Search Results

Search found 37381 results on 1496 pages for 'string parsing'.

Page 8/1496 | < Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • string parsing to double fails in C++ (Xcode problem?)

    - by helixed
    Here's a fun one I've been trying to figure out. I have the following program: #include <iostream> #include <string> #include <sstream> using namespace std; int main(int argc, char *argv[]) { string s("5"); istringstream stream(s); double theValue; stream >> theValue; cout << theValue << endl; cout << stream.fail(); } The output is: 0 1 I don't understand why this is failing. Could somebody please tell me what I'm doing wrong? Thanks, helixed EDIT: Okay, sorry to turn this into a double post, but this looks like a problem specific to Xcode. If I compile this in g++, the code works without a problem. Does anybody have an idea why this is happening in Xcode, and how I could possibly fix it? Thanks again, helixed

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • android sdk main.out.xml parsing error?

    - by mobibob
    I just started a new Android project, "WeekendStudy" to continue learning Android development and I got stumped compiling the default 'hello weekendstudy' compile / run. I think that I missed a step in configuration and setup, but I am at a loss to find out where. I have an AVD configured, set and launched. When I press 'run', the SDK is building a file main.out.xml and then fails as this: [2010-03-06 09:46:47 - WeekendStudy]Error in an XML file: aborting build. [2010-03-06 09:46:48 - WeekendStudy]res/layout/main.xml:0: error: Resource entry main is already defined. [2010-03-06 09:46:48 - WeekendStudy]res/layout/main.out.xml:0: Originally defined here. [2010-03-06 09:46:48 - WeekendStudy]/Users/mobibob/Projects/workspace-weekend/WeekendStudy/res/layout/main.out.xml:1: error: Error parsing XML: no element found [2010-03-06 09:48:16 - WeekendStudy]Error in an XML file: aborting build. [2010-03-06 09:48:16 - WeekendStudy]res/layout/main.xml:0: error: Resource entry main is already defined. [2010-03-06 09:48:16 - WeekendStudy]res/layout/main.out.xml:0: Originally defined here. [2010-03-06 09:48:16 - WeekendStudy]/Users/mobibob/Projects/workspace-weekend/WeekendStudy/res/layout/main.out.xml:1: error: Error parsing XML: no element found [2010-03-06 09:55:29 - WeekendStudy]res/layout/main.xml:0: error: Resource entry main is already defined. [2010-03-06 09:55:29 - WeekendStudy]res/layout/main.out.xml:0: Originally defined here. [2010-03-06 09:55:29 - WeekendStudy]/Users/mobibob/Projects/workspace-weekend/WeekendStudy/res/layout/main.out.xml:1: error: Error parsing XML: no element found [2010-03-06 09:55:49 - WeekendStudy]Error in an XML file: aborting build. [2010-03-06 09:55:49 - WeekendStudy]res/layout/main.xml:0: error: Resource entry main is already defined. [2010-03-06 09:55:49 - WeekendStudy]res/layout/main.out.xml:0: Originally defined here. [2010-03-06 09:55:49 - WeekendStudy]/Users/mobibob/Projects/workspace-weekend/WeekendStudy/res/layout/main.out.xml:1: error: Error parsing XML: no element found

    Read the article

  • Parsing large delimited files with dynamic number of columns

    - by annelie
    Hi, What would be the best approach to parse a delimited file when the columns are unknown before parsing the file? The file format is Rightmove v3 (.blm), the structure looks like this: #HEADER# Version : 3 EOF : '^' EOR : '~' #DEFINITION# AGENT_REF^ADDRESS_1^POSTCODE1^MEDIA_IMAGE_00~ // can be any number of columns #DATA# agent1^the address^the postcode^an image~ agent2^the address^the postcode^^~ // the records have to have the same number of columns as specified in the definition, however they can be empty etc #END# The files can potentially be very large, the example file I have is 40Mb but they could be several hundred megabytes. Below is the code I had started on before I realised the columns were dynamic, I'm opening a filestream as I read that was the best way to handle large files. I'm not sure my idea of putting every record in a list then processing is any good though, don't know if that will work with such large files. List<string> recordList = new List<string>(); try { using (FileStream fs = new FileStream(path, FileMode.Open, FileAccess.Read)) { StreamReader file = new StreamReader(fs); string line; while ((line = file.ReadLine()) != null) { string[] records = line.Split('~'); foreach (string item in records) { if (item != String.Empty) { recordList.Add(item); } } } } } catch (FileNotFoundException ex) { Console.WriteLine(ex.Message); } foreach (string r in recordList) { Property property = new Property(); string[] fields = r.Split('^'); // can't do this as I don't know which field is the post code property.PostCode = fields[2]; // etc propertyList.Add(property); } Any ideas of how to do this better? It's C# 3.0 and .Net 3.5 if that helps. Thanks, Annelie

