object to string - Page 8

Javascript Object Database

- by Narven

Hi, is there any javascript object database?? Something like http://www.db4o.com/ but for javascript? thanks

string.EndsWith()

- by neven

Hi, I need to check in string.Endswith("") from any of the following operators : "+,-,*,/" I don't want to use "||" operator. Regards, Neven.

How can I filter a string in c? I want to remove anything that isn't [a-z0-9_]. int main(int argc, char ** argv) { char* name = argv[1]; // remove anything that isn't [a-z0-9_] printf("%s", name); }

Read the article

increasing string size through loop

- by calccrypto

what's a simple way to increase the length of a string given an arbitrary integer x? like 'a' goes to 'z' and then goes to 'aa' to 'zz' to 'aaa', etc.

Read the article

String Parsing in C#

- by Betamoo

What is the most efficient way to parse a C# string in the form of "(params (abc 1.3)(sdc 2.0)....)" into a struct in the form struct Params { double abc,sdc....; } Thanks EDIT The structure always have the same parameters (number and names).. but the order is not granted..

Read the article

python - remove string from words in an array

- by tekknolagi

#!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

Read the article

Split a long JSON string into lines in Ruby

- by David J.

Read the article

String.IsNullOrWhiteSpace

- by Scott Dorman

An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); } return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty(" ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; } Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

Read the article

Confused about implementing Single Responsibility Principle

- by HichemSeeSharp

Please bear with me if the question looks not well structured. To put you in the context of my issue: I am building an application that invoices vehicles stay duration in a parking. In addition to the stay service there are some other services. Each service has its own calculation logic. Here is an illustration (please correct me if the design is wrong): public abstract class Service { public int Id { get; set; } public bool IsActivated { get; set; } public string Name { get; set } public decimal Price { get; set; } } public class VehicleService : Service { //MTM : many to many public virtual ICollection<MTMVehicleService> Vehicles { get; set; } } public class StayService : VehicleService { } public class Vehicle { public int Id { get; set; } public string ChassisNumber { get; set; } public DateTime? EntryDate { get; set; } public DateTime? DeliveryDate { get; set; } //... public virtual ICollection<MTMVehicleService> Services{ get; set; } } Now, I am focusing on the stay service as an example: I would like to know at invoicing time which class(es) would be responsible for generating the invoice item for the service and for each vehicle? This should calculate the duration cost knowing that the duration could be invoiced partially so the like is as follows: not yet invoiced stay days * stay price per day. At this moment I have InvoiceItemsGenerator do everything but I am aware that there is a better design.

Read the article

How do I concatenate 2 strings in NSIS

- by Apoc

How do I concatenate 2 strings in NSIS?

Read the article

how to create a string literal as a function argument via string concatenation in c

- by Reed Debaets

I need to pass a string literal to a function myfunction("arg1" CONSTANT "arg1"); now part of that constructed string literal needs to be a function return stmp = createString(); myfunction("arg1" stmp "arg2"); is there any way to do this in one line? myfunction("arg1" createString() "arg2"); //doesn't work ... why not? what instead? NOTE: C only please.

Read the article

String replacement problem.

- by fastcodejava

I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

Read the article

Transforming a string to a valid PDO_MYSQL DSN

- by Alix Axel

What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

Read the article

PHP String tokenizer not working correctly

- by asdadas

I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

Read the article

How to build Object Oriented Skills?

- by cedar715

Being a core developer for couple of years, coding applications seeing the class diagrams, sequence diagrams, I decided to improve my self, taking the next step of designing. As I'm an OO developer, I'm interested in improving my design skills. For Example, I had a hard time designing a currency converter. My questions to the SO: Is it by experience the design skills can be acquired? Will learning books/blog/material over internet etc help? Is it that one needs the domain knowledge of the application being developed? Knowing Design patterns, principles? Studying 'Code Complete' book ? Need to have Problem-solving skills? In short, given a problem, I just want to solve it in Object-oriented way??

