Search Results

Search found 60513 results on 2421 pages for 'parse com'.

Page 757/2421 | < Previous Page | 753 754 755 756 757 758 759 760 761 762 763 764  | Next Page >

  • GQL, Aggregation and Order By

    - by Koran
    Hi, How can GQL support ORDER BY when it does not support aggregation? The question is - if say the result of the query is more than 1000, does ORDER BY return fully ordered list or only the first 1000 items which is then ordered? To explain the question more: is conceptually MIN() same as query.orderby('asc').fetch(1)? If it is properly ordering the list, then how can it not provide COUNT(), since to properly order the list, GQL possibly has to parse through the whole list - in which case, COUNT() is not an issue at all? Or is item indexed and kept in some type of tree so that it does not need to parse it all the time?

    Read the article

  • C# SQL Parameter Errors in Loops

    - by jakesankey
    Please help me out with this. I have this small application to load txt files into a sql db and it works fine with sqlite. When I ported to SQL I started getting 'parameter already declared' errors.. If anyone can help me reorganize this code, it would be great! I need to get the parameter definitions outside of the loops or something.. using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"SELECT FileName FROM Import;"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { Console.WriteLine("Connecting to SQL server..."); SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R.txt*", SearchOption.AllDirectories); insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.String)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { var FileNameExt1 = Path.GetFileName(file); cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } } FYI - the PartNumber, CMMNumber, Date, etc at the bottom are pulled from the file name and I need it in the table next to each respective record.

    Read the article

  • How should I handle searching through byte arrays in Java?

    - by Zombies
    Preliminary: I am writting my own httpclient in Java. I am trying to parse out the contents of chunked encoding. Here is my dilema: Since I am trying to parse out chunked http transfer encoding with a gzip payload there is a mix of ascii and binary. I can't just take the http resp content and convert it to a string and make use of StringUtils since the binary data can easily contain nil characters. So what I need to do is some basic things for parsing out each chunk and its chunk length (as per chunked transfer/HTTP/1.1 spec). Are there any helpful ways of searching through byte arrays of binary/part ascii data for certain patterns (like a CR LF) (instead of just a single byte) ? Or must I write the for loops for this?

    Read the article

  • Error in Decompression?

    - by user595606
    I am writing a crawler for a website. Its response is gzip encoded. I am not able to parse correctly a particular field, though the decompression is successful. I am also using htmlagilitypack to parse it, the parsed value of the field is only a part of the original value as an example : I am getting only /wEWAwKc04vTCQKb86mzBwKln/PuCg== whereas the firebug shows the actual value as much longer: /wEWBgKj7IuJCgKb86mzBwKln/PuCgLT250qAtC0+8cMAvimiNYD what does the '==' at the end means? I am assuming it that its a error on decompressors behalf?

    Read the article

  • How do I add Objective C code to a FireBreath Project?

    - by jmort253
    I am writing a browser plugin for Mac OS that will place a status bar icon in the status bar, which users can use to interface with the browser plugin. I've successfully built a FireBreath 1.6 project in XCode 4.4.1, and can install it in the browser. However, FireBreath uses C++, whereas a large majority of the existing libraries for Mac OS are written in Objective C. In the /Mac/projectDef.make file, I added the Cocoa Framework and Foundation Framework, as suggested here and in other resources I've found on the Internet: target_link_libraries(${PROJECT_NAME} ${PLUGIN_INTERNAL_DEPS} ${Cocoa.framework} # added line ${Foundation.framework} # added line ) I reran prepmac.sh, expecting a new project to be created in XCode with my .mm files, and .m files; however, it seems that they're being ignored. I only see the .cpp and .h files. I added rules for those in the projectDef.make file, but it doesn't seem to make a difference: file (GLOB PLATFORM RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} Mac/[^.]*.cpp Mac/[^.]*.h Mac/[^.]*.m #added by me Mac/[^.]*.mm #added by me Mac/[^.]*.cmake ) Even if I add the files in manually, I get a series of compilation errors. There are about 20 of them, all related to the file NSObjRuntime.h file: Parse Issue - Expected unqualified-id Parse Issue - Unknown type name 'NSString' Semantic Issue - Use of undeclared identifier 'NSString' Parse Issue - Unknown type name 'NSString' ... ... Semantic Issue - Use of undeclared identifier 'aSelectorName' ... ... Semantic Issue - Use of undeclared identifier 'aClassName' ... It continues like this for some time with similar errors... From what I've read, these errors appear because of dependencies on the Foundation Framework, which I believe I've included in the project. I also tried clicking the project in XCode I'm to the point now where I'm not sure what to try next. People say it's not hard to use Objective C in C/C++ code, but being new to XCode and Objective C might contribute to my confusion. This is only day 4 for me in this new platform. What do I need to do to get XCode to compile the Objective C code? Please remember that I'm a little new to this, so I'd appreciate it if you leave detailed answers as opposed to the vague one-liners that are common in the firebreath tag. I'm just a little in over my head, but if you can get me past this hurdle I'm certain I'll be good to go from there. UPDATE: I edited projects/MyPlugin/CMakeLists.txt and added in the .m and .mm rules there too. after running prepmac.sh, the files are included in the project, but I still get the same compile errors. I moved all the .h files and .mm files from the Obj C code to the MyPlugin root folder and reran the prepmac.sh file. Problem still exists. Same compile errors.

