Search Results

Search found 22641 results on 906 pages for 'use case'.

Page 842/906 | < Previous Page | 838 839 840 841 842 843 844 845 846 847 848 849  | Next Page >

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Why do sockets not die when server dies? Why does a socket die when server is alive?

    - by Roman
    I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • How to navigate to another html page?

    - by newbie
    In my application there's a usual login page sending username and password to the server script, where it needs to be authenticated, and in case of an authentic user, the server should redirect to a page student.html. This is my code var ports = 3000; var portt = 3001; var express = require('express'); var student = require('express')(); var teacher = require('express')(); var server_s = require('http').createServer(student); var server_t = require('http').createServer(teacher); var ios = require('socket.io').listen(server_s); var iot = require('socket.io').listen(server_t); var path = require('path'); server_s.listen(ports); server_t.listen(portt); student.use(express.static(path.join(__dirname, 'public'))); student.get('/', function(req,res){ res.sendfile(__dirname + '/login.html'); }); teacher.use(express.static(path.join(__dirname, 'public'))); teacher.get('/', function(req,res){ res.sendfile(__dirname + '/mytry.html'); }); ios.sockets.on('connection', function(socket){ var username, password; socket.on('check',function(data){ username = data[0]; password = data[1]; //************* Database connection and query ************* var mysql = require('mysql'); var connection = mysql.createConnection({ host : 'localhost', user : 'user', password: '*******', database: 'my_db' }); connection.connect(); var qstring = 'SELECT s_id FROM login_student WHERE username='+username+'AND password='+password; connection.query(qstring, function(err, rows, fields) { if (err) { console.log('ERROR: ' + err); socket.emit('login_failure','DB error'); return; } console.log('The solution is: ', rows[0].solution); if (rows>0) //***** Here i want redirection to another page ****** else socket.emit('login_failure','Invalid Username or password'); }); connection.end(); }); }); iot.sockets.on('connection', function(socket){ ; }); }); Can anyone suggest what should I do?

    Read the article

  • Paging & Sorting grids with ASP.Net MVC

    - by Scott Ivey
    I'm new to MVC, and am not following how you'd do paging and sorting on a grid. I'm used to using the asp.Net GridView control with an ObjectDataSource pointed at objects in our business layer - and in that case the ODS handles all of the paging & sorting using the methods that our ORM generates on the objects. I've looked at using the same ORM with MVC - and things work out fine there - i just loop thru the collections to build the table on the page - but without the ODS to handle the paging & sorting, i'm confused as to how I'd handle that. Would I have a separate controller for the paging and sorting? I'm not sure what the best practices are for this scenario, so if someone can point me in the right direction it would be much appreciated. Edit: Ok, so I understand that I need to roll my own - but where do I start? I've created a CustomerController, and a view that displays a table of customers that looks like below - and I want to sort on FirstName or LastName columns. My Model has a Sort() method on it that'll take a string sort expression in the format that would be used by a GridView/ODS pair. Would I create a new Action on my CustomerController called Sort, and put an ActionLink in my header? <table> <tr> <th> First Name </th> <th> Last Name </th> </tr> <% foreach (var item in Model) { %> <tr> <td> <%= Html.Encode(item.FirstName) %> </td> <td> <%= Html.Encode(item.LastName) %> </td> </tr> <% } %> </table>

