Search Results

Search found 6384 results on 256 pages for 'cgi parse qs'.

Page 86/256 | < Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >

  • python regex for repeating string

    - by Lars Nordin
    I am wanting to verify and then parse this string (in quotes): string = "start: c12354, c3456, 34526;" //Note that some codes begin with 'c' I would like to verify that the string starts with 'start:' and ends with ';' Afterward, I would like to have a regex parse out the strings. I tried the following python re code: regx = r"V1 OIDs: (c?[0-9]+,?)+;" reg = re.compile(regx) matched = reg.search(string) print ' matched.groups()', matched.groups() I have tried different variations but I can either get the first or the last code but not a list of all three. Or should I abandon using a regex?

    Read the article

  • Validating XML with multiple XSDs in Java

    - by Arian
    Hello! I want to parse an XML file with Java and validate it in the same step against an XSD schema. An XML file may contain content of several schemas, like this: <outer xmlns="my.outer.namespace" xmlns:x="my.third.namespace"> <foo>hello</foo> <inner xmlns="my.inner.namespace"> <bar x:id="bar">world</bar> </inner> </outer> Given a namespace the corresponding xsd file can be provided, but the used namespaces are unknown before parsing. If a schema defines default values for attributes, I also want to know that somehow. I was able to validate a file if the schemas are known, I was able to parse a file without validation and I implemented a LSResourceResolver. However, I can't get all of it working together. How do I have to set up my (SAX) parser?