    Read the article

  • Combining DROP USER and DROP DATABASE with SELECT .. WHERE query?

    - by zsero
    I'd like to make a very simple thing, replicate the functionality of mysql's interactive mysql_secure_installation script. My question is that is there a simple, built-in way in MySQL to combine the output of a SELECT query with the input of a DROP user or DROP database script? For example, if I'd like to drop all users with empty passwords. How could I do that with DROP USER statement? I know an obvious solution would be to run everything for example from a Python script, run a query with mysql -Bse "select..." parse the output with some program construct the drop query run it. Is there an easy way to do it in a simple SQL query? I've seen some example here, but I wouldn't call it simple: http://stackoverflow.com/a/12097567/518169 Would you recommend making a combined query, or just to parse the output using for example Python or bash scripts/sed?

    Read the article

  • Java simple data format british time

    - by DD
    Hi, I am using simple date format to allow users to specify which time zone they are sending data in: DateFormat df = new SimpleDateFormat("yyyy-MM-dd HH:mm:ss,z"); This works fine: e.g. df.parse("2009-05-16 11:07:41,GMT"); However, if someone is always sending time in London time (i.e. taking into account daylight savings), what would be the approriate time zone String to add? e.g. this doesnt work: df.parse("2009-05-16 11:07:41,Europe/London"); Thanks.

    Read the article

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Validating XML with multiple XSDs in Java

    - by Arian
    Hello! I want to parse an XML file with Java and validate it in the same step against an XSD schema. An XML file may contain content of several schemas, like this: <outer xmlns="my.outer.namespace" xmlns:x="my.third.namespace"> <foo>hello</foo> <inner xmlns="my.inner.namespace"> <bar x:id="bar">world</bar> </inner> </outer> Given a namespace the corresponding xsd file can be provided, but the used namespaces are unknown before parsing. If a schema defines default values for attributes, I also want to know that somehow. I was able to validate a file if the schemas are known, I was able to parse a file without validation and I implemented a LSResourceResolver. However, I can't get all of it working together. How do I have to set up my (SAX) parser?

    Read the article

  • Datetime comparaison in CAML Query for Sharepoint

    - by Garcia Julien
    Hi, i'm trying to have some item from a sharepoint list, depends on date in a custom column. I've created my query with 2U2 Caml Builder, and that's worked but when I put it in my own code in my webpart, it always return to me all the items od the list. Here is my code: DateTime startDate = new DateTime(Int32.Parse(year), 1, 1); DateTime endDate = new DateTime(Int32.Parse(year), 12, 31); SPQuery q = new SPQuery(); q.Query = "<Query><Where><And><Geq><FieldRef Name='Publicate Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(startDate) + "</Value></Geq><Leq><FieldRef Name='Publicate_x0020_Date' /><Value IncludeTimeValue='FALSE' Type='DateTime'>" + SPUtility.CreateISO8601DateTimeFromSystemDateTime(endDate) + "</Value></Leq></And></Where></Query>"; SPListItemCollection allItem = library.GetItems(q);

    Read the article

  • Extracting multiple values from a string with RegEx

    - by Toni Frankola
    I have an input string that's generated as in following example: string.Format("Document {0}, was saved by {1} on {2}. The process was completed {3} milliseconds and data was received.", "Document.docx", "John", "1/1/2011", 45); Generate string looks like this then: Document Document.docx, was saved by John on 1/1/2011. The process was completed 45 milliseconds and data was received. Once such a string is received from a different application, what would be the easiest way to parse with regex and extract values Document.docx, John, 1/1/2011, 45 from it. I am looking for the easiest way to do this as we will have to parse a number of different input strings.