Read the article

Object desing problem for simple school application

- by Aragornx

I want to create simple school application that provides grades,notes,presence,etc. for students,teachers and parents. I'm trying to design objects for this problem and I'm little bit confused - because I'm not very experienced in class designing. Some of my present objects are : class PersonalData() { private String name; private String surename; private Calendar dateOfBirth; [...] } class Person { private PersonalData personalData; } class User extends Person { private String login; private char[] password; } class Student extends Person { private ArrayList<Counselor> counselors = new ArrayList<>(); } class Counselor extends Person { private ArrayList<Student> children = new ArrayList<>(); } class Teacher extends Person { private ArrayList<ChoolClass> schoolClasses = new ArrayList<>(); private ArrayList<Subject> subjects = new ArrayList<>(); } This is of course a general idea. But I'm sure it's not the best way. For example I want that one person could be a Teacher and also a Parent(Counselor) and present approach makes me to have two Person objects. I want that user after successful logging in get all roles that it has (Student or Teacher or (Teacher & Parent) ). I think I should make and use some interfaces but I'm not sure how to do this right. Maybe like this: interface Role { } interface TeacherRole implements Role { void addGrade( Student student, Grade grade, [...] ); } class Teacher implements TeacherRole { private Person person; [...] } class User extends Person{ ArrayList<Role> roles = new ArrayList<>(); } Please if anyone could help me to make this right or maybe just point me to some literature/article that covers practical objects design.

Read the article

Finding multiple values in a string Jquery / Javascript

- by user257503

I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

Read the article

Does this copy the reference or the object?

- by Water Cooler v2

Sorry, I am being both thick and lazy, but mostly lazy. Actually, not even that. I am trying to save time so I can do more in less time as there's a lot to be done. Does this copy the reference or the actual object data? public class Foo { private NameValueCollection _nvc = null; public Foo( NameValueCollection nvc) { _nvc = nvc; } } public class Bar { public static void Main() { NameValueCollection toPass = new NameValueCollection(); new Foo( toPass ); // I believe this only copies the reference // so if I ever wanted to compare toPass and // Foo._nvc (assuming I got hold of the private // field using reflection), I would only have to // compare the references and wouldn't have to compare // each string (deep copy compare), right? } I think I know the answer for sure: it only copies the reference. But I am not even sure why I am asking this. I guess my only concern is, if, after instantiating Foo by calling its parameterized ctor with toPass, if I needed to make sure that the NVC I passed as toPass and the NVC private field _nvc had the exact same content, I would just need to compare their references, right?

Read the article

Search for string allowing for one mismatches in any location of the string, Python

- by Vincent

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

Read the article

controlling an object through another object ?

- by Stefano Borini

Today I've seen the following pattern: you have an object A and an object B. Object B accepts a pointer to A at its constructor. Once B is created, there's a method B.doCalc() that performs a calculation (internally using A's information). The result is obtained with method B.getResult(). In order to perform another calculation, A is modified, and B.doCalc() is called again. What is your opinion on this choice ? I would have designed it differently, but I want to hear your voice. Edit : note that my main objection is to modify A to have a different result from B, without touching B. Although similar, I think that just this discipline expresses a much better feeling of what's going on. Instead of a = new A a.whatever = 5 b = new B(a) b.doCalc() res = b.getResult() a.whatever = 6 b.doCalc() res = b.getResult() You get the a pointer object from b itself. a = new A a.whatever = 5 b = new B(a) b.doCalc() res = b.getResult() a = b.getAPointer() a.whatever = 6 b.doCalc() res = b.getResult() because it makes more explicit the fact that a is taken from b and then modified. I still don't like it, though...

Read the article

Vector of Object Pointers, general help and confusion

- by Staypuft

Have a homework assignment in which I'm supposed to create a vector of pointers to objects Later on down the load, I'll be using inheritance/polymorphism to extend the class to include fees for two-day delivery, next day air, etc. However, that is not my concern right now. The final goal of the current program is to just print out every object's content in the vector (name & address) and find it's shipping cost (weight*cost). My Trouble is not with the logic, I'm just confused on few points related to objects/pointers/vectors in general. But first my code. I basically cut out everything that does not mater right now, int main, will have user input, but right now I hard-coded two examples. #include <iostream> #include <string> #include <vector> using namespace std; class Package { public: Package(); //default constructor Package(string d_name, string d_add, string d_zip, string d_city, string d_state, double c, double w); double calculateCost(double, double); void Print(); ~Package(); private: string dest_name; string dest_address; string dest_zip; string dest_city; string dest_state; double weight; double cost; }; Package::Package() { cout<<"Constucting Package Object with default values: "<<endl; string dest_name=""; string dest_address=""; string dest_zip=""; string dest_city=""; string dest_state=""; double weight=0; double cost=0; } Package::Package(string d_name, string d_add, string d_zip, string d_city, string d_state, string r_name, string r_add, string r_zip, string r_city, string r_state, double w, double c){ cout<<"Constucting Package Object with user defined values: "<<endl; string dest_name=d_name; string dest_address=d_add; string dest_zip=d_zip; string dest_city=d_city; string dest_state=d_state; double weight=w; double cost=c; } Package::~Package() { cout<<"Deconstructing Package Object!"<<endl; delete Package; } double Package::calculateCost(double x, double y){ return x+y; } int main(){ double cost=0; vector<Package*> shipment; cout<<"Enter Shipping Cost: "<<endl; cin>>cost; shipment.push_back(new Package("tom r","123 thunder road", "90210", "Red Bank", "NJ", cost, 10.5)); shipment.push_back(new Package ("Harry Potter","10 Madison Avenue", "55555", "New York", "NY", cost, 32.3)); return 0; } So my questions are: I'm told I have to use a vector of Object Pointers, not Objects. Why? My assignment calls for it specifically, but I'm also told it won't work otherwise. Where should I be creating this vector? Should it be part of my Package Class? How do I go about adding objects into it then? Do I need a copy constructor? Why? What's the proper way to deconstruct my vector of object pointers? Any help would be appreciated. I've searched for a lot of related articles on here and I realize that my program will have memory leaks. Using one of the specialized ptrs from boost:: will not be available for me to use. Right now, I'm more concerned with getting the foundation of my program built. That way I can actually get down to the functionality I need to create. Thanks.

