested this approach. My question is why is the IHtmlDownloader variable readonly?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • [PHP] Using cURL to download large XML files

    - by ndg
    I'm working with PHP and need to parse a number of fairly large XML files (50-75MB uncompressed). The issue, however, is that these XML files are stored remotely and will need to be downloaded before I can parse them. Having thought about the issue, I think using a system() call in PHP in order to initiate a cURL transfer is probably the best way to avoid timeouts and PHP memory limits. Has anyone done anything like this before? Specifically, what should I pass to cURL to download the remote file and ensure it's saved to a local folder of my choice?

    Read the article

  • Read binary data from a MDB-file running under LAMP

    - by BusterX
    I need to be able to connect to an MDB-file in a LAMP-environment (running on Linux) and ultimately insert converted data into a Mysql db. The data I need to access is stored as a BLOB (Long Binary Data according to Access) in the MDB file. I have not yet been able to actually have a look at the data but I have been told that the BLOB consists of byte strings. Something along the lines of: 0x1c 0x10 0x27 0x00 0x00 I need to parse the byte strings and convert these to a format that is human readable. I do have access to the documentation that explains the various byte strings. So this is really two questions: How do a get access to the MDB file via PHP* (running under LAMP) and read the BLOB (I do not have access to a Windows-platform)? What would be the best way to parse the binary data (in PHP*) once I am able to connect to the MDB-file? *Or are there other methods/languages that are more appropriate?

    Read the article

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • PHP Multiple User Login Form - Navigation to Different Pages Based on Login Credentials

    - by Zulu Irminger
    I am trying to create a login page that will send the user to a different index.php page based on their login credentials. For example, should a user with the "IT Technician" role log in, they will be sent to "index.php", and if a user with the "Student" role log in, they will be sent to the "student/index.php" page. I can't see what's wrong with my code, but it's not working... I'm getting the "wrong login credentials" message every time I press the login button. My code for the user login page is here: <?php session_start(); if (isset($_SESSION["manager"])) { header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); exit(); } ?> <?php if (isset($_POST["username"]) && isset($_POST["password"]) && isset($_POST["role"])) { $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["username"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if (($existCount == 1) && ($role == 'IT Technician')) { while ($row = mysql_fetch_array($sql)) { $id = $row["id"]; } $_SESSION["id"] = $id; $_SESSION["manager"] = $manager; $_SESSION["password"] = $password; $_SESSION["role"] = $role; header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); } else { echo 'Your login details were incorrect. Please try again <a href="http://www.zuluirminger.com/SchoolAdmin/index.php">here</a>'; exit(); } } ?> <?php if (isset($_POST["username"]) && isset($_POST["password"]) && isset($_POST["role"])) { $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["username"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if (($existCount == 1) && ($role == 'Student')) { while ($row = mysql_fetch_array($sql)) { $id = $row["id"]; } $_SESSION["id"] = $id; $_SESSION["manager"] = $manager; $_SESSION["password"] = $password; $_SESSION["role"] = $role; header("location: http://www.zuluirminger.com/SchoolAdmin/student/index.php"); } else { echo 'Your login details were incorrect. Please try again <a href="http://www.zuluirminger.com/SchoolAdmin/index.php">here</a>'; exit(); } } ?> And the form that the data is pulled from is shown here: <form id="LoginForm" name="LoginForm" method="post" action="http://www.zuluirminger.com/SchoolAdmin/user_login.php"> User Name:<br /> <input type="text" name="username" id="username" size="50" /><br /> <br /> Password:<br /> <input type="password" name="password" id="password" size="50" /><br /> <br /> Log in as: <select name="role" id="role"> <option value="">...</option> <option value="Head">Head</option> <option value="Deputy Head">Deputy Head</option> <option value="IT Technician">IT Technician</option> <option value="Pastoral Care">Pastoral Care</option> <option value="Bursar">Bursar</option> <option value="Secretary">Secretary</option> <option value="Housemaster">Housemaster</option> <option value="Teacher">Teacher</option> <option value="Tutor">Tutor</option> <option value="Sanatorium Staff">Sanatorium Staff</option> <option value="Kitchen Staff">Kitchen Staff</option> <option value="Parent">Parent</option> <option value="Student">Student</option> </select><br /> <br /> <input type="submit" name = "button" id="button" value="Log In" onclick="javascript:return validateLoginForm();" /> </h3> </form> Once logged in (and should the correct page be loaded, the validation code I have at the top of the script looks like this: <?php session_start(); if (!isset($_SESSION["manager"])) { header("location: http://www.zuluirminger.com/SchoolAdmin/user_login.php"); exit(); } $managerID = preg_replace('#[^0-9]#i', '', $_SESSION["id"]); $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["manager"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if ($existCount == 0) { header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); exit(); } ?> Just so you're aware, the database table has the following fields: id, username, password and role. Any help would be greatly appreciated! Many thanks, Zulu

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • In BASH how can i find my system on active internet interface, what is the upload speed?