    Read the article

  • Invalid ADTS sampling_frequency_index and channel_configuration why?

    - by Moto
    Hello all, I hope someone can direct me on the right path before I put a lot of time and effort on this. I'm currently trying to parse an AAC+ frame to get information such as number of channels and sample frequency. So it seems that we can simply get this information from the ADTS header but most of the time this information is inaccurate. So the question is: -Why is this data inaccurate? What is the meaning of the ADTS header channel and sample freq? Should I rely on it? -Should I parse further down the frame to get this information? FYI, the AAC+ raw data is coming from streaming servers... Thanks for the help! -Moto

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • PHP Multiple User Login Form - Navigation to Different Pages Based on Login Credentials

    - by Zulu Irminger
    I am trying to create a login page that will send the user to a different index.php page based on their login credentials. For example, should a user with the "IT Technician" role log in, they will be sent to "index.php", and if a user with the "Student" role log in, they will be sent to the "student/index.php" page. I can't see what's wrong with my code, but it's not working... I'm getting the "wrong login credentials" message every time I press the login button. My code for the user login page is here: <?php session_start(); if (isset($_SESSION["manager"])) { header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); exit(); } ?> <?php if (isset($_POST["username"]) && isset($_POST["password"]) && isset($_POST["role"])) { $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["username"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if (($existCount == 1) && ($role == 'IT Technician')) { while ($row = mysql_fetch_array($sql)) { $id = $row["id"]; } $_SESSION["id"] = $id; $_SESSION["manager"] = $manager; $_SESSION["password"] = $password; $_SESSION["role"] = $role; header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); } else { echo 'Your login details were incorrect. Please try again <a href="http://www.zuluirminger.com/SchoolAdmin/index.php">here</a>'; exit(); } } ?> <?php if (isset($_POST["username"]) && isset($_POST["password"]) && isset($_POST["role"])) { $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["username"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_POST["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if (($existCount == 1) && ($role == 'Student')) { while ($row = mysql_fetch_array($sql)) { $id = $row["id"]; } $_SESSION["id"] = $id; $_SESSION["manager"] = $manager; $_SESSION["password"] = $password; $_SESSION["role"] = $role; header("location: http://www.zuluirminger.com/SchoolAdmin/student/index.php"); } else { echo 'Your login details were incorrect. Please try again <a href="http://www.zuluirminger.com/SchoolAdmin/index.php">here</a>'; exit(); } } ?> And the form that the data is pulled from is shown here: <form id="LoginForm" name="LoginForm" method="post" action="http://www.zuluirminger.com/SchoolAdmin/user_login.php"> User Name:<br /> <input type="text" name="username" id="username" size="50" /><br /> <br /> Password:<br /> <input type="password" name="password" id="password" size="50" /><br /> <br /> Log in as: <select name="role" id="role"> <option value="">...</option> <option value="Head">Head</option> <option value="Deputy Head">Deputy Head</option> <option value="IT Technician">IT Technician</option> <option value="Pastoral Care">Pastoral Care</option> <option value="Bursar">Bursar</option> <option value="Secretary">Secretary</option> <option value="Housemaster">Housemaster</option> <option value="Teacher">Teacher</option> <option value="Tutor">Tutor</option> <option value="Sanatorium Staff">Sanatorium Staff</option> <option value="Kitchen Staff">Kitchen Staff</option> <option value="Parent">Parent</option> <option value="Student">Student</option> </select><br /> <br /> <input type="submit" name = "button" id="button" value="Log In" onclick="javascript:return validateLoginForm();" /> </h3> </form> Once logged in (and should the correct page be loaded, the validation code I have at the top of the script looks like this: <?php session_start(); if (!isset($_SESSION["manager"])) { header("location: http://www.zuluirminger.com/SchoolAdmin/user_login.php"); exit(); } $managerID = preg_replace('#[^0-9]#i', '', $_SESSION["id"]); $manager = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["manager"]); $password = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["password"]); $role = preg_replace('#[^A-Za-z0-9]#i', '', $_SESSION["role"]); include "adminscripts/connect_to_mysql.php"; $sql = mysql_query("SELECT id FROM Users WHERE username='$manager' AND password='$password' AND role='$role' LIMIT 1"); $existCount = mysql_num_rows($sql); if ($existCount == 0) { header("location: http://www.zuluirminger.com/SchoolAdmin/index.php"); exit(); } ?> Just so you're aware, the database table has the following fields: id, username, password and role. Any help would be greatly appreciated! Many thanks, Zulu