    Read the article

  • OpenGL Shader Compile Error

    - by Tomas Cokis
    I'm having a bit of a problem with my code for compiling shaders, namely they both register as failed compiles and no log is received. This is the shader compiling code: /* Make the shader */ Uint size; GLchar* file; loadFileRaw(filePath, file, &size); const char * pFile = file; const GLint pSize = size; newCashe.shader = glCreateShader(shaderType); glShaderSource(newCashe.shader, 1, &pFile, &pSize); glCompileShader(newCashe.shader); GLint shaderCompiled; glGetShaderiv(newCashe.shader, GL_COMPILE_STATUS, &shaderCompiled); if(shaderCompiled == GL_FALSE) { ReportFiler->makeReport("ShaderCasher.cpp", "loadShader()", "Shader did not compile", "The shader " + filePath + " failed to compile, reporting the error - " + OpenGLServices::getShaderLog(newCashe.shader)); } And these are the support functions: bool loadFileRaw(string fileName, char* data, Uint* size) { if (fileName != "") { FILE *file = fopen(fileName.c_str(), "rt"); if (file != NULL) { fseek(file, 0, SEEK_END); *size = ftell(file); rewind(file); if (*size > 0) { data = (char*)malloc(sizeof(char) * (*size + 1)); *size = fread(data, sizeof(char), *size, file); data[*size] = '\0'; } fclose(file); } } return data; } string OpenGLServices::getShaderLog(GLuint obj) { int infologLength = 0; int charsWritten = 0; char *infoLog; glGetShaderiv(obj, GL_INFO_LOG_LENGTH,&infologLength); if (infologLength > 0) { infoLog = (char *)malloc(infologLength); glGetShaderInfoLog(obj, infologLength, &charsWritten, infoLog); string log = infoLog; free(infoLog); return log; } return "<Blank Log>"; } and the shaders I'm loading: void main(void) { gl_FragColor = vec4(1.0, 0.0, 0.0, 1.0); } void main(void) { gl_Position = ftransform(); } In short I get From: ShaderCasher.cpp, In: loadShader(), Subject: Shader did not compile Message: The shader Data/Shaders/Standard/standard.vs failed to compile, reporting the error - <Blank Log> for every shader I compile I've tried replacing the file reading with just a hard coded string but I get the same error so there must be something wrong with how I'm compiling them. I have run and compiled example programs with shaders, so I doubt my drivers are the issue, but in any case I'm on a Nvidia 8600m GT. Can anyone help?

    Read the article

  • Tab Bar disappears below the bottom of the screen

    - by Manu
    Hi, In my application I'm using a Navigation Controller to push one view that loads a Tab Bar Controller and a custom Navigation Bar as well. The problem is that the Tab Bar disappears below the bottom of the screen, and I don't know what's causing the problem. If I load a simple Tab Bar in the next view, it positions itself correctly... but what I need is a Tab Bar Controller, and in that case the Tab Bar disappears below the bottom. I have tried changing the view and size properties of the Tab Bar, but that did not solve the problem. I also realised that the images and text of the tabs don't show (I have set up the "favourites" and "contacts" images and text, and they are big enough and should be visible on the top side of the tab, but they are not). Both tabs work perfectly, by the way. There is an image here. I load the Tab Bar with the following code: - (void)viewDidLoad { [super viewDidLoad]; myTabBarController = [[UITabBarController alloc] init]; SettingsViewController* tab1 = [[SettingsViewController alloc] init]; AboutViewController* tab2 = [[AboutViewController alloc] init]; NSArray* controllers = [NSArray arrayWithObjects:tab1, tab2, nil]; myTabBarController.viewControllers = controllers; [self.view insertSubview:myTabBarController.view belowSubview:myNavigationBar]; } It doesn't matter if I remove the Navigation Bar or not. I have tested using this instead: [self.view addSubview:myTabBarController.view]; ... forgetting about the Navigation Bar, but the Tab Bar still goes under the bottom. I don't know if the problem is in one of my NIB files or in how I load the view (although I do this as I read in the Apple's SDK documentation). Any ideas? Another question would be... do you know how could I change the title of my Navigation Bar when I select the second tab? I imagine I would have to do it in viewDidLoad in AboutViewController.m, would that be correct? Thanks for you time!

