Search Results

Search found 3038 results on 122 pages for 'cs'.

Page 77/122 | < Previous Page | 73 74 75 76 77 78 79 80 81 82 83 84  | Next Page >

• algorithm to combine data for linear fit?

  - by BoldlyBold

  I'm not sure if this is the best place to ask this, but you guys have been helpful with plenty of my CS homework in the past so I figure I'll give it a shot. I'm looking for an algorithm to blindly combine several dependent variables into an index that produces the best linear fit with an external variable. Basically, it would combine the dependent variables using different mathematical operators, include or not include each one, etc. until an index is developed that best correlates with my external variable. Has anyone seen/heard of something like this before? Even if you could point me in the right direction or to the right place to ask, I would appreciate it. Thanks.

  Read the article

• jQuery Loading Status for $.ajax

  - by Geetha

  Hi All, I am using the following code to get data from the database( from cs page itself i am creating the html code) and binding the html code to the div. Problem: If the database size is higher it takes some time to show the result. thet time i want to shoe a loading.gif image in that location. Once it get the data i have to hide the load image. Code: $.ajax({ type: "POST", contentType: "application/json; charset=utf-8", data: "{ searchText: '" + searchText + "', product: '" + product + "', category: '" + category + "', artist:'" + artist + "'}", url: "Search.aspx/FetchSearchResult", dataType: "json", success: function(data) { $("#searchContainer").html(data.d[0]);}}); Geetha.

  Read the article

• How do I ensure my abstract class's function can only operate on extenders of the same type as the c

  - by incrediman

  For example, let's say this is my abstract class: abstract class A{ int x; int y; void foo(A fooMe); } ...and B and C are two classes which extend A. What I want is for B to only be able to call foo() on other Bs, and for C to only be able to call foo() on other Cs. But I want this to be out of the hands of the programmer who's extending my A class - that is, I want a way to ensure this functionality within As code alone. What can I do? (If possible) I'd like to avoid any hack or generics solution that's too messy - I still want foo to be able to be called like this, for example: B b=new B(); B bb=new B(); bb.foo(b);

  Read the article

• CruiseControl.NET, Visual Studio & SubVersion

  - by Ian

  Hi All, I am setting up a Continuous Integration server. I have one issue that doesn't seem to be mentioned in the tutorials. I have a ASP.net Web Application that I need to compile and them publish. My Problem is that I seem to be able to compile the app but when I attempt to use a buildPublisher this copies every thing including .svn files & folders and ms CS files. I am using an MSBuild task to compile my source. I tried setting my MSBuild Output Directory to directory but this didn't seem to have any effect. What am I not understanding? Thanks

  Read the article

• How does the dataset determine the return type of a scalar query?

  - by Tobias Funke

  I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

  Read the article

• Should a service layer return view models for an MVC application?

  - by erg39

  Say you have an ASP.NET MVC project and are using a service layer, such as in this contact manager tutorial on the asp.net site: http://www.asp.net/mvc/tutorials/iteration-4-make-the-application-loosely-coupled-cs If you have viewmodels for your views, is the service layer the appropriate place to provide each viewmodel? For instance, in the service layer code sample there is a method public IEnumerable<Contact> ListContacts() { return _repository.ListContacts(); } If instead you wanted a IEnumerable, should it go in the service layer, or is there somewhere else that is the "correct" place? Perhaps more appropriately, if you have a separate viewmodel for each view associated with ContactController, should ContactManagerService have a separate method to return each viewmodel? If the service layer is not the proper place, where should viewmodel objects be initialized for use by the controller?

  Read the article

• Do I have partial view/code behind in Flask?

  - by hbrlovehaku

  I'm migrating from C#.NET to Python/Flask. In .NET I have MasterPage, UserControl, PartialView each has its own code behind. e.g. I can save the check login functions in Login.ascx.cs and render the Login.ascx wherever I'd like to. If logged in, it shows the welcome message, else shows the login form. But in Flask I only found {% include 'login.html' %} which include the static html file. How can I implement this design in Flask?

  Read the article

• OnClientClick event for keeping track of prints?

  - by Ram

  Hello, I am trying to keep track of prints that are made for a page. The page has Print this page link. And the code for it is like below: This is written in .cs file as there are many conditions for displaying this. And i am appending here using String Builder. sbOutput.AppendFormat("<td align=\"right\" valign=\"bottom\"><div style =\"float:right;text-align:right; valign:bottom;width:200px\"class=\"print_button notPrinted\"><a class=\"notPrinted\" href=\"#\" onclick=\"window.print();\">PRINT THIS COUPON </a><img src=\"images/print-icon-34x34.gif\" class=\"notPrinted\" align=\"absmiddle\" /></div> </td></tr></table>", couponid, Userid, locationid); Do i have to use onclientclick or something else?? Thanks so much in advance.

