Search Results

Search found 4451 results on 179 pages for 'split brain'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 80/179 | < Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >

  • Extracting contents of ConnectionStrings in web.config in Silverlight Business application.

    - by webKite
    I am trying to read dataSource ad Catalog from connectionString in web.config in Silverlight business project. Unfortunately when I used "SqlConnectionStringBuilder", I could not read connectionstring the has "connectionString="metadata=res:///MainDatabase.Main.csdl|res:///MainDatabase.Main.ssdl|......."" where as it work for "connectionString="Data Source=My-PC\SQL_2008;Initial Catalog =...."". I could get them using "Split" however, I don't like that solution. Is there any way to get my requirements? Thanks

    Read the article

  • MySQL create view from concat value

    - by cnotethegr8
    Lets say I have a table as follows, +----+-------------+ | id | value | +----+-------------+ | 1 | aa,bb,cc,dd | | 2 | ee,ff,gg,hh | +----+-------------+ I want to be able to search this table to see if id = 1 AND value = 'cc'. Im assuming a good way of doing this is to grab the id = 1 row and split its values into separate rows in a new view. Something like, +-----+ | val | +-----+ | aa | | bb | | cc | | dd | +-----+ I would like to do all of this in MySQL. How can i do this, and is there possibly a better way to do it?

    Read the article

  • What is a good way of Enhancing contrast of color images?

    - by erjik
    I split color image for 3 channels and made a contrast enhancement of each channel. Then merged them together, I like the image at the result, but it has different colors. Black objects became yellow and so on... EDIT: The algorithm I used is to calculate the 5th percentile and the 95th percentile as min and max values, and then expand the values of image so that it will have min and max values as 0 and 255. If there is a better approach please tell me.

    Read the article

  • Proper two-level iPad UITableView

    - by Knodel
    I have an iPad app with split view. In the root view I need to make a two-level UITableView, so the UIWebView in the DetailView shows corresponding content. What I need is to make a two-level UITableView without editing, moving etc, so it can send the name of the selected row in the second level of the table to the DetailViewController. What is the best way to do it? Thanks in advance!

    Read the article

  • How do I solve "405 Method Not Allowed" for our subversion setup?

    - by macke
    We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

    Read the article

  • Javascript wont change value in TextBox

    - by mattgcon
    Here is my javascript function AppendValues(e) { var lghtcnt = 0; var vars = e.id.split(';'); var highcnt = false; var lghtid = ""; var maxltcnt = 100; for (var x = 0; x < vars.length; x++) { var tokens = vars[x].split('|'); var pram = tokens if (tokens[0] == "ID"){ lghtid = tokens[1]; } if (tokens[0] == "LTC"){ var itemcnt = 0; var currentcnt = 0; currentcnt = parseInt(tokens[1].toString()); var txtid = document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]); if (e.checked) { totallightcnt += currentcnt; if (totallightcnt > maxltcnt) { document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; alert('This puts you over the limit of 100 total lights, please make adjustments.'); break; } document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = currentcnt.toString(); } else { totallightcnt -= currentcnt; document.getElementById(vars[0] + ';' + vars[1] + ';' + vars[2] + ';' + vars[3] + ';' + vars[4]).value = 0; break; } } if (highcnt) { break; } } } Here is the issue, when I check the value it DOES say theupdated value but it does not display to the user on the webpage. What could be the issue?

    Read the article

  • JS text to array

    - by Sonny
    Hi i got this text 2/92/20 3/32/32 4/62/6 5/22/28 6/60/61 7/33/32 8/34/31 9/31/19 10/19/19 11/34/39 12/32/32 14/19/25 15/45/37 16/32/32 17/84/36 18/72/33 and i need it to be like // 2/92/20 chars[0][0]=2; chars[0][1]=92; chars[0][2]=20; How should i make that PS: the split must be in $.ajax({ type: "POST", url: "char_info2.php", dataType: "html", success: function(data) { //here }

    Read the article

  • how to start with a voip/public announcement project?

    - by Metiu
    The main requirements are: open source solution on Linux support P2P VoIP calls support presence support multicast VoIP announcements (and maybe some way of setting up such a "conference") preferably serverless (maybe the network can get split and I'd need to keep the functionality for all clients that still see each other) I tried looking at telepathy, in particular telepathy-salut, but it seems to be quite a new technology, so it lacks clear/good documentation and/or working examples. I'm also evaluating SIP (e.g. SofiaSIP), but it's working only if connected to a server.