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • UCA + Natural Sorting

    - by Alix Axel
    I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

    Read the article

  • small scale web site - global javascript file style/format/pattern - improving maintainability

    - by yaya3
    I frequently create (and inherit) small to medium websites where I have the following sort of code in a single file (normally named global.js or application.js or projectname.js). If functions get big, I normally put them in a seperate file, and call them at the bottom of the file below in the $(document).ready() section. If I have a few functions that are unique to certain pages, I normally have another switch statement for the body class inside the $(document).ready() section. How could I restructure this code to make it more maintainable? Note: I am less interested in the functions innards, more so the structure, and how different types of functions should be dealt with. I've also posted the code here - http://pastie.org/999932 in case it makes it any easier var ProjectNameEnvironment = {}; function someFunctionUniqueToTheHomepageNotWorthMakingConfigurable () { $('.foo').hide(); $('.bar').click(function(){ $('.foo').show(); }); } function functionThatIsWorthMakingConfigurable(config) { var foo = config.foo || 700; var bar = 200; return foo * bar; } function globallyRequiredJqueryPluginTrigger (tooltip_string) { var tooltipTrigger = $(tooltip_string); tooltipTrigger.tooltip({ showURL: false ... }); } function minorUtilityOneLiner (selector) { $(selector).find('li:even').not('li ul li').addClass('even'); } var Lightbox = {}; Lightbox.setup = function(){ $('li#foo a').attr('href','#alpha'); $('li#bar a').attr('href','#beta'); } Lightbox.init = function (config){ if (typeof $.fn.fancybox =='function') { Lightbox.setup(); var fade_in_speed = config.fade_in_speed || 1000; var frame_height = config.frame_height || 1700; $(config.selector).fancybox({ frameHeight : frame_height, callbackOnShow: function() { var content_to_load = config.content_to_load; ... }, callbackOnClose : function(){ $('body').height($('body').height()); } }); } else { if (ProjectNameEnvironment.debug) { alert('the fancybox plugin has not been loaded'); } } } // ---------- order of execution ----------- $(document).ready(function () { urls = urlConfig(); (function globalFunctions() { $('.tooltip-trigger').each(function(){ globallyRequiredJqueryPluginTrigger(this); }); minorUtilityOneLiner('ul.foo') Lightbox.init({ selector : 'a#a-lightbox-trigger-js', ... }); Lightbox.init({ selector : 'a#another-lightbox-trigger-js', ... }); })(); if ( $('body').attr('id') == 'home-page' ) { (function homeFunctions() { someFunctionUniqueToTheHomepageNotWorthMakingConfigurable (); })(); } });

    Read the article

  • waiting for 2 different events in a single thread

    - by João Portela
    component A (in C++) - is blocked waiting for alarm signals (not relevant) and IO signals (1 udp socket). has one handler for each of these. component B (java) - has to receive the same information the component A udp socket receives. periodicaly gives instructions that should be sent through component A udp socket. How to join both components? it is strongly desirable that: the changes to attach component B to component A are minimal (its not my code and it is not very pleasent to mess with). the time taken by the new operations (usually communicating with component B) interfere very little with the usual processing time of component A - this means that if the operations are going to take a "some" time I would rather use a thread or something to do them. note: since component A receives udp packets more frequently that it has component B instructions to forward, if necessary, it can only forward the instructions (when available) from the IO handler. my initial ideia was to develop a component C (in C++) that would sit inside the component A code (is this called an adapter?) that when instanciated starts the java process and makes the necessary connections (that not so little overhead in the initialization is not a problem). It would have 2 stacks, one for the data to give component B (lets call it Bstack) and for the data to give component A (lets call it Astack). It would sit on its thread (lets call it new-thread) waiting for data to be available in Bstack to send it over udp, and listen on the udp socket to put data on the Astack. This means that the changes to component A are only: when it receives a new UDP packet put it on the Bstack, and if there is something on the Astack sent it over its UDP socket (I decided for this because this socket would only be used in the main thread). One of the problems is that I don't know how to wait for both of these events at the same time using only one thread. so my questions are: Do I really need to use the main thread to send the data over component A socket or can I do it from the new-thread? (I think the answer is no, but I'm not sure about race conditions on sockets) how to I wait for both events? boost::condition_variable or something similar seems the solution in the case of the stack and boost::asio::io_service io_service.run() seems like the thing to use for the socket. Is there any other alternative solution for this problem that I'm not aware of? Thanks for reading this long text but I really wanted you to understand the problem.

