Search Results

Search found 55276 results on 2212 pages for 'eicar test string'.

Page 810/2212 | < Previous Page | 806 807 808 809 810 811 812 813 814 815 816 817  | Next Page >

  • JSON is used only for JavaScript?

    - by Bob Smith
    I am storing a JSON string in the database that represents a set of properties. In the code behind, I export it and use it for some custom logic. Essentially, I am using it only as a storage mechanism. I understand XML is better suited for this but I read that JSON is faster and preferred. Is it a good practice to use JSON if the intention is not to use the string on the client side?

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • How to get Alfresco login ticket without user password, but with impersonating user with user principal name (UPN)

    - by dok
    I'm writing a DLL that has function for getting Alfresco login ticket without using user password, using only a user principal name (UPN). I’m calling alfresco REST API service /wcservice. I use NTLM in Alfresco. I’m impersonating users using WindowsIdentity constructor as explained here http://msdn.microsoft.com/en-us/library/ms998351.aspx#paght000023_impersonatingbyusingwindowsidentity. I checked and user is properly impersonated (I checked WindowsIdentity.GetCurrent().Name property). After impersonating a user, I try to make HttpWebRequest and set its credentials with CredentialsCache.DefaultNetworkCredentials. I get the error: The remote server returned an error: (401) Unauthorized. at System.Net.HttpWebRequest.GetResponse() When I use new NetworkCredential("username", "P@ssw0rd") to set request credentials, I get Alfresco login ticket (HttpStatusCode.OK, 200). Is there any way that I can get Alfresco login ticket without user password? Here is the code that I'm using: private string GetTicket(string UPN) { WindowsIdentity identity = new WindowsIdentity(UPN); WindowsImpersonationContext context = null; try { context = identity.Impersonate(); MakeWebRequest(); } catch (Exception e) { return e.Message + Environment.NewLine + e.StackTrace; } finally { if (context != null) { context.Undo(); } } } private string MakeWebRequest() { string URI = "http://alfrescoserver/alfresco/wcservice/mg/util/login"; HttpWebRequest request = WebRequest.Create(URI) as HttpWebRequest; request.CookieContainer = new CookieContainer(1); //request.Credentials = new NetworkCredential("username", "p@ssw0rd"); // It works with this request.Credentials = CredentialCache.DefaultNetworkCredentials; // It doesn’t work with this //request.Credentials = CredentialCache.DefaultCredentials; // It doesn’t work with this either try { using (HttpWebResponse response = request.GetResponse() as HttpWebResponse) { StreamReader sr = new StreamReader(response.GetResponseStream()); return sr.ReadToEnd(); } } catch (Exception e) { return (e.Message + Environment.NewLine + e.StackTrace); } } Here are records from Alfresco stdout.log (if it helps in any way): 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,550 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.526239ms 17:18:04,550 DEBUG [app.servlet.NTLMAuthenticationFilter] New NTLM auth request from 10.**.**.** (10.**.**.**:1229) 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Processing request: /alfresco/wcservice/mg/util/login SID:7453F7BD4FD2E6A61AD40A31A37733A5 17:18:04,566 DEBUG [web.scripts.DeclarativeRegistry] Web Script index lookup for uri /mg/util/login took 0.400909ms 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Received type1 [Type1:0xe20882b7,Domain:<NotSet>,Wks:<NotSet>] 17:18:04,566 DEBUG [app.servlet.NTLMAuthenticationFilter] Client domain null 17:18:04,675 DEBUG [app.servlet.NTLMAuthenticationFilter] Sending NTLM type2 to client - [Type2:0x80000283,Target:AlfrescoServerA,Ch:197e2631cc3f9e0a]

    Read the article

  • Grails - Self Join

    - by WaZ
    Hi, When I write the following class, I get the following compilation error: could not resolve property How can I achive the following: class Employee{ String Name String Email Employee Manager static hasMany = [desginations:Designation] static constraints = { Name(unique:true) Email(unique:true) } Thanks, Much appreciated.

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • Java regex return after first match

    - by user216915
    hi how do i return after the first match of regular expression? (does the Matcher.find() method do that? ) say I have a string "abcdefgeee". I want to ask the regex engine stop finding immediately after it finds the first match of "e" for example. I am writing a method to return true/false if the pattern is found and i don't want to find the whole string for "e". (I am looking for a regex solution ) thanks

    Read the article

  • Filter a form using a command button on another form

    - by Shaun
    I have a form with a cmdbutton that at the moment opens another form and shows all records for several types of PartitionStyles and TrimFinishs (486 at present), I need to be able to filter the second form to show only the TrimFinish I need. Private Sub lbl600SeriesS_Click() Dim stDocName As String Dim stLinkCriteria As String stDocName = "frmModules" stLinkCriteria = "Forms!frmModules![TrimFinish] = 1" DoCmd.OpenForm stDocName, , , stLinkCriteria End Sub At the moment it shows only a new record, I know there should be 162 records using 1, what have I missed or done incorrect.

