Search Results

Search found 19840 results on 794 pages for 'shortcut key'.

Page 79/794 | < Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >

  • sql foreign keys

    - by Paul Est
    I was create tables with the syntax in phpmyadmin: DROP TABLE IF EXISTS users; DROP TABLE IF EXISTS info; CREATE TABLE users ( user_id int unsigned NOT NULL auto_increment, email varchar(100) NOT NULL default '', pwd varchar(32) NOT NULL default '', isAdmin int(1) unsigned NOT NULL, PRIMARY KEY (user_id) ) TYPE=INNODB; CREATE TABLE info ( info_id int unsigned NOT NULL auto_increment, first_name varchar(100) NOT NULL default '', last_name varchar(100) NOT NULL default '', address varchar(300) NOT NULL default '', zipcode varchar(100) NOT NULL default '', personal_phone varchar(100) NOT NULL default '', mobilephone varchar(100) NOT NULL default '', faxe varchar(100) NOT NULL default '', email2 varchar(100) NOT NULL default '', country varchar(100) NOT NULL default '', sex varchar(1) NOT NULL default '', birth varchar(1) NOT NULL default '', email varchar(100) NOT NULL default '', PRIMARY KEY (info_id), FOREIGN KEY (email) REFERENCES users(email) ON UPDATE CASCADE ON DELETE CASCADE ) TYPE=INNODB; But shows the error "#1064 - You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'TYPE=INNODB' at line 11 " If i remove the TYPE=INNODB in the end of create the tables, it will show the error "#1005 - Can't create table 'curriculo.info' (errno: 150) ".

    Read the article

  • Key strokes in wpf window hosted in MFC ActiveX running in Internet Explorer

    - by user310046
    We have an MFC ActiveX control created in Visual Studio 2008 with CLR support which creates a WPF grid and shows a WPF window within that grid. This ActiveX is hosted within Internet Explorer and it shows up and works nicely except that the tab key, backspace, function keys etc. does not work since they are handeled by IE instead of the WPF window. Regular characters works nicely. This is a known feature and previously when we used to have MFC based dialogs within this ActiveX we used this: http://support.microsoft.com/kb/187988. By just using this code directly the AfxGetApp()->PreTranslateMessage((LPMSG)lParam) statement will return FALSE, so I'm not able to get the key stroke to be handled by the WPF window. I beleive I need to ask the WPF application this instead of the CWinApp, but I'm not sure how and if this can be done. Does anyone have enough understanding of what's going on here to get this to work? Using XBAP instead of ActiveX is not an option as this is run in an intranet application which needs more access than the sandbox can give us. I hope this is enough information. With best regards Svein Dybvik

    Read the article

  • How To Generate Parameter Set for the Diffie-Hellman Key Agreement Algorithm in Android

    - by sebby_zml
    Hello everyone, I am working on mobile/server security related project. I am now stuck in generating a Diffie-Hellman key agreement part. It works fine in server side program but it is not working in mobile side. Thus, I assume that it is not compactible with Android. I used the following class to get the parameters. It returns a comma-separated string of 3 values. The first number is the prime modulus P. The second number is the base generator G. The third number is bit size of the random exponent L. My question is is there anything wrong with the code or it is not compactible for android?What kind of changes should I do? Your suggestion and guidance would be very much help for me. Thanks a lot in advance. public static String genDhParams() { try { // Create the parameter generator for a 1024-bit DH key pair AlgorithmParameterGenerator paramGen = AlgorithmParameterGenerator.getInstance("DH"); paramGen.init(1024); // Generate the parameters AlgorithmParameters params = paramGen.generateParameters(); DHParameterSpec dhSpec = (DHParameterSpec)params.getParameterSpec(DHParameterSpec.class); // Return the three values in a string return ""+dhSpec.getP()+","+dhSpec.getG()+","+dhSpec.getL(); } catch (NoSuchAlgorithmException e) { } catch (InvalidParameterSpecException e) { } return null; } Regards, Sebby

    Read the article

  • jqGrid : "All in One" approach width jqGridEdit Class > how to set a composite primary key ?