    Read the article

  • using AsyncTask class for parallel operationand displaying a progress bar

    - by Kumar
    I am displaying a progress bar using Async task class and simulatneously in parallel operation , i want to retrieve a string array from a function of another class that takes some time to return the string array. The problem is that when i place the function call in doing backgroung function of AsyncTask class , it gives an error in Doing Background and gives the message as cant change the UI in doing Background .. Therefore , i placed the function call in post Execute method of Asynctask class . It doesnot give an error but after the progress bar has reached 100% , then the screen goes black and takes some time to start the new activity. How can i display the progress bar and make the function call simultaneously.??plz help , m in distress here is the code package com.integrated.mpr; import android.app.Activity; import android.app.ProgressDialog; import android.content.Intent; import android.os.AsyncTask; import android.os.Bundle; import android.os.Handler; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class Progess extends Activity implements OnClickListener{ static String[] display = new String[Choose.n]; Button bprogress; @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.progress); bprogress = (Button) findViewById(R.id.bProgress); bprogress.setOnClickListener(this); } @Override public void onClick(View v) { // TODO Auto-generated method stub switch(v.getId()){ case R.id.bProgress: String x ="abc"; new loadSomeStuff().execute(x); break; } } public class loadSomeStuff extends AsyncTask<String , Integer , String>{ ProgressDialog dialog; protected void onPreExecute(){ dialog = new ProgressDialog(Progess.this); dialog.setProgressStyle(ProgressDialog.STYLE_HORIZONTAL); dialog.setMax(100); dialog.show(); } @Override protected String doInBackground(String... arg0) { // TODO Auto-generated method stub for(int i = 0 ;i<40;i++){ publishProgress(5); try { Thread.sleep(1000); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } dialog.dismiss(); String y ="abc"; return y; } protected void onProgressUpdate(Integer...progress){ dialog.incrementProgressBy(progress[0]); } protected void onPostExecute(String result){ display = new Logic().finaldata(); Intent openList = new Intent("com.integrated.mpr.SENSITIVELIST"); startActivity(openList); } } }

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • GHC.Generics and Type Families

    - by jberryman
    This is a question related to my module here, and is simplified a bit. It's also related to this previous question, in which I oversimplified my problem and didn't get the answer I was looking for. I hope this isn't too specific, and please change the title if you can think if a better one. Background My module uses a concurrent chan, split into a read side and write side. I use a special class with an associated type synonym to support polymorphic channel "joins": {-# LANGUAGE TypeFamilies #-} class Sources s where type Joined s newJoinedChan :: IO (s, Messages (Joined s)) -- NOT EXPORTED --output and input sides of channel: data Messages a -- NOT EXPORTED data Mailbox a instance Sources (Mailbox a) where type Joined (Mailbox a) = a newJoinedChan = undefined instance (Sources a, Sources b)=> Sources (a,b) where type Joined (a,b) = (Joined a, Joined b) newJoinedChan = undefined -- and so on for tuples of 3,4,5... The code above allows us to do this kind of thing: example = do (mb , msgsA) <- newJoinedChan ((mb1, mb2), msgsB) <- newJoinedChan --say that: msgsA, msgsB :: Messages (Int,Int) --and: mb :: Mailbox (Int,Int) -- mb1,mb2 :: Mailbox Int We have a recursive action called a Behavior that we can run on the messages we pull out of the "read" end of the channel: newtype Behavior a = Behavior (a -> IO (Behavior a)) runBehaviorOn :: Behavior a -> Messages a -> IO () -- NOT EXPORTED This would allow us to run a Behavior (Int,Int) on either of msgsA or msgsB, where in the second case both Ints in the tuple it receives actually came through separate Mailboxes. This is all tied together for the user in the exposed spawn function spawn :: (Sources s) => Behavior (Joined s) -> IO s ...which calls newJoinedChan and runBehaviorOn, and returns the input Sources. What I'd like to do I'd like users to be able to create a Behavior of arbitrary product type (not just tuples) , so for instance we could run a Behavior (Pair Int Int) on the example Messages above. I'd like to do this with GHC.Generics while still having a polymorphic Sources, but can't manage to make it work. spawn :: (Sources s, Generic (Joined s), Rep (Joined s) ~ ??) => Behavior (Joined s) -> IO s The parts of the above example that are actually exposed in the API are the fst of the newJoinedChan action, and Behaviors, so an acceptable solution can modify one or all of runBehaviorOn or the snd of newJoinedChan. I'll also be extending the API above to support sums (not implemented yet) like Behavior (Either a b) so I hoped GHC.Generics would work for me. Questions Is there a way I can extend the API above to support arbitrary Generic a=> Behavior a? If not using GHC's Generics, are there other ways I can get the API I want with minimal end-user pain (i.e. they just have to add a deriving clause to their type)?