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • Check if a String is a double or an int?

    - by user69514
    I have a string for a Date in the form mm/dd, and I need to check if either the month or day was entered as a double public Date(String dateStr){ int slash = 0; //check slash is present try{ slash = dateStr.indexOf('/'); }catch(StringIndexOutOfBoundsException e){ error = "Invalid date format: " + dateStr; } //check if month is a number try{ month = Integer.parseInt(dateStr.substring(0, slash)); //day = Integer.parseInt(dateStr.substring(slash + 1, dateStr.length())); } catch(NumberFormatException e){ System.out.println("Invalid format for input string: " + dateStr.substring(0, slash)); } //check if day is a number try{ day = Integer.parseInt(dateStr.substring(slash + 1, dateStr.length())); } catch(NumberFormatException e){ System.out.println("Invalid format for input string: " + dateStr.substring(slash + 1, dateStr.length())); } //check if month was entered as a double }

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • Memory Issues When DOM Parsing A Large XML File on Android Devices

    - by tonyc
    Hey awesome SO users, I have an Android application that parses an XML file for users and displays results in a much more mobile friendly format. The app works great for most users, but some users have lots and lots of data and the app crashes on them because it runs out of memory. Is there any way I have a DOM style XML parser quit parsing data after a certain amount of parsing? I only need the first 30 or so elements so it would make the application much more efficient. I'd like to use a SAX or pull parser instead, but the XML I'm parsing is not valid and I have no control over it. Unless anyone has some good SAX solutions that let me parse messy, invalid XML, I think DOM is the only way to go. Thanks for reading!

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

  • getting 502 proxy error while parsing

    - by developer
    Iam parsing a page and im getting response from that but after some time i.e. after some of the parsing gets done i get this error from the server - Proxy Error The proxy server received an invalid response from an upstream server. The proxy server could not handle the request GET /file.php. Reason: Error reading from remote server and after this my parsing fails. I even tried sleep() function but it didnt helped and the error still came. Are they temporarily blocking my ip or what?? What could be the reason for this and how can i parse those pages without getting this error and all ???

    Read the article

  • Replacing substring in a string

    - by user177785
    I am uploading a image file to the server. Now after uploading the file to the server I need to rename the file with an id, but the extension of the file should be retained. Eg: if I upload the file image1.png then my server script should retain the extension .png. But I need to change the substring to some other substring (primary key of db). image1.png should be renamed to 123.png image2.jpg should be renamed to somevalue.jpg The image can be of any extension like .png, .jpg, .jpeg etc. I want to rename then in such a way that the image/file extension should be retained.

    Read the article

  • String to array or Array to string tips on formats, etc

    - by user316841
    hi, first of all thanks for taking your time! I'm a junior Dev, working with PHP + mysql. My issue: I'm saving data from a form to my database. From this form, there's only need to save the contacts: Name, phone number, address. But, it would be nice to have a small reference to the user answers. Let's say for each question we've got a value betwee 1 and 4. Since there's no need to create a table just for it, because what's needed is just the personal contacts. I'm thinking of recording each question/answer, as a letter and its correspondent value. Example (A2, B1, C5, D3, etc). My question is: Is there a format I could afterwards, handle easily ? Convert to array (string to array) in case the client change ideas, and ask this data, placed in table columns ? Just to prevent this situation! Example, From (A2, B1, C5 ) to array( "A" = "1", "B" = "1", "C" = "5" ) For now I guess, Regex is the answer, but it's allways hard to figure it out and I'm allways getting in troubles =) Thanks!

    Read the article

< Previous Page | 4 5 6 7 8 9 10 11 12 13 14 15  | Next Page >