    - by Qualliarys
    Hello, How to set a composite primary key for a "All in One" approach (grid defined in JS file, and data using jqGridEdit Class in php file) ? Please, for me a composite primary key of a table T, is a elementary primary key that is defined with some fields belong to this table T ! Here is my test, but i get no data and cannot use the CRUD operations : In my JS file i have this lines code: ... colModel":[ {"name":"index","index":"index","label":"index"}, // <= THAT'S JUST THE INDEX OF MY TABLE {"name":"user","index":"user","label":"user","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"pwd","index":"pwd","label":"pwd","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY {"name":"state","index":"state","label":"state","key":true}, // <= A PART OF MY COMPOSITE PRIMARY KEY ... <= AND SO ON "url":"mygrid_crud.php", "datatype":"json", "jsonReader":{repeatitems:false}, "editurl": "mygrid_crud.php", "prmNames":{"id":"index"} // <= WHAT I NEED TO WRITE HERE ??? ... In my php file (mygrid_crud.php) : ... $grid = new jqGridEdit($conn); $query = "SELECT * FROM mytable WHERE user='$user' and pwd='$pwd' and state='$state'..."; // <= SELECT * it's ok or i need to specify all fields i need ? $grid->SelectCommand = $query; $grid->dataType = "json"; $grid->table = 'mytable'; $grid->setPrimaryKeyId('index'); // <= WHAT I NEED TO WRITE HERE ??? ... $grid->editGrid(); Please, say me what is wrong, and how to do to set a composite primary key in this approach !? Thank you so much for tour responses.

    Read the article

  • entity framework - getting null exception using foreign key

    - by Nick
    Having some trouble with what should be a very simple scenario. For example purposes, I have two tables: -Users -Comments There is a one-to-many relationship set up for this; there is a foreign key from Comments.CommentorID to Users.UserID. When I do the LINQ query and try to bind to a DataList, I get a null exception. Here is the code: FKMModel.FKMEntities ctx = new FKMModel.FKMEntities(); IQueryable<Comment> CommentQuery = from x in ctx.Comment where x.SiteID == 101 select x; List<Comment> Comments = CommentQuery.ToList(); dl_MajorComments.DataSource = Comments; dl_MajorComments.DataBind(); In the ASPX page, I have the following as an ItemTemplate (I simplified it and took out the styling, etc, for purposes of posting here since it's irrelevant): <div> <%# ((FKMModel.Comment)Container.DataItem).FKMUser.Username %> <%# ((FKMModel.Comment)Container.DataItem).CommentDate.Value.ToShortDateString() %> <%# ((FKMModel.Comment)Container.DataItem).CommentTime %> </div> The exception occurs on the first binding (FKMUser.Username). Since the foreign key is set up, I should have no problem accessing any properties from the Users table. Intellisense set up the FKMUser navigation property and it knows the properties of that foreign table. What is going on here??? Thanks, Nick

    Read the article

  • Chord Chart - Skip to key with a click

    - by Juan Gonzales
    I have a chord chart app that basically can transpose a chord chart up and down throughout the keys, but now I would like to expand that app and allow someone to pick a key and automatically go to that key upon a click event using a function in javascript or jquery. Can someone help me figure this out? The logic seems simple enough, but I'm just not sure how to implement it. Here are my current functions that allow the user to transpose up and down... var match; var chords = ['C','C#','D','D#','E','F','F#','G','G#','A','A#','B','C','Db','D','Eb','E','F','Gb','G','Ab','A','Bb','B','C']; var chords2 = ['C','Db','D','Eb','E','F','Gb','G','Ab','A','Bb','B','C','C#','D','D#','E','F','F#','G','G#','A','A#','C']; var chordRegex = /(?:C#|D#|F#|G#|A#|Db|Eb|Gb|Ab|Bb|C|D|E|F|G|A|B)/g; function transposeUp(x) { $('.chord'+x).each(function(){ ///// initializes variables ///// var currentChord = $(this).text(); // gatheres each object var output = ""; var parts = currentChord.split(chordRegex); var index = 0; ///////////////////////////////// while (match = chordRegex.exec(currentChord)){ var chordIndex = chords2.indexOf(match[0]); output += parts[index++] + chords[chordIndex+1]; } output += parts[index]; $(this).text(output); }); } function transposeDown(x){ $('.chord'+x).each(function(){ var currentChord = $(this).text(); // gatheres each object var output = ""; var parts = currentChord.split(chordRegex); var index = 0; while (match = chordRegex.exec(currentChord)){ var chordIndex = chords2.indexOf(match[0],1); //var chordIndex = $.inArray(match[0], chords, -1); output += parts[index++] + chords2[chordIndex-1]; } output += parts[index]; $(this).text(output); }); } Any help is appreciated. Answer will be accepted! Thank You