    Read the article

  • Log4j: Issues about the FallbackErrorHandler

    - by rdogpink
    I am working on a client-server-application and wanted to implement a flexible Loggingframework, so I chose log4j, which doesn´t really evolve anymore, but it is still handy framework. Because the Logging happens along the network, i wanted a solution for the case, that the network drive isn´t available, so the Logger has to change its destination file(s). Now I wanted to use the FallbackErrorHandler (configured with a XML-File) from the Log4j-library and the implementation worked: When my network drive isn´t available, it switches to a local Logfile, so no logging should be lost. But I headded two problems since yesterday and couldn´t figure or find out, how to solve it. No return to initial Logging Configuration: When the network drive is on again and the Logger could write to the old destinations, log4j still logs at the local drive and I can´t figure out, how to notify the original (primary) Logger to start again. I also tried to attach a second Appender to the ErrorHandler, which should mirror the failed primary Logger, that it tries to write on the network destination and when the network is on again, it logs in both files, on the local and on the network drive. But unfortunately it didn´t work out, I only got a failure message that the ErrorHandler-content doesn´t fit. log4j:WARN The content of element type "errorHandler" must match "(param*,root-ref?,logger-ref*,appender-ref?)". This is the responsible code. <appender name="TraceAppender" class="org.apache.log4j.DailyRollingFileAppender"> <!-- The second appender-ref "TestAppender" leads to the error. --> <errorHandler class="org.apache.log4j.varia.FallbackErrorHandler"> <logger-ref ref="com.idoh"/> <appender-ref ref="TraceFallbackAppender"/> <appender-ref ref="TestAppender"/> </errorHandler> <param name="datePattern" value=".yyyy-MM-dd" /> <param name="file" value="logs/Trace.txt" /> <layout class="org.apache.log4j.PatternLayout"> <param name="ConversionPattern" value="%-6r %d{HH:mm:ss,SSS} [%t] %-5p - %m%n"/> </layout> </appender> So, how could I trigger log4j to reset to initial configuration or hold a second appender parallel to the "Local-Logger". My Application should work by itself and shouldn´t have to be restarted often. First Error message is swallowed: I recognized, that the first message, which leads to the switching between the primary logger and the FallbackErrorHandler (for example a logging-request to a readonly-File), is swallowed, so neither the primary logger logs it (because it can´t) nor the backup-Logger knows what it missed. So anybody else ran in this problem and could solve it? Or has any suggestions?

    Read the article

  • Memory leaks getting sub-images from video (cvGetSubRect)