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • Can I make Axis2 generate a WSDL with 'unwrapped' types?

    - by Bedwyr Humphreys
    I'm trying to consume a hello world AXIS2 SOAP web service using a PHP client. The Java class is written in Netbeans and the AXIS2 aar file is generated using the Netbeans AXIS2 plugin. You've all seen it before but here's the java class: public class SOAPHello { public String sayHello(String username) { return "Hello, "+username; } } The wsdl genereated by AXIS2 seems to wrap all the parameters so that when I consume the service i have to use a crazy PHP script like this: $client = new SoapClient("http://myhost:8080/axis2/services/SOAPHello?wsdl"); $parameters["username"] = "Dave"; $response = $client->sayHello($parameters)->return; echo $response."!"; When all I really want to do is echo $client->sayHello("Dave")."!"; My question is two-fold: why is this happening? and what can I do to stop it? :) Here's are the types, message and porttype sections of the generated wsdl: <wsdl:types> <xs:schema attributeFormDefault="qualified" elementFormDefault="qualified" targetNamespace="http://soap.axis2.myhost.co.uk"> <xs:element name="sayHello"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="username" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="sayHelloResponse"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="return" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> </wsdl:types> <wsdl:message name="sayHelloRequest"> <wsdl:part name="parameters" element="ns:sayHello"/> </wsdl:message> <wsdl:message name="sayHelloResponse"> <wsdl:part name="parameters" element="ns:sayHelloResponse"/> </wsdl:message> <wsdl:portType name="SOAPHelloPortType"> <wsdl:operation name="sayHello"> <wsdl:input message="ns:sayHelloRequest" wsaw:Action="urn:sayHello"/> <wsdl:output message="ns:sayHelloResponse" wsaw:Action="urn:sayHelloResponse"/> </wsdl:operation> </wsdl:portType>

    Read the article

  • Html code clearner

    - by Blanca
    Hi! Is there any library or method to input a String with html code, and which has a return value another String whitout this htmlo code, just the information??? I am watching libraries such JTidy, or HtmlParser, but I don't know how to use it! Something easier??? Thank you!

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • LINQ - array property contains element from another array

    - by Rob
    I have a object (product), with a property of type 'array' e.g. product.tags = {"tag1","tag2","tag9"} I have an array of input tags to filter on. ... but this is not quite working: List<string> filterTags = new List<string>() { "tag1", "tag3" }; var matches = from p in products where p.Tags.Contains(filterTags) select p; Any recommendations? Thanks.

    Read the article

  • Find items is SSRS by Id

    - by chief7
    How do you find items in SSRS by ID? I tried to use the id returned by another find result, a new guid to string and small random string all of which return the same error: The ID field has a value that is not valid. --- Microsoft.ReportingServices.Diagnostics.Utilities.InvalidElementException: The ID field has a value that is not valid. Here is the code: var request = new FindItemsRequest { Conditions = new[] { new SearchCondition { Name = "ID", Value = "test"} }, Folder = "/" }; return _ssrsService .FindItems(request) .Items I'm using SSRS 2005.

    Read the article

  • regex question: independent position of words

    - by Fuxi
    hi all, is it possible to define a regex pattern which checks eg. for 3 terms independent to their position in the main string? eg. my string is something like "click here to unsubscribe: http://www.url.com" the pattern should also work with "http:// unsubscribe click" thx

    Read the article

  • Get the type name

    - by Neir0
    How i can get full right name of generic type? For example: This code typeof(List<string>).Name return List`1 instead of List<string> How to get a right name?

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • ASP.NET MVC BaseController to dynamically set MasterPage file

    - by rockinthesixstring
    I've built a Base Controller that all of my Controllers inherit from, and I've got it setup so that it checks the browser type and returns the appropriate MasterPageFile on the fly. I'm wondering if this is an efficient way to do this or if I should optimize it another way. Public Class BaseController : Inherits System.Web.Mvc.Controller Protected Overrides Function View(ByVal viewName As String, ByVal masterName As String, ByVal model As Object) As System.Web.Mvc.ViewResult If Request.Browser.IsMobileDevice Then Return MyBase.View(viewName, "Mobile", model) Else Return MyBase.View(viewName, "Site", model) End If End Function End Class

    Read the article

  • Get Attribute value in ViewEngine ASP.NET MVC 3

    - by Kushan Fernando
    I'm writting my own view engine. public class MyViewEngine : RazorViewEngine { public override ViewEngineResult FindView(ControllerContext controllerContext, string viewName, string masterName, bool useCache) { // Here, how do I get attributes defined on top of the Action ? } } ASP.NET MVC Custom Attributes within Custom View Engine Above SO Question has how to get attributes defined on top of the Controller. But I need to get attributes defined on Action.

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

< Previous Page | 806 807 808 809 810 811 812 813 814 815 816 817  | Next Page >