    Read the article

  • SQL error C# - Parameter already defined

    - by jakesankey
    Hey there. I have a c# application that parses txt files and imports the data from them into a sql db. I was using sqlite and am now working on porting it to sql server. It was working fine with sqlite but now with sql i am getting an error when it is processing the files. It added the first row of data to the db and then says "parameter @PartNumber has already been declared. Variable names must be unique within a batch or stored procedure". Here is my whole code and SQL table layout ... the error comes at the last insertCommand.ExecuteNonQuery() instance at the end of the code... SQL TABLE: CREATE TABLE Import ( RowId int PRIMARY KEY IDENTITY, PartNumber text, CMMNumber text, Date text, FeatType text, FeatName text, Value text, Actual text, Nominal text, Dev text, TolMin text, TolPlus text, OutOfTol text, FileName text ); CODE: using System; using System.Data; using System.Data.SQLite; using System.IO; using System.Text.RegularExpressions; using System.Threading; using System.Collections.Generic; using System.Linq; using System.Data.SqlClient; namespace JohnDeereCMMDataParser { internal class Program { public static List<string> GetImportedFileList() { List<string> ImportedFiles = new List<string>(); using (SqlConnection connect = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { connect.Open(); using (SqlCommand fmd = connect.CreateCommand()) { fmd.CommandText = @"IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT DISTINCT FileName FROM Import; END"; fmd.CommandType = CommandType.Text; SqlDataReader r = fmd.ExecuteReader(); while (r.Read()) { ImportedFiles.Add(Convert.ToString(r["FileName"])); } } } return ImportedFiles; } private static void Main(string[] args) { Console.Title = "John Deere CMM Data Parser"; Console.WriteLine("Preparing CMM Data Parser... done"); Console.WriteLine("Scanning for new CMM data... done"); Console.ForegroundColor = ConsoleColor.Gray; using (SqlConnection con = new SqlConnection(@"Server=FRXSQLDEV;Database=RX_CMMData;Integrated Security=YES")) { con.Open(); using (SqlCommand insertCommand = con.CreateCommand()) { SqlCommand cmdd = con.CreateCommand(); string[] files = Directory.GetFiles(@"C:\Documents and Settings\js91162\Desktop\", "R303717*.txt*", SearchOption.AllDirectories); List<string> ImportedFiles = GetImportedFileList(); foreach (string file in files.Except(ImportedFiles)) { string FileNameExt1 = Path.GetFileName(file); cmdd.CommandText = @" IF (EXISTS (SELECT * FROM INFORMATION_SCHEMA.TABLES WHERE TABLE_SCHEMA = 'RX_CMMData' AND TABLE_NAME = 'Import')) BEGIN SELECT COUNT(*) FROM Import WHERE FileName = @FileExt; END"; cmdd.Parameters.Add(new SqlParameter("@FileExt", FileNameExt1)); int count = Convert.ToInt32(cmdd.ExecuteScalar()); con.Close(); con.Open(); if (count == 0) { Console.WriteLine("Parsing CMM data for SQL database... Please wait."); insertCommand.CommandText = @" INSERT INTO Import (FeatType, FeatName, Value, Actual, Nominal, Dev, TolMin, TolPlus, OutOfTol, PartNumber, CMMNumber, Date, FileName) VALUES (@FeatType, @FeatName, @Value, @Actual, @Nominal, @Dev, @TolMin, @TolPlus, @OutOfTol, @PartNumber, @CMMNumber, @Date, @FileName);"; insertCommand.Parameters.Add(new SqlParameter("@FeatType", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@FeatName", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Value", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Actual", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Nominal", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@Dev", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolMin", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@TolPlus", DbType.Decimal)); insertCommand.Parameters.Add(new SqlParameter("@OutOfTol", DbType.Decimal)); string FileNameExt = Path.GetFullPath(file); string RNumber = Path.GetFileNameWithoutExtension(file); string RNumberE = RNumber.Split('_')[0]; string RNumberD = RNumber.Split('_')[1]; string RNumberDate = RNumber.Split('_')[2]; DateTime dateTime = DateTime.ParseExact(RNumberDate, "yyyyMMdd", Thread.CurrentThread.CurrentCulture); string cmmDate = dateTime.ToString("dd-MMM-yyyy"); string[] lines = File.ReadAllLines(file); bool parse = false; foreach (string tmpLine in lines) { string line = tmpLine.Trim(); if (!parse && line.StartsWith("Feat. Type,")) { parse = true; continue; } if (!parse || string.IsNullOrEmpty(line)) { continue; } Console.WriteLine(tmpLine); foreach (SqlParameter parameter in insertCommand.Parameters) { parameter.Value = null; } string[] values = line.Split(new[] { ',' }); for (int i = 0; i < values.Length - 1; i++) { SqlParameter param = insertCommand.Parameters[i]; if (param.DbType == DbType.Decimal) { decimal value; param.Value = decimal.TryParse(values[i], out value) ? value : 0; } else { param.Value = values[i]; } } insertCommand.Parameters.Add(new SqlParameter("@PartNumber", RNumberE)); insertCommand.Parameters.Add(new SqlParameter("@CMMNumber", RNumberD)); insertCommand.Parameters.Add(new SqlParameter("@Date", cmmDate)); insertCommand.Parameters.Add(new SqlParameter("@FileName", FileNameExt)); // insertCommand.ExecuteNonQuery(); } } } Console.WriteLine("CMM data successfully imported to SQL database..."); } con.Close(); } } } }

    Read the article

  • Parsing a text file with a fixed format in Java

    - by EugeneP
    Suppose I know a text file format, say, each line contains 4 fields like this: firstword secondword thirdword fourthword firstword2 secondword2 thirdword2 fourthword2 ... and I need to read it fully into memory I can use this approach: open a text file while not EOF read line by line split each line by a space create a new object with four fields extracted from each line add this object to a Set Ok, but is there anything better, a special 3-rd party Java library? So that we could define the structure of each text line beforehand and parse the file with some function thirdpartylib.setInputTextFileFormat("format.xml"); thirdpartylib.parse(Set, "pathToFile") ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Ruby function similar to parse_str in php?

    - by jolierouge
    Hi, I need to parse a string like this: a[metadata][][name]=dont|do|this&a[name]=Hello World&a[metadata][][value]=i|really|mean it CGI::parse gives me this: {"a[name]"=["Hello World"], "a[metadata][][name]"=["dont|do|this"], "a[metadata][][value]"=["i|really|mean it"]} I would like something like what PHP does with parse_str, which when given the same string does this: Array ( [a] => Array ( [metadata] => Array ( [0] => Array ( [name] => dont|do|this ) [1] => Array ( [value] => i|really|mean it ) ) [name] => Hello World )) Any help would be awesome. Thanks!