    - by dnul
    Hi, i'm trying to do video windowing that is: show all frames from a video and also some sub-image from each frame. This sub-image can change size and be taken from a different position of the original frame. So , the code i've written does basically this: cvQueryFrame to get a new image from the video Create a new IplImage (img) with sub-image dimensions ( window.height,window.width) Create a new Cvmat (mat) with sub-image dimensions ( window.height,window.width) CvGetSubRect(originalImage,mat,window) seizes the sub-image transform Mat (cvMat) to img (IplImage) using cvGetImage my problem is that for each frame i create new IplImage and cvMat which take a lot of memory and when i try to free the allocated memory I get a segmentation fault or in the case of the CvMat the allocated space does not get free (valgrind keeps telling me its definetly lost space). the following code does it: int main(void){ CvCapture* capture; CvRect window; CvMat * tmp; //window size window.x=0;window.y=0;window.height=100;window.width=100; IplImage * src=NULL,*bk=NULL,* sub=NULL; capture=cvCreateFileCapture( "somevideo.wmv"); while((src=cvQueryFrame(capture))!=NULL){ cvShowImage("common",src); //get sub-image sub=cvCreateImage(cvSize(window.height,window.width),8,3); tmp =cvCreateMat(window.height, window.width,CV_8UC1); cvGetSubRect(src, tmp , window); sub=cvGetImage(tmp, sub); cvShowImage("Window",sub); //free space if(bk!=NULL) cvReleaseImage(&bk); bk=sub; cvReleaseMat(&tmp); cvWaitKey(20); //window dimensions changes window.width++; window.height++; } } cvReleaseMat(&tmp); does not seem to have any effect on the total amount of lost memory, valgrind reports the same amount of "definetly lost" memory if i comment or uncomment this line. cvReleaseImage(&bk); produces a segmentation fault. notice i'm trying to free the previous sub-frame which i'm backing up in the bk variable. If i comment this line the program runs smoothly but with lots of memory leaks I really need to get rid of memory leaks, can anyone explain me how to correct this or even better how to correctly perform image windowing? Thank you

    Read the article

  • Java loading user-specified classes at runtime

    - by user349043
    I'm working on robot simulation in Java (a Swing application). I have an abstract class "Robot" from which different types of Robots are derived, e.g. public class StupidRobot extends Robot { int m_stupidness; int m_insanityLevel; ... } public class AngryRobot extends Robot { float m_aggression; ... } As you can see, each Robot subclass has a different set of parameters. What I would like to do is control the simulation setup in the initial UI. Choose the number and type of Robots, give it a name, fill in the parameters etc. This is one of those times where being such a dinosaur programmer, and new to Java, I wonder if there is some higher level stuff/thinking that could help me here. So here is what I've got: (1) User Interface Scrolling list of Robot types on the left. "Add " and "<< Remove" buttons in the middle. Default-named scrolling list of Robots on the right. "Set Parameters" button underneath. (So if you wanted an AngryRobot, you'd select AngryRobot on the left list, click "Add" and "AngryRobot1" would show up on the right.) When selecting a Robot on the right, click "Set Parameters..." button which would call yet another model dialog where you'd fill in the parameters. Different dialog called for each Robot type. (2) Data structures an implementation As an end-product I think a HashMap would be most convenient. The keys would be Robot types and the accompanying object would be all of the parameters. The initializer could just retrieve each item one and a time and instantiate. Here's what the data structures would look like: enum ROBOT_TYPE {STUPID, ANGRY, etc} public class RobotInitializer { public ROBOT_TYPE m_type; public string m_name; public int[] m_int_params; public float[] m_float_params; etc. The initializer's constructor would create the appropriate length parameter arrays based on the type: public RobotInitializer(ROBOT_TYPE type, int[] int_array, float[] float_array, etc){ switch (type){ case STUPID: m_int_params = new int[STUPID_INT_PARAM_LENGTH]; System.arraycopy(int_array,0,m_int_params,0,STUPID_INT_PARAM_LENGTH); etc. Once all the RobotInitializers are instantiated, they are added to the HashMap. Iterating through the HashMap, the simulation initializer takes items from the Hashmap and instantiates the appropriate Robots. Is this reasonable? If not, how can it be improved? Thanks

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • How to pass operators as parameters