    Read the article

  • Custom types as key for a map - C++

    - by Appu
    I am trying to assign a custom type as a key for std::map. Here is the type which I am using as key. struct Foo { Foo(std::string s) : foo_value(s){} bool operator<(const Foo& foo1) { return foo_value < foo1.foo_value; } bool operator>(const Foo& foo1) { return foo_value > foo1.foo_value; } std::string foo_value; }; When used with std::map, I am getting the following error. error C2678: binary '<' : no operator found which takes a left-hand operand of type 'const Foo' (or there is no acceptable conversion) c:\program files\microsoft visual studio 8\vc\include\functional 143 If I change the struct like the below, everything worked. struct Foo { Foo(std::string s) : foo_value(s) {} friend bool operator<(const Foo& foo,const Foo& foo1) { return foo.foo_value < foo1.foo_value; } friend bool operator>(const Foo& foo,const Foo& foo1) { return foo.foo_value > foo1.foo_value; } std::string foo_value; }; Nothing changed except making the operator overloads as friend. I am wondering why my first code is not working? Any thoughts?

    Read the article

  • TextArea being used as an itemEditor misbehaves when the enter key is pressed

    - by ChrisInCambo
    Hi, I have a TextArea inside an itemEditor component, the problem is that when typing in the TextArea if the enter key is pressed the itemEditor resets itself rather moving the caret to the next line as expected: <mx:List width="100%" editable="true" > <mx:dataProvider> <mx:ArrayCollection> <mx:Array> <mx:Object title="Stairway to Heaven" /> </mx:Array> </mx:ArrayCollection> </mx:dataProvider> <mx:itemRenderer> <mx:Component> <mx:Text height="100" text="{data.title}"/> </mx:Component> </mx:itemRenderer> <mx:itemEditor> <mx:Component> <mx:TextArea height="100" text="{data.title}"/> </mx:Component> </mx:itemEditor> </mx:List> </mx:Application> Could anyone advise how I can get around this strange behaviour and make the enter key behave as expected? Thanks, Chris

    Read the article

  • I am not able to drop foreign key in mysql Error 150. Please help

    - by Shantanu Gupta
    i am trying to create a foreign key in my table. But when i executes my query it shows me error 150 Error Code : 1005 Can't create table '.\vts#sql-6ec_1.frm' (errno: 150) (0 ms taken) My Queries are Query to create a foreign Key alter table `vts`.`tblguardian` add constraint `FK_tblguardian` FOREIGN KEY (`GuardianPickPointId`) REFERENCES `tblpickpoint` (`PickPointId`) EDIT: Now I am trying to drop this constraint But it fails again and shows me same error as it was giving when i was trying to create foreign key. alter table `vts`.`tblguardian` drop index `FK_tblguardian` Primary Key table CREATE TABLE `tblpickpoint` ( `PickPointId` int(4) NOT NULL auto_increment, `PickPointName` varchar(500) default NULL, `PickPointLabel` varchar(500) default NULL, `PickPointLatLong` varchar(100) NOT NULL, PRIMARY KEY (`PickPointId`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1 CHECKSUM=1 DELAY_KEY_WRITE=1 ROW_FORMAT=DYNAMIC Foreign Key Table CREATE TABLE `tblguardian` ( `GuardianId` int(4) NOT NULL auto_increment, `GuardianName` varchar(500) default NULL, `GuardianAddress` varchar(500) default NULL, `GuardianMobilePrimary` varchar(15) NOT NULL, `GuardianMobileSecondary` varchar(15) default NULL, `GuardianPickPointId` int(4) default NULL, PRIMARY KEY (`GuardianId`) ) ENGINE=InnoDB DEFAULT CHARSET=latin1

    Read the article

  • PowerShell script to restart a service

    - by Guy Thomas
    My mission is to press a keyboard sequence, such as Ctrl +Shift +R, to restart a Windows Service. I have a script which works fine in the PowerShell ISE, when launched with administrative privileges. When I try with a PowerShell script it fails due to insufficient Administrative Privileges. It’s galling that I can get it to work with an old-fashioned bat file, but not PowerShell. The root of the problem is that shortcuts to a PowerShell script have their Administrative privileges box greyed out. So far no work-around has overcome this privilege problem. Any ideas?

    Read the article

  • capture delete key in CListCtrl and do soem processing

    - by user333422
    Hi, I have a class which inherits from CListCtrl class, say class list. I have another class dlg, which inherits from CDialog. Class dlg contains an instance of class list. I have got a delete button in class dlg, on which I delete the selected item in listCtrl and do lots of other processing. I want the same functionality on delete key. I added OnKeyDown() fn is my class list, where I can capture VK_DELETE key. But my problem is that, how do I do otehr processing that I need to do in dialog class. All that processing is dlg class based not list class based. I have many such dlg classes with different data and in every dlg class processing is different. I tried capturing VK_DELETE in dialog class, but it doesn't capture it if focus is on list class. I am totally stuck and have no idea, how to do this. Please give me some idea how i can do this. Thanks, SG

    Read the article

  • Horrible VMware keyboard shortcuts

    - by rshimoda
    Hello, I'm a VMware user and far too often I use keyboard shortcuts while programming. However, this has proved to be quite distressing as sometimes the VMware gets hold of it and turns off / pauses (ctrl+Z) the virtual machine. Is there a way to disable keyboard shortcuts on VMware? Has anyone here ever found a workaround?