  Read the article

• Reason for different segments in Linux on x86

  - by anjruu

  Hey all, So, I know that Linux uses four default segments for an x86 processor (kernel code, kernel data, user code, user data), but they all have the same base and limit (0x00000000 and 0xfffff), meaning each segment maps to the same set of linear addresses. Given this, why even have user/kernel segments? I understand why there should be separate segments for code and data (just due to how the x86 processor deals with the cs and ds registers), but why not have a single code segment and a single data segment? Memory protection is done through paging, and the user and kernel segments map to the same linear addresses anyway. Thanks! anjruu

  Read the article

• Change the image height and width based on the scale?

  - by user281947

  I want to resize the image height and width after setting its scale, below is what i am doing : <Image x:Name="img" Source="sii.PNG" > <Image.RenderTransform> <ScaleTransform x:Name="scale" /> </Image.RenderTransform> </Image> below is the cs code : void Slider_ValueChanged(object sender, RoutedPropertyChangedEventArgs<double> e) { scale.ScaleX = scale.ScaleY =e.NewValue; //here i have to change the height and width of an image }

  Read the article

• How to create a web framework in C# without ASP?

  - by Mark

  I've managed to get a C# asp page running under ubuntu/apache/mono, but I don't want to write my framework in these ASP pages, I want to use straight C# and then I'll use a templating language for my views. But I don't know where to begin? C# is a compiled language, so... how would I do this? Would I compile everything and then have apache hook into the (single) executable and pass in the the request URL? Could I request specific .cs pages and then have apache tell it to compile and then "display" it only if it's been updated? Can the "view" files be compiled individually to avoid having to recompile everything every time there's a change? Is there some "base" I can work from, or am I going to have to reinvent accessing GET and POST variables (by reading header info) and all sorts of other stuff we take for granted in languages like PHP?

  Read the article

• Passing derived objects in a constructure

  - by Clarence Klopfstein

  This is a bit of a convoluted question, hopefully I can make it clear. I am finding that this may not be possible, but am trying to see if anybody has a solution. I have four classes, two are core classes and two are those core classes extended: extUser Extends coreUser extSecurity Extends coreSecurity In the constructor for coreUser you have this: public coreUser(string id, ref coreSecurity cs) When trying to extend coreUser you would have this: public extUser(string id ref extSecurity es) : base(id, ref es) This fails because es is of type, extSecurity and the base class expects a type of coreSecurity. I've not found anyway to cast this to allow for me to override this base class in C#. In VB it works just fine. Ideas?

  Read the article

• Firing events in script task

  - by Anonymouslemming

  I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

  Read the article

• How to port C# code which uses a callback to VB.NET?

  - by Bob

  I need to port the following from the ASP.NET MVC 2 sourcecode from C# to VB.NET. It's from AuthorizeAttribute.cs beginning on line 86: HttpCachePolicyBase cachePolicy = filterContext.HttpContext.Response.Cache; cachePolicy.SetProxyMaxAge(new TimeSpan(0)); cachePolicy.AddValidationCallback(CacheValidateHandler, null /* data */); where CacheValidateHandler is: private void CacheValidateHandler(HttpContext context, object data, ref HttpValidationStatus validationStatus) { validationStatus = OnCacheAuthorization(new HttpContextWrapper(context)); } The VB.NET port from http://converter.telerik.com doesn't quite work for this line: cachePolicy.AddValidationCallback(CacheValidateHandler, Nothing) ' Error where CacheValidateHandler is: Private Sub CacheValidateHandler(ByVal context As HttpContext, ByVal data As Object, _ ByRef validationStatus As HttpValidationStatus) validationStatus = OnCacheAuthorization(New HttpContextWrapper(context)) End Sub VS2008 complains that CacheValidateHandler does not specify its arguments for context, data, and validationStatus. Any ideas how to port this code?

  Read the article

• from JS to iphone dev - what's the best language to start with?

  - by Enkai

  I am a total beginner and would like to eventually learn to develop for the iphone. I have just done a beginner's CS course where the language we learned was JavaScript. We studied basic concepts like: variables, arrays, loops (for,while,if,if..else..), properties and functions. I'm wondering if I am starting in the right/wrong place by following this book: Learn C on the Mac by Dave Mark? I have read a few chapters and am finding it a bit hard to get my head around the way that C works, for example the way that Strings are printed seems overly complicated as compared to JS. Do you think that JS was the wrong language to start off with and would I be better to go from JS straight to Objective-C rather than to C? I have tried to read up on previous threads on the merits/demerits of learning C first but haven't found any that relate JS to learning C/Obj C/ Cocoa. Any advice appreciated as I am very new to this. Thanks

  Read the article

• Text property in a UserControl in C#

  - by yeyeyerman

  I have a control with a inner TextBox. I want to make a direct relationship between the Text property of the UserControl and the Text property of the TextBox. The first thing I realized is that Text was not being displayed in the Properties of the UserControl. Then I added the Browsable(true) attribute. [Browsable(true)] public override string Text { get { return m_textBox.Text; } set { m_textBox.Text = value; } } Now, the text will be shown for a while, but then is deleted. This is because the information is not written within the xxxx.Designer.cs. How can this behviour be changed?