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • insert a date in mysql database

    - by kawtousse
    I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

    Read the article

  • Ruby function similar to parse_str in php?

    - by jolierouge
    Hi, I need to parse a string like this: a[metadata][][name]=dont|do|this&a[name]=Hello World&a[metadata][][value]=i|really|mean it CGI::parse gives me this: {"a[name]"=["Hello World"], "a[metadata][][name]"=["dont|do|this"], "a[metadata][][value]"=["i|really|mean it"]} I would like something like what PHP does with parse_str, which when given the same string does this: Array ( [a] => Array ( [metadata] => Array ( [0] => Array ( [name] => dont|do|this ) [1] => Array ( [value] => i|really|mean it ) ) [name] => Hello World )) Any help would be awesome. Thanks!

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Translate parse_git_branch function to zsh from bash (for prompt)

    - by yar
    I am using this function in Bash function parse_git_branch { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^${IFS}]*)" if [[ ! ${git_status}} =~ "working directory clean" ]]; then state="*" fi # add an else if or two here if you want to get more specific if [[ ${git_status} =~ ${pattern} ]]; then branch=${BASH_REMATCH[1]} echo "(${branch}${state})" fi } but I'm determined to use zsh. While I can use this perfectly as a shell script (even without a shebang) in my .zshrc the error is a parse error on this line if [[ ! ${git_status}}... What do I need to do to get it ready for zshell? Edit: The "actual error" I'm getting is " parse error near } and it refers to the line with the strange double }}, which works on Bash. Edit: Here's the final code, just for fun: parse_git_branch() { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^[:space:]]*)" if [[ ! ${git_status} =~ "working directory clean" ]]; then state="*" fi if [[ ${git_status} =~ ${pattern} ]]; then branch=${match[1]} echo "(${branch}${state})" fi } setopt PROMPT_SUBST PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Thanks to everybody for your patience and help. Edit: The best answer has schooled us all: git status is porcelain (UI). Good scripting goes against GIT plumbing. Here's the final function: parse_git_branch() { in_wd="$(git rev-parse --is-inside-work-tree 2>/dev/null)" || return test "$in_wd" = true || return state='' git diff-index HEAD --quiet 2>/dev/null || state='*' branch="$(git symbolic-ref HEAD 2>/dev/null)" test -z "$branch" && branch='<detached-HEAD>' echo "(${branch#refs/heads/}${state})" } PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Note that only the prompt is zsh-specific. In Bash it would be your prompt plus "\$(parse_git_branch)". This might be slower (more calls to GIT, but that's an empirical question) but it won't be broken by changes in GIT (they don't change the plumbing). And that is very important for a good script moving forward. Days Later: Ugh, it turns out that diff-index HEAD is NOT the same as checking status against working directory clean. So will this mean another plumbing call? I surely don't have time/expertise to write my own porcelain....

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • In BASH how can i find my system on active internet interface, what is the upload speed?

    - by YumYumYum
    I am trying to write an TUI bandwidth trace application which on query can instantly tell me, that my download and upload speed is XXXX. I have figured out that download i can use with wget and parse it using BASH, but how do i get the upload speed? Example of download parse method: 1) Remote download : wget http://x.x.com:7007/files/software/vnc.zip Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 573K/s in 2.7s 2012-03-24 11:35:22 (573 KB/s) - `vnc.zip' saved [1594344/1594344] 2) Local download tells Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 --.-K/s in 0.1s 2012-03-24 06:43:04 (11.4 MB/s) - `vnc.zip' saved [1594344/1594344]

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

< Previous Page | 753 754 755 756 757 758 759 760 761 762 763 764  | Next Page >