    Read the article

  • Lexical Analyzer(Scanner) for Language G by using C/C++

    - by udsha
    int a = 20; int b =30; float c; c = 20 + a; if(c) { a = c*b + a; } else { c = a - b + c; } use C++ / C to Implement a Lexer. 1. Create Unambiguous grammer for language G. 2. Create Lexical Analyzer for Language G. 3. It should identified tokens and lexemes for that language. 4. create a parse tree. 5. to use attribute grammer on a parse tree the values of the intrinsic attributes should be available on the symbol table.

    Read the article

  • insert a date in mysql database

    - by kawtousse
    I use a jquery datepicker then i read it in my servlet like that: String dateimput=request.getParameter("datepicker");//1 then parse it like that: System.out.println("datepicker:" +dateimput); DateFormat df = new SimpleDateFormat("MM/dd/yyyy"); java.util.Date dt = null; try { dt = df.parse(dateimput); System.out.println("date imput parssé1 est:" +dt); System.out.println("date imput parsée2 est:" +df.format(dt)); } catch (ParseException e) { e.printStackTrace(); } and insert query like that: String query = "Insert into dailytimesheet(trackingDate,activity,projectCode) values ("+df.format(dt)+", \""+activity+"\" ,\""+projet+"\")"; it pass successfully untill now but if i check the record inserted i found the date: 01/01/0001 00:00:00 l've tried to fix it but it still a mess for me.

    Read the article

  • Invalid ADTS sampling_frequency_index and channel_configuration why?

    - by Moto
    Hello all, I hope someone can direct me on the right path before I put a lot of time and effort on this. I'm currently trying to parse an AAC+ frame to get information such as number of channels and sample frequency. So it seems that we can simply get this information from the ADTS header but most of the time this information is inaccurate. So the question is: -Why is this data inaccurate? What is the meaning of the ADTS header channel and sample freq? Should I rely on it? -Should I parse further down the frame to get this information? FYI, the AAC+ raw data is coming from streaming servers... Thanks for the help! -Moto

    Read the article

  • RegEx (or other) parsing of script

    - by jpmyob
    RegEx is powerful - it is tru but I have a little - query for you I want to parse out the FUNCTIONS from some old code in JS...however - I am RegEx handicapped (mentally deficient in grasping the subtleties).. the issue that makes me NOT EVEN TRY - is two fold - 1) myVar = function(x){ yadda yadda } AND function myVar(x) { yadda yadda } are found throuout - COLD I write a parser for each? sure - but that seems inefficient... 2) MANY things may reside INSIDE the {} including OTHER sets of {} or other Functions(){} block of text... HELP - does anyone have, or know of some code parsing snippets or examples that will parse out the info I want to collect? Thanks

    Read the article

  • Translate parse_git_branch function to zsh from bash (for prompt)

    - by yar
    I am using this function in Bash function parse_git_branch { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^${IFS}]*)" if [[ ! ${git_status}} =~ "working directory clean" ]]; then state="*" fi # add an else if or two here if you want to get more specific if [[ ${git_status} =~ ${pattern} ]]; then branch=${BASH_REMATCH[1]} echo "(${branch}${state})" fi } but I'm determined to use zsh. While I can use this perfectly as a shell script (even without a shebang) in my .zshrc the error is a parse error on this line if [[ ! ${git_status}}... What do I need to do to get it ready for zshell? Edit: The "actual error" I'm getting is " parse error near } and it refers to the line with the strange double }}, which works on Bash. Edit: Here's the final code, just for fun: parse_git_branch() { git_status="$(git status 2> /dev/null)" pattern="^# On branch ([^[:space:]]*)" if [[ ! ${git_status} =~ "working directory clean" ]]; then state="*" fi if [[ ${git_status} =~ ${pattern} ]]; then branch=${match[1]} echo "(${branch}${state})" fi } setopt PROMPT_SUBST PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Thanks to everybody for your patience and help. Edit: The best answer has schooled us all: git status is porcelain (UI). Good scripting goes against GIT plumbing. Here's the final function: parse_git_branch() { in_wd="$(git rev-parse --is-inside-work-tree 2>/dev/null)" || return test "$in_wd" = true || return state='' git diff-index HEAD --quiet 2>/dev/null || state='*' branch="$(git symbolic-ref HEAD 2>/dev/null)" test -z "$branch" && branch='<detached-HEAD>' echo "(${branch#refs/heads/}${state})" } PROMPT='$PR_GREEN%n@$PR_GREEN%m%u$PR_NO_COLOR:$PR_BLUE%2c$PR_NO_COLOR%(!.#.$)' RPROMPT='$PR_GREEN$(parse_git_branch)$PR_NO_COLOR' Note that only the prompt is zsh-specific. In Bash it would be your prompt plus "\$(parse_git_branch)". This might be slower (more calls to GIT, but that's an empirical question) but it won't be broken by changes in GIT (they don't change the plumbing). And that is very important for a good script moving forward. Days Later: Ugh, it turns out that diff-index HEAD is NOT the same as checking status against working directory clean. So will this mean another plumbing call? I surely don't have time/expertise to write my own porcelain....