  Read the article

• How does the dataset designer determine the return type of a scalar query?

  - by Tobias Funke

  I am attempting to add a scalar query to a dataset. The query is pretty straight forward, it's just adding up some decimal values in a few columns and returning them. I am 100% confident that only one row and one column is returned, and that it is of decimal type (SQL money type). The problem is that for some reason, the generated method (in the .designer.cs code file) is returning a value of type object, when it should be decimal. What's strange is that there's another scalar query that has the exact same SQL but is returning decimal like it should. How does the dataset designer determine the data type, and how can I tell it to return decimal?

  Read the article

• Clear the form once form submitted

  - by zurna

  Once the form submitted, response from another page is printed to #GameStorySys. But values entered to the form still stays there. Is it possible for the form values to disappear (but the form should still stay) once the form submitted? $("[name='GameStoryForm']").click(function() { $.ajax({ type: "POST", data: $("#GameStoryForm").serialize(), url: "content/commentary/index.cs.asp?Process=EditLiveCommentaryStory&CommentaryID=<%=Request.QueryString("CommentaryID")%>", success: function(output) { $('#GameStorySys').html(output); }, error: function(output) { $('#GameStorySys').html(output); } }); });

  Read the article

• Creating a relative path to a Database in Asp.net for a library

  - by Greener

  In school I am part of a team of four working to create a GUI to translate the paper records of a made-up company and their functionality to a digital format. We're using an ASP.NET website for this purpose. Basically we use stored procedures and C# classes to represent the database. The folder we're using for the project contains the site and the libraries in separate folders. If I try to open the site from the folder containing both these elements the site will not run. I want to know if there is some way I can set up a relative path to the database in the Settings.Settings.cs file (or by some other means) of my libraries so I don't have to constantly change the database location for the connection string value every time we move the project. I suppose I should also mention that the database is in an App_Data folder.

  Read the article

• How is the implicit segment register of a near pointer determined?

  - by Daniel Trebbien

  In section 4.3 of Intel 64® and IA-32 Architectures Software Developer's Manual. Volume 1: Basic Architecture, it says: A near pointer is a 32-bit offset ... within a segment. Near pointers are used for all memory references in a flat memory model or for references in a segmented model where the identity of the segment being accessed is implied. This leads me to wondering: how is the implied segment register determined? I know that (%eip) and displaced (%eip) (e.g. -4(%eip)) addresses use %cs by default, and that (%esp) and displaced (%esp) addresses use %ss, but what about (%eax), (%edx), (%edi), (%ebp) etc., and can the implicit segment register depend also on the instruction that the memory address operand appears in?

  Read the article

• Is there any Application Server Frameworks for other languages/platforms than JavaEE and .NET?

  - by Jonas

  I'm a CS student and has rare experience from the enterprise software industry. When I'm reading about enterprise software platforms, I mostly read about these two: Java Enterprise Edition, JavaEE .NET and Windows Communication Foundation By "enterprise software platforms" I mean frameworks and application servers with support for the same characteristics as J2EE and WCF has: [JavaEE] provide functionality to deploy fault-tolerant, distributed, multi-tier Java software, based largely on modular components running on an application server. WCF is designed in accordance with service oriented architecture principles to support distributed computing where services are consumed by consumers. Clients can consume multiple services and services can be consumed by multiple clients. Services are loosely coupled to each other. Is there any alternatives to these two "enterprise software platforms"? Isn't any other programming languages used in a bigger rate for this problem area? I.e Why isn't there any popular application servers for C++/Qt?

  Read the article

• Visual Studio swapping code between projects?!?!?!?!??!

  - by Tom

  Are there any known issues with visual studio and code being swapped between projects? I had a project running in VS2008 and when i went back to it, the code from another project had been swapped in the Program.cs class. I havent made any mistakes, im not talking about some code- i mean the whole project had been swapped out. Its as if the .proj files or .soln files had been swapped from their project folders??? EDIT Ive restarted laptop, opened the code again and its still showing the wrong code BUT when i execute it, its the right code?!?!?!

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• C++ Questions about vectors

  - by xbonez

  Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

  Read the article

• Example applications and benefits of using "C" , "C++" or "Java"

  - by Waltzy

  Ok, I'm revising for my upcoming year 2 exams on a CS course and its likely something like this will come up. my question is what is an ideal application that would especially benefit from the program features of each of the three languages? I have a vague idea but getting a second opinion could really help. JavaPortability, easy - good for GUIs. C++Fast but may requite significant changes in order to be moved from system to system, good for image processing. CI'm unsure here small embedded applications? Some clarification on this would be really appreciated, thanks again StackOverflow

  Read the article

< Previous Page | 73 74 75 76 77 78 79 80 81 82 83 84  | Next Page >