    - by YumYumYum
    I am trying to write an TUI bandwidth trace application which on query can instantly tell me, that my download and upload speed is XXXX. I have figured out that download i can use with wget and parse it using BASH, but how do i get the upload speed? Example of download parse method: 1) Remote download : wget http://x.x.com:7007/files/software/vnc.zip Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 573K/s in 2.7s 2012-03-24 11:35:22 (573 KB/s) - `vnc.zip' saved [1594344/1594344] 2) Local download tells Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 --.-K/s in 0.1s 2012-03-24 06:43:04 (11.4 MB/s) - `vnc.zip' saved [1594344/1594344]

    Read the article

  • Validating XML with multiple XSDs in Java

    - by Arian
    Hello! I want to parse an XML file with Java and validate it in the same step against an XSD schema. An XML file may contain content of several schemas, like this: <outer xmlns="my.outer.namespace" xmlns:x="my.third.namespace"> <foo>hello</foo> <inner xmlns="my.inner.namespace"> <bar x:id="bar">world</bar> </inner> </outer> Given a namespace the corresponding xsd file can be provided, but the used namespaces are unknown before parsing. If a schema defines default values for attributes, I also want to know that somehow. I was able to validate a file if the schemas are known, I was able to parse a file without validation and I implemented a LSResourceResolver. However, I can't get all of it working together. How do I have to set up my (SAX) parser?

    Read the article

  • Java simple data format british time

    - by DD
    Hi, I am using simple date format to allow users to specify which time zone they are sending data in: DateFormat df = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss,z"); This works fine: e.g. df.parse("2009-05-16 11:07:41,GMT"); However, if someone is always sending time in London time (i.e. taking into account daylight savings), what would be the approriate time zone String to add? e.g. this doesnt work: df.parse("2009-05-16 11:07:41,Europe/London"); Thanks.

    Read the article

  • Having trouble reading XML file from Windows server. Works on Linux

    - by DuFF14
    I'm parsing an XML file in an android app. My success varies depending upon where the file is hosted. After hosting the file on 4 different servers (2 Linux, 2 Windows), I discovered that when the xml is hosted on a Linux server, the app works. When it's hosted on a Windows server, I am unable to parse correctly. Instead of reading the expected xml tags, it reads HTML tags (, , , etc). I'm not sure why it doesn't work on Windows servers, or if that is even the issue and not just a coincidence. Any help is appreciated. Thanks. Here is my code: private void getXmlData() { HttpClient httpclient = new DefaultHttpClient(); String url = XML_URL; HttpPost httppost = new HttpPost(url); HttpResponse response = httpclient.execute(httppost); SaxParser saxParser = new SaxParser(response); parsedXML = saxParser.parse(); }

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

  • insert a date in mysql database

    - by kawtousse
    I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

    Read the article

  • What is the right method for parsing a blog post?

    - by Zedwal
    Hi guys, Need a guide line .... I am trying to write a personal blog. What is the standard structure for for input for the post. I am trying the format like: This is the simple text And I am [b] bold text[/b]. This is the code part: [code lang=java] public static void main (String args[]) { System.out.println("Hello World!"); } [/code] Is this the right way to store post in the database? And What is the right method to parse this kind of post? Shall I use regular expression to parse this or there is another standard for this. If the above mentioned format is not the right way for storage, then what it could be? Thanks

    Read the article

  • Repeating a object that only occurs couple of times and has different values with htmlagilitypack c#.

    - by dtd
    I have a problem I cant seem to solve here. Lets say I have some html like beneth here that I want to parse. All this html is within one list on the page. And the names repeat themself like in the example I wrote. <li class = "seperator"> a date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "seperator"> a new date </li> <li class = "lol"> some text </li> <li class = "seperator"> a nother new date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> I did manage to use htmlagility pack to parse every li object seperate, and almost formating it how I want. My print atm looks something like this: "a date" "some text" "some text" "some text" "some text" "a new date" "some text" "a nother new date " "some text" "some text" "some text" What I want to achive: "a date" "some text" "a date" "some text" "a date" "some text" "a date" "some text" "a new date" "some text" "a nother new date " "some text" "a nother new date " "some text" "a nother new date " "some text" But the problem is that beneath every seperator, the count of every lol object may vary. So one day, the webpage may have one lol object beneth date 1, and the next day it may have 10 lol objects. So I am woundering if there is an smart/easy way to somehow count the number of lol objects in between the seperators. Or if there is another way to figure this out? Within for example htmlagilitypack. And yes, I need the correct date in front of every lol object, not just infront the first one. This would have been a pice of cake if the seperator class would have ended beneath the last lol object, but sadly that is not the case... I dont think that I need to paste my code here, but basicly what I do is to parse the page, extract the seperators and lol objects and add them to a list, where I split them up to seperator and lol objects. Then I print it out to a file and since the seperator only occure 3 times(in the example) I will only get out 3 seperate dates.

    Read the article

< Previous Page | 753 754 755 756 757 758 759 760 761 762 763 764  | Next Page >