    - by Rodion Ingles
    I have to load an array of doubles from a file, multiply each element by a value in a table (different values for different elements), do some work on it, invert the multiplication (that is, divide) and then save the data back to file. Currently I implement the multiplication and division process in two separate methods. Now there is some extra work behind the scenes but apart from the specific statements where the multiplication/division occurs, the rest of the code is identical. As you can imagine, with this approach you have to be very careful making any changes. The surrounding code is not trivial, so its either a case of manually editing each method or copying changes from one method to the other and remembering to change the * and / operators. After too many close calls I am fed up of this and would like to make a common function which implements the common logic and two wrapper functions which pass which operator to use as a parameter. My initial approach was to use function pointers: MultiplyData(double data) { TransformData(data, &(operator *)); } DivideData(double data) { TransformData(data, &(operator /)); } TransformData(double data, double (*func)(double op1, double op2)) { /* Do stuff here... */ } However, I can't pass the operators as pointers (is this because it is an operator on a native type?), so I tried to use function objects. Initially I thought that multiplies and divides functors in <functional> would be ideal: MultiplyData(double data) { std::multiplies<double> multFunct; TransformData(data, &multFunct); } DivideData(double data) { std::divides<double> divFunct; TransformData(data, &divFunct); } TransformData(double data, std::binary_function<double, double, double> *funct) { /* Do stuff here... */ } As you can see I was trying to use a base class pointer to pass the functor polymorphically. The problem is that std::binary_function does not declare an operator() member for the child classes to implement. Is there something I am missing, or is the solution to implement my own functor heirarchy (which really seems more trouble than it is worth)?

    Read the article

  • unable to trigger event in IE during clonning

    - by Abhimanyu
    Following is the code which will clone a set of div with their events(onclick) which is working fine for FF but in case of IE it is not firing events associated with each div. <html> <head> <style type='text/css'> .firstdiv{ border:1px solid red; } </style> <script language="JavaScript"> function show_tooltip(idx,condition,ev) { alert(idx +"=="+condition+"=="+ev); } function createCloneNode () { var cloneObj = document.getElementById("firstdiv").cloneNode(true); document.getElementById("maindiv").appendChild(cloneObj); } function init(){ var mainDiv = document.createElement("div"); mainDiv.id = 'maindiv'; var firstDiv = document.createElement("div"); firstDiv.id ='firstdiv'; firstDiv.className ='firstdiv'; for(var j=0;j<4;j++) { var summaryDiv = document.createElement("div"); summaryDiv.id = "sDiv"+j summaryDiv.className ='summaryDiv'; summaryDiv.onmouseover = function() {this.setAttribute("style","text-decoration:underline;cursor:pointer;");} summaryDiv.onmouseout = function() {this.setAttribute("style","text-decoration:none;");} summaryDiv.setAttribute("onclick", "show_tooltip("+j+",'view_month',event)"); summaryDiv.innerHTML = 'Div'+j; firstDiv.appendChild(summaryDiv); } mainDiv.appendChild(firstDiv); var secondDiv = document.createElement("div"); var linkDiv = document.createElement("div"); linkDiv.innerHTML ='create clone of above element'; linkDiv.onclick = function() { createCloneNode(); } secondDiv.appendChild(linkDiv); mainDiv.appendChild(secondDiv); document.body.appendChild(mainDiv); } </script> </head> <body> <script language="JavaScript"> init() </script> </body> </html> can anybody tell me whats the problem in above code please correct me..

    Read the article

  • git: setting a single tracking remote from a public repo.

    - by Gauthier
    I am confused with remote branches. My local repo: (local) ---A---B---C-master My remote repo (called int): (int) ---A---B---C---D---E-master What I want to do is to setup the local repo's master branch to follow that of int. Local repo: (local) ---A---B---C---D---E-master-remotes/int/master So that when int changes to: (int) ---A---B---C---D---E---F-master I can run git pull from the local repo's master and get (local) ---A---B---C---D---E---F-master-remotes/int/master Here's what I have tried: git fetch int gets me all the branches of int into remote branches. This can get messy since int might have hundreds of branches. git fetch int master gets me the commits, but no ref to it, only FETCH_HEAD. No remote branch either. git fetch int master:new_master works but I don't want a new name every time I update, and no remote branch is setup. git pull int master does what I want, but there is still no remote branch setup. I feel that it is ok to do so (that's the best I have now), but I read here and there that with the remote setup it is enough with git pull. git branch --track new_master int/master, as per http://www.gitready.com/beginner/2009/03/09/remote-tracking-branches.html . I get "not a valid object name: int/master". git remote -v does show me that int is defined and points at the correct location (1. worked). What I miss is the int/master branch, which is precisely what I want to get. git fetch in master:int/master. Well, int/master is created, but is no remote. So to summarize, I've tried some stuff with no luck. I would expect 2 to give me the remote branch to master in the repo int. The solution I use now is option 3. I read somewhere that you could change some config file by hand, but isn't that a bit cumbersome? The "cumbersome" way of editting the config file did work: [branch "master"] remote = int merge = master It can be done from command line: $ git config branch.master.remote int $ git config branch.master.merge master Any reason why option 2 above wouldn't do that automatically? Even in that case, git pull fetches all branches from the remote.