    Read the article

  • How do you convert date taken from a bash script to milliseconds in java program?

    - by Matt Pascoe
    I am writing a piece of code in java that needs to take a time sent from a bash script and parse the time to milliseconds. When I check the millisecond conversion on the date everything is correct except for the month I have sent which is January instead of March. Here is the variable I create in the bash script, which later in the script I pass to the java program: TIME=`date +%m%d%Y_%H:%M:%S` Here is the java code which parses the time to milliseconds: String dt = "${scriptstart}"; java.text.SimpleDateFormat scriptStart = new java.text.SimpleDateFormat("MMDDyyyy_HH:mm:ss"); long start = scriptStart.parse(dt).getTime(); The goal of this statement is to find the elapsed time between the start of the script and the current system time. To troubleshoot this I printed out the two: System Time = 1269898069496 (converted = Mon Mar 29 2010 16:27:49 GMT-0500 (Central Daylight Time)) Script Start = 03292010_16:27:45 Script Start in Milli = 1264804065000 (Converted = Fri Jan 29 2010 16:27:45 GMT-0600 (Central Standard Time))

    Read the article

  • In BASH how can i find my system on active internet interface, what is the upload speed?

    - by YumYumYum
    I am trying to write an TUI bandwidth trace application which on query can instantly tell me, that my download and upload speed is XXXX. I have figured out that download i can use with wget and parse it using BASH, but how do i get the upload speed? Example of download parse method: 1) Remote download : wget http://x.x.com:7007/files/software/vnc.zip Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 573K/s in 2.7s 2012-03-24 11:35:22 (573 KB/s) - `vnc.zip' saved [1594344/1594344] 2) Local download tells Length: 1594344 (1.5M) [application/zip] Saving to: `vnc.zip' 100%[==================================================================>] 1,594,344 --.-K/s in 0.1s 2012-03-24 06:43:04 (11.4 MB/s) - `vnc.zip' saved [1594344/1594344]

    Read the article

  • Backbone.js - Getting JSON back from url

    - by Brian
    While trying to learn Backbone.js, I've been trying to grab the content of a JSON file using the following code: (function($){ var MyModel = Backbone.Model.extend(); var MyCollection = Backbone.Collection.extend({ model : MyModel, url: '/backbone/data.json', parse: function(response) { console.log(response); return response; } }); var stuff = new MyCollection; console.log(stuff.fetch()); console.log(stuff.toJSON()); })(jQuery) 'stuff.fetch()' returns the entire object (with the data I'm after in responseText), 'stuff.toJSON' returns nothing ([]), but the console in the parse method is returning exactly what I want (the json object of my data). I feel like I'm missing something obvious here, but I just can't seem to figure it out why I can't get the right data out. Could someone point me in the right direction or show me what I'm doing wrong here? Am I using a model for the wrong thing?

    Read the article

  • Having trouble reading XML file from Windows server. Works on Linux

    - by DuFF14
    I'm parsing an XML file in an android app. My success varies depending upon where the file is hosted. After hosting the file on 4 different servers (2 Linux, 2 Windows), I discovered that when the xml is hosted on a Linux server, the app works. When it's hosted on a Windows server, I am unable to parse correctly. Instead of reading the expected xml tags, it reads HTML tags (, , , etc). I'm not sure why it doesn't work on Windows servers, or if that is even the issue and not just a coincidence. Any help is appreciated. Thanks. Here is my code: private void getXmlData() { HttpClient httpclient = new DefaultHttpClient(); String url = XML_URL; HttpPost httppost = new HttpPost(url); HttpResponse response = httpclient.execute(httppost); SaxParser saxParser = new SaxParser(response); parsedXML = saxParser.parse(); }

    Read the article

  • Creating objects makes the VM faster?