    Read the article

  • How can you use jQuery to make sIFR-replaced elements fade in?

    - by Sam Goldman
    This is what I currently have: // #content is visibility=hidden sIFR.replace(mix_bold, { selector: '#content p', onReplacement: function(fi) { $('#content').fadeIn("slow"); } }); The fade in happens, but for a split second the replaced flash movie appears before being hidden. Has anyone gotten this to work? I am using jQuery 1.2.6 and sIFR 3 r436. Tested in Safari 4 and FF 3. Thanks!

    Read the article

  • python - remove string from words in an array

    - by tekknolagi
    #!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How should I parse this simple text file in Java?

    - by Winston
    I have a text file that looks like this: grn129 agri- ac-214 ahss hud114 ahss lov1150 ahss lov1160 ahss lov1170 ahss lov1210 ahss What is the best way to parse this file using Java if I want to create a HashMap with the first column as the key and the second column as the value. Should I use the Scanner class? Try to read in the whole file as a string and split it? What is the best way?

    Read the article

  • Access Creates new file every time I Compact & Repair

    - by NickSentowski
    It didn't always do this, but ever since I split my database and made the front-end an ACCDE file, any time I try to compact and repair either file, a new file called "Database 1" is generated and my original file size doesn't change. Is this normal? My ACCDB is roughly 20MB, and my ACCDE is just over 1M after being used the first time. Before opening, the ACCDE was only 600k (I have lots of forms and queries, and regularly store PDF attachments.

    Read the article

  • Dreamweaver CS5 - Have Design Window as a Panel?

    - by Oliver Jones
    I've been looking around on the dreamweaver interface, and I'm trying to get my design window as an external panel. Reason is, I have a dual monitor system, and I would like to have the main window (where you can have both code/split/design) on my main screen, but with the code selected, and a design view on my secondary monitor. I'm assuming this can't be done, although I have noticed you can have your code as an external panel (Code Inspector). Would like to hear your input. Thanks

    Read the article

  • im writing a spellchecking program, how do i replace ch in a string..eg..

    - by Ajay Hopkins
    what am i doing wrong/what can i do?? import sys import string def remove(file): punctuation = string.punctuation for ch in file: if len(ch) > 1: print('error - ch is larger than 1 --| {0} |--'.format(ch)) if ch in punctuation: ch = ' ' return ch else: return ch ref = (open("ref.txt","r")) test_file = (open("test.txt", "r")) dictionary = ref.read().split() file = test_file.read().lower() file = remove(file) print(file) p.s, this is in Python 3.1.2

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • Adding google.maps.latlng within a loop

    - by Mick Morrison
    I am new to Java Script. I am using it, in combination with Java Server Faces. I want to add some points to define a Polilyne using GoogleMaps Apiv3. My problem is that I can't add a FOR statement to the javascript, because it dumps. If I comment this FOR loop, it also dumps. The dump I am getting is: "javax.servlet.ServletException: null source". Has anyone any suggestion to solve this? Thanks in advance, Emanuel <script type="text/javascript"> function initialize() { var longit = "${dateRange.longitude}" ; var lat = "${dateRange.latitude}" ; var latlng = new google.maps.LatLng(lat, longit); var myOptions = { zoom: 15, center: latlng, mapTypeId: google.maps.MapTypeId.ROADMAP }; var map = new google.maps.Map(document.getElementById("map_canvas"), myOptions); var points = []; var cadena1 = "${dateRange.latArray}" ; var cadena2 = "${dateRange.longArray}" ; var latArray = cadena1.split('?'); var longArray = cadena2.split('?'); /* The code Below is the one that fails */ for (var i=0; i < latArray.length; i++) { points.push(new google.maps.LatLng(latArray[i], longArray[i])); } /* Finish of the error code */ // The Polilyne is created var mapPath = new google.maps.Polyline ({ path: points, strokeColor: "#FF0000", strokeOpacity: 1.0, strokeWeight: 4 }); mapPath.setMap(map); } </script> </head> <body onload="initialize()"> <h:graphicImage url="http://localhost:8080/gps_tracking/faces/resources/images/logo.jpg"> </h:graphicImage> <h1 align="center">Sol-Tech</h1><br /> <hr></hr> <div id="map_canvas" style="width:100%; height:100%"></div> </body>