Read the article

Uncaught TypeError: Object [object Object] has no method 'onAdded'

- by user3604227

I am using ExtJS4 with Java servlets. I am following the MVC architecture for ExtJS. I am trying a simple example of displaying a border layout but it doesnt work and I get the following error in ext-all.js in the javascript console: Uncaught TypeError: Object [object Object] has no method 'onAdded' Here is my code: app.js Ext.Loader.setConfig({ enabled : true }); Ext.application({ name : 'IN', appFolder : 'app', controllers : [ 'Items' ], launch : function() { console.log('in LAUNCH-appjs'); Ext.create('Ext.container.Viewport', { items : [ { xtype : 'borderlyt' } ] }); } }); Items.js (controller) Ext.define('IN.controller.Items', { extend : 'Ext.app.Controller', views : [ 'item.Border' ], init : function() { this.control({ 'viewport > panel' : { render : this.onPanelRendered } }); }, onPanelRendered : function() { console.log('The panel was rendered'); } }); Border.js (view) Ext.define('IN.view.item.Border',{extend : 'Ext.layout.container.Border', alias : 'widget.borderlyt', title : 'Border layout' , autoShow : true, renderTo : Ext.getBody(), defaults : { split : true, layout : 'border', autoScroll : true, height : 800, width : 500 }, items : [ { region : 'north', html : "Header here..", id : 'mainHeader' }, { region : 'west', width : 140, html : "Its West..", }, { region : 'south', html : "This is my temp footer content", height : 30, margins : '0 5 5 5', bodyPadding : 2, id : 'mainFooter' }, { id : 'mainContent', collapsible : false, region : 'center', margins : '5', border : true, } ] }); The folder structure for the Webcontent is as follows: WebContent app controller Items.js model store view item Border.js ext_js resources src ext_all.js index.html app.js Can someone help me resolve this error? Thanks in advance

Read the article

C# collection/string .Contains vs collection/string.IndexOf

- by Daniel

Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

Read the article

Making a string out of a string and an integer in Python

- by Waterfox

I get this error when trying to take an integer and prepend "b" to it, converting it into a string: File "program.py", line 19, in getname name = "b" + num TypeError: Can't convert 'int' object to str implicitly That's related to this function: num = random.randint(1,25) name = "b" + num

Read the article

Findind string in another string in PHP

- by Mamadou

Hi everybody I got a string like this : $str1 = "mod 1 + mode 2 + comp 1 + toto" I would like to test even " mod 1" is in $str1. I used strpos but this function dosen't help Pliz can anyone give an idea to fix this problem thank u.

Search Results

Search found 57023 results on 2281 pages for 'object to string'.

Page 8/2281 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15 | Next Page >

- by Narven

- by neven

- by Paul Tarjan

- by calccrypto

- by Betamoo

- by tekknolagi

- by David J.

- by Scott Dorman

- by HichemSeeSharp

- by Apoc

- by Reed Debaets

- by fastcodejava

- by Alix Axel

- by asdadas

- by cedar715

- by Aragornx

- by user257503

- by Water Cooler v2

- by Vincent

- by Stefano Borini

- by Staypuft

- by user3604227

- by Daniel

- by Waterfox

- by Mamadou

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15 | Next Page >