    - by Sudhir Jonathan
    Look at this piece of code: MessageParser parser = new MessageParser(); for (int i = 0; i < 10000; i++) { parser.parse(plainMessage, user); } For some reason, it runs SLOWER (by about 100ms) than for (int i = 0; i < 10000; i++) { MessageParser parser = new MessageParser(); parser.parse(plainMessage, user); } Any ideas why? The tests were repeated a lot of times, so it wasn't just random. How could creating an object 10000 times be faster than creating it once?

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • XmlNode.InnerText

    - by Jonathan.Peppers
    We have XML like so: <Example> <Node>Some text here <ChildNode>Child 1</ChildNode> <ChildNode>Child 2</ChildNode> </Node> </Example> We are using XmlDocument to parse this. When we have the XmlNode of the Node element, XmlNode.InnerText returns us this: "Some text hereChild 1Child2" How can we get the inner text of the Node element without the child nodes' inner text? We don't really want to use any Regex or string splitting to accomplish this. Note: We also don't want to switch to using a different set of classes to parse this XML, it would be too much of a code change.

    Read the article

  • Perl module for parsing natural language time duration specifications (similar to the "at" command)?

    - by Ryan Thompson
    I'm writing a perl script that takes a "duration" option, and I'd like to be able to specify this duration in a fairly flexible manner, as opposed to only taking a single unit (e.g. number of seconds). The UNIX at command implements this kind of behavior, by allowing specifications such as "now + 3 hours + 2 days". For my program, the "now" part is implied, so I just want to parse the stuff after the plus sign. (Note: the at command also parses exact date specifications, but I only want to parse durations.) Is there a perl module for parsing duration specifications like this? I don't need the exact syntax accepted by at, just any reasonable syntax for specifying time durations. Edit: Basically, I want something like DateTime::Format::Flexible for durations instead of dates.

    Read the article

  • What is the right method for parsing a blog post?

    - by Zedwal
    Hi guys, Need a guide line .... I am trying to write a personal blog. What is the standard structure for for input for the post. I am trying the format like: This is the simple text And I am [b] bold text[/b]. This is the code part: [code lang=java] public static void main (String args[]) { System.out.println("Hello World!"); } [/code] Is this the right way to store post in the database? And What is the right method to parse this kind of post? Shall I use regular expression to parse this or there is another standard for this. If the above mentioned format is not the right way for storage, then what it could be? Thanks

    Read the article

  • Repeating a object that only occurs couple of times and has different values with htmlagilitypack c#.

    - by dtd
    I have a problem I cant seem to solve here. Lets say I have some html like beneth here that I want to parse. All this html is within one list on the page. And the names repeat themself like in the example I wrote. <li class = "seperator"> a date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> <li class = "seperator"> a new date </li> <li class = "lol"> some text </li> <li class = "seperator"> a nother new date </li> <li class = "lol"> some text </li> <li class = "lol"> some text </li> I did manage to use htmlagility pack to parse every li object seperate, and almost formating it how I want. My print atm looks something like this: "a date" "some text" "some text" "some text" "some text" "a new date" "some text" "a nother new date " "some text" "some text" "some text" What I want to achive: "a date" "some text" "a date" "some text" "a date" "some text" "a date" "some text" "a new date" "some text" "a nother new date " "some text" "a nother new date " "some text" "a nother new date " "some text" But the problem is that beneath every seperator, the count of every lol object may vary. So one day, the webpage may have one lol object beneth date 1, and the next day it may have 10 lol objects. So I am woundering if there is an smart/easy way to somehow count the number of lol objects in between the seperators. Or if there is another way to figure this out? Within for example htmlagilitypack. And yes, I need the correct date in front of every lol object, not just infront the first one. This would have been a pice of cake if the seperator class would have ended beneath the last lol object, but sadly that is not the case... I dont think that I need to paste my code here, but basicly what I do is to parse the page, extract the seperators and lol objects and add them to a list, where I split them up to seperator and lol objects. Then I print it out to a file and since the seperator only occure 3 times(in the example) I will only get out 3 seperate dates.