    Read the article

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • How to test if a doctrine records has any relations that are used

    - by murze
    Hi, I'm using a doctrine table that has several optional relations (of types Doctrine_Relation_Association and Doctrine_Relation_ForeignKey) with other tables. How can I test if a record from that table has connections with records from the related table. Here is an example to make my question more clear. Assume that you have a User and a user has a many to many relation with Usergroups and a User can have one Userrole How can I test if a give user is part of any Usergroups or has a role. The solution starts I believe with $relations = Doctrine_Core::getTable('User')->getRelations(); $user = Doctrine_Core::getTable('User')->findOne(1); foreach($relations as $relation) { //here should go a test if the user has a related record for this relation if ($relation instanceof Doctrine_Relation_Association) { //here the related table probably has more then one foreign key (ex. user_id and group_id) } if ($relation instanceof Doctrine_Relation_ForeignKey) { //here the related table probably has the primary key of this table (id) as a foreign key (user_id) } } //true or false echo $result I'm looking for a general solution that will work no matter how many relations there are between user and other tables. Thanks!

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • "Special case" records for foreign key constraints

    - by keithjgrant
    Let's say I have a mysql table, called foo with a foreign key option_id constrained to the option table. When I create a foo record, the user may or may not have selected an option, and 'no option' is a viable selection. What is the best way to differentiate between 'null' (i.e. the user hasn't made a selection yet) and 'no option' (i.e. the user selected 'no option')? Right now, my plan is to insert a special record into the option table. Let's say that winds up with an id of 227 (this table already has a number of records at this point, so '1' isn't available). I have no need to access this record at a database level, and it would act as nothing more than a placeholder that the foreign key in the foo table can reference. So do I just hard-code '227' in my codebase when I'm creating 'foo' records where the user has selected 'no option'? The hard-coded id seems sloppy, and leaves room for error as the code is maintained down the road, but I'm not really sure of another approach.

    Read the article

  • Going "behind Hibernate's back" to update foreign key values without an associated entity

    - by Alex Cruise
    Updated: I wound up "solving" the problem by doing the opposite! I now have the entity reference field set as read-only (insertable=false updatable=false), and the foreign key field read-write. This means I need to take special care when saving new entities, but on querying, the entity properties get resolved for me. I have a bidirectional one-to-many association in my domain model, where I'm using JPA annotations and Hibernate as the persistence provider. It's pretty much your bog-standard parent/child configuration, with one difference being that I want to expose the parent's foreign key as a separate property of the child alongside the reference to a parent instance, like so: @Entity public class Child { @Id @GeneratedValue Long id; @Column(name="parent_id", insertable=false, updatable=false) private Long parentId; @ManyToOne(cascade=CascadeType.ALL) @JoinColumn(name="parent_id") private Parent parent; private long timestamp; } @Entity public class Parent { @Id @GeneratedValue Long id; @OrderBy("timestamp") @OneToMany(mappedBy="parent", cascade=CascadeType.ALL, fetch=FetchType.LAZY) private List<Child> children; } This works just fine most of the time, but there are many (legacy) cases when I'd like to put an invalid value in the parent_id column without having to create a bogus Parent first. Unfortunately, Hibernate won't save values assigned to the parentId field due to insertable=false, updatable=false, which it requires when the same column is mapped to multiple properties. Is there any nice way to "go behind Hibernate's back" and sneak values into that field without having to drop down to JDBC or implement an interceptor? Thanks!

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • Assigning hotkeys to custom buttons in Sage CRM

    - by CodeGeek
    Hi All, I'm trying to assign a hotkey to a custom buttom in Sage CRM. I'm able to do so for one keypress. However, it doesn't seem to work if I try to use a combination of keys, for example, 'Alt+C' Please refer my code below: document.onkeypress = onKeyPress; var flag = false; function onKeyPress() { if(window.event.keyCode == 18) { flag = true; } if(window.event.keyCode == 67 && flag) { alert("Successful!!!"); } }

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 75 76 77 78 79 80 81 82 83 84 85 86  | Next Page >