    Read the article

  • PHP - error when insert date into MySQL

    - by Michael Mao
    Hello everyone: I've got a typical problem when trying to insert a date into MySQL. The column defined in MySQL is of type DATE. My PHP version is 5.3.0 Apart from this date-related issue, the rest of my code works just fine. And this is my PHP script to do this: $tablename = BOOKS_TABLE; $insert = mysql_query("INSERT INTO $tablename (barcode, book_name, volume_num,". " author, publisher, item_type, buy_price, buy_date) VALUES ". "(". "'" . $barcode . "', ". "'" . $bookname . "', ". "'" . $volumenum . "', ". "'" . $author . "', ". "'" . $publisher . "', ". "'" . $itemtype . "', ". "'" . $buyprice . "', ". "'" . getMySQLDateString($buydate). //"'STR_TO_DATE('".$buydate ."', '%d/%m/%Y'))'". //nothing changes in MySQL ")"); And this is the faulty function : function getMySQLDateString($buydate) //typical buydate : 04/21/2009 { $mysqlDateString = date('Y-m-d H:i:s', $strtotime($buydate)); return $mysqlDateString; } The first commented out line wouldn't do anything, the script is executed with no error, however, there is nothing changed in datebase after this. The current approach will cause a Fatal error saying function name must be a string in this line. Actually I followed this thread on SO, but just cannot pass the date into MySQL... Can anyone help me figure out which part is not right? How would you do it, in this case, to get it right? Sorry about such a journeyman-like question, thanks a lot in advance.

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • help me to choose the best soulotion for my purpose to build my software.

    - by rima
    before answer me plz thinking about the futures of these kind of program and answer me plz. I wanna get some data from oracle server like: 1-get all the function,package,procedure and etc for showing them or drop them & etc... 2-compile my *.sql files,get the result if they have problem & etc... becuz I was beginner in oracle first of all I for solve the second problem I try to connect to sqlPlus by RUN sqlplus and trace the output(I mean,I change the output stream of shell and trace what happend and handle the assigned message to customer. NOW THIS PART SUCCEED. just a little bit I have problem with get all result because the output is asynchronous.any way... [in this case I log in to oracle Server by send argument to the sqlplus by make a process in c#] after that I try to get all function,package or procedure name,but I have problem in speed!so I try to use oracle.DataAccess.dll to connect the database. now I m so confusing about: which way is correct way to build a program that work like Oracle Developer! I do not have any experience for like these program how work. If Your answer is I must use the second way follow this part plz: I search a little bit the Golden,PLedit (Benthic software),I have little bit problem how I must create the connection string?because I thinking about how I can find the host name or port number that oracle work on them?? am I need read the TNSNames.Ora file? IF your answer is I must use the first way follow this part plz: do u have any Idea for how I parse the output?because for example the result of a table is so confusing...[i can handle & program it but I really need someone experience,because the important things to me learn how such software work so nice and with quick response?] All of the has different style in output... If you are not sure Can u help me which book can help me in this way i become expert? becuz for example all the C# write just about how u can connect to DB and the DB books write how u can use this DB program,I looking for a book that give me some Idea how develop an interface for do transaction between these two.not simple send and receive data,for example how write a compiler for them. the language of book is not different for me i know C#,java,VB,sql,Oracle Thanks.

    Read the article

< Previous Page | 838 839 840 841 842 843 844 845 846 847 848 849  | Next Page >