    Read the article

  • working validation hint, working word counter but not working together

    - by Sriyani Rathnayaka
    I added a word counter to a my form's textarea... it is something like this... <div> <label>About you:</label> <textarea id="qualification" class="textarea hint_needed" rows="4" cols="30" ></textarea> <span class="hint">explain about you</span> <script type="text/javascript"> $("textarea").textareaCounter(); </script> </div> My problem is when I add textaracounter() like this my validation hint is not working.. when I remover the counter function validation hint is working... this is the jquery for hint message.. $(".hint").css({ "display":"none" }); $("input.hint_needed, select.hint_needed, textarea.hint_needed, radio.hint_needed").on("mouseenter", function() { $(this).next(".hint").css({ "display":"inline" }); }).on("mouseleave", function() { $(this).next(".hint").css({ "display":"none" }); }); this is for the word counter.. (function($){ $.fn.textareaCounter = function(options) { // setting the defaults // $("textarea").textareaCounter({ limit: 100 }); var defaults = { limit: 150 }; var options = $.extend(defaults, options); // and the plugin begins return this.each(function() { var obj, text, wordcount, limited; obj = $("#experience"); obj.after('<span style="font-weight: bold; color:#6a6a6a; clear: both; margin: 3px 0 0 150px; float: left; overflow: hidden;" id="counter-text">Max. '+options.limit+' words</span>'); obj.keyup(function() { text = obj.val(); if(text === "") { wordcount = 0; } else { wordcount = $.trim(text).split(" ").length; } if(wordcount > options.limit) { $("#counter-text").html('<span style="color: #DD0000;">0 words left</span>'); limited = $.trim(text).split(" ", options.limit); limited = limited.join(" "); $(this).val(limited); } else { $("#counter-text").html((options.limit - wordcount)+' words left'); } }); }); }; })(jQuery); can anybody tell me what is the problem there? Thank you..

    Read the article

  • Managing conflicting ivy repositories (in eclipse)

    - by Stephen
    I've got eclipse workspaces for my full time job and my home test work that are both set up with ivy (and using ivyDE). However, I'm finding that I'm getting strange behaviour and conflicts between the different workspaces - issues like not being able to find certain dependencies, or not compiling etc. Is there a way in ivy or ivyDE to set the home .ivy2 directory so that I can split my workspaces? At the moment, I'm alternating different directories for my .ivy2 cache.

    Read the article

  • Can splitting .MDB files into segments help with stability?

    - by Craig Johnston
    Is this a realistic solution to the problems associated with larger .mdb files: split the large .mdb file into smaller .mdb files have one 'central' .mdb containing links to the tables in the smaller .mdb files How easy would it be to make this change to an .mdb backed VB application? Could the changes to the database be done so that there are no changes required to the front-end application?

    Read the article

  • Proper HTML technique to create an web form out of an image

    - by Lars
    I plan to create an interactive golf score card for my website (XHTML). (Btw. thats how such a scorecard looks like: ScoreCard). So at the end one should be able to insert a score for each hole in the appropriated input field in the virtual scorecard on the website. For me it is very important that the interactive scorecard really looks the same as the original (paper-) scorecard does and so my first approach was to scan and slice the scorecard image to reach that appearance. Here you can see the way I sliced the image: The idea was to insert HTML text input for each score field ending up with something like this: After I sliced the image I reconstructed it using the HTML . To do that I put the image slices as the cell background. <table> <tr> <td style="background: url("slice1.jpg") width="58px" height="25px"> <input type="text"></inputText> </td> </tr> ... </table> At the first moment this worked fine (as Gimp offers quite a nice feature for this). Then the problem was that I had to create a HTML table to create the exact layout. As you can see the lower part of the layout is split up into 3 columns. The middle column is split up into several (for each hole) rows. So the left and right column have to be spanned over those rows. Ok finally that worked, but it lead to some kind of scaling problem. If I zoom in or out on the table the middle column (and only that one) is not scaled the right way. Iam not able to fix this, and so I start doubting if this is the right technique for html image virtualization. Iam really no specialist in the area of creating websites, so I would really appriciate any help on this. Maybe there is a complete other and better technique to do that, as I think it is a common job in webcreation. I couldnt find any nice examples or tuts on that.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 76 77 78 79 80 81 82 83 84 85 86 87  | Next Page >