    Read the article

  • How do i know in the detail view what cell in tableview was selected?

    - by Daniel Rotaru
    how can i know what tableview cell was selected?(being in the detail view) The problem is that. I have an table view controller. Here are parsed from the internet entries to the table. So it's a dynamic tabe view that loads from internet. I will not know how many entries will be in the table so i will not know what details view to call when i click a row. So i have maked one view. This view contains an calendar. On this calendar(wich is the detail iew) i will parse data from internet depending on the selected row. For exemple: i have table: entry 1, entry 2,entry 3,entry 4 When i click entry 2 i need to call a php with the argument entry 2. The php will know what entry on the table i have selected and will generate me the correct xml that i will parse. Here is my tableview didSelectRow function: - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic -- create and push a new view controller if(bdvController == nil) bdvController = [[BookDetailViewController alloc] initWithNibName:@"BookDetailView" bundle:[NSBundle mainBundle]]; Villa *aVilla = [appDelegate.villas objectAtIndex:indexPath.row]; [self.navigationController pushViewController:bdvController animated:YES] And here is my self view function on detailviewcontroller: -(void)loadView { [super loadView]; self.title=@"Month" UIBarButtonItem *addButtonItem = [[UIBarButtonItem alloc] initWithTitle:@"ListView" style:UIBarButtonItemStyleDone target:self action:@selector(add:)]; self.navigationItem.rightBarButtonItem = addButtonItem; calendarView = [[[KLCalendarView alloc] initWithFrame:CGRectMake(0.0f, 0.0f, 320.0f, 373.0f) delegate:self] autorelease]; appDelegate1 = (XMLAppDelegate *)[[UIApplication sharedApplication] delegate]; myTableView=[[UITableView alloc]initWithFrame:CGRectMake(0, 260, 320, 160)style:UITableViewStylePlain]; myTableView.dataSource=self; myTableView.delegate=self; UIView *myHeaderView=[[UIView alloc]initWithFrame:CGRectMake(0, 0, myTableView.frame.size.width,2)]; myHeaderView.backgroundColor=[UIColor grayColor]; [myTableView setTableHeaderView:myHeaderView]; [self.view addSubview:myTableView]; [self.view addSubview:calendarView]; [self.view bringSubviewToFront:myTableView]; } I think that here in self load i need to make the if procedure.. If indexPath.row=x parse fisier.php?variabila=title_of_rowx but the question is how i know the indexPath variable?

    Read the article

  • Socket receive buffer size

    - by Kanishka
    Is there a way to determine the receive buffer size of a TCPIP socket in c#. I am sending a message to a server and expecting a response where I am not sure of the receive buffer size. IPEndPoint ipep = new IPEndPoint(IPAddress.Parse("192.125.125.226"),20060); Socket server = new Socket(AddressFamily.InterNetwork, SocketType.Stream, ProtocolType.Tcp); server.Connect(ipep); String OutStr= "49|50|48|48|224|48|129|1|0|0|128|0|0|0|0|0|4|0|0|32|49|50"; byte[] temp = OutStr.Split('|').Select(s => byte.Parse(s)).ToArray(); int byteCount = server.Send(temp); byte[] bytes = new byte[255]; int res=0; res = server.Receive(bytes); return Encoding.UTF8.GetString(bytes);

    Read the article

  • Convert UTC date to actual date and time

    - by evann
    I have a chart of bitcoin prices. I have the correct prices on the Y-axis, but I cannot get the correct time on the X-axis. The time shows up in a UTC format in my console. I am adding price and date to the series each iteration. I need to get the date of that particular result and find the YEAR, MONTH and DAY of that so I can put it in the right format. Any help is appreciated thanks. $.ajax({ url: "/chart/ajax_get_chart", // the URL of the controller action method dataType: "json", type: "GET", success: function (result) { var result = JSON.parse(result); series = []; for (var i = 0; i < result.length; i++) { tempArray = [parseFloat(result[i]['price'])]; tempDate = Date.parse(result[i]['date']); series.push(tempDate); series.push(tempArray); }

    Read the article

< Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >