Search Results

Search found 44965 results on 1799 pages for 'presenter first'.

Page 86/1799 | < Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >

  • Running 1 DC physically and a second virtually

    - by stead1984
    I plan to create my first DC and forest on a physical server, then I want to run a second DC on a virtual server that will replicate the first DC. I understand that this will provide redundancy for AD that if the first domain controller went down the second would resume until the first is back online. Would this work and how?

    Read the article

  • Webforms MVP Passive View - event handling

    - by ss2k
    Should the view have nothing event specific in its interface and call the presenter plain methods to handle events and not have any official EventHandlers? For instance // ASPX protected void OnSaveButtonClicked(object sender, EventArgs e) { _Presenter.OnSave(); } Or should the view have event EventHandlers defined in its interface and link those up explicitly to control events on the page // View public interface IView { ... event EventHandler Saved; ... } // ASPX Page implementing the view protected override void OnInit(EventArgs e) { base.OnInit(e); SaveButton.Click += delegate { Saved(this, e); }; } // Presenter internal Presenter(IView view,IRepository repository) { _view = view; _repository = repository; view.Saved += Save; } The second seems like a whole lot of plumbing code to add all over. My intention is to understand the benefits of each style and not just a blanket answer of which to use. My main goals is clarity and high value testability. Testability overall is important, but I wouldn't sacrifice design simplicity and clarity to be able to add another type of test that doesn't lead to too much gain over the test cases already possible with a simpler design. If a design choice does off more testability please include an example (pseudo code is fine) of the type of test it can now offer so I can make my decision if I value that type of extra test enough. Thanks!

    Read the article

  • Error compiling / linking e text editor on Linux

    - by jckdnk111
    The code compiles without too much complaint, but the last step fails with the error below. There is some discussion about it on the e forum, but still no answer. [LD] e ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x0): multiple definition of `_pcre_OP_lengths' .objs.release/cx_pcre_tables.o:(.rodata+0x0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x70): multiple definition of `_pcre_utf8_table1' .objs.release/cx_pcre_tables.o:(.rodata+0x70): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x88): multiple definition of `_pcre_utf8_table1_size' .objs.release/cx_pcre_tables.o:(.rodata+0x88): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x8c): multiple definition of `_pcre_utf8_table2' .objs.release/cx_pcre_tables.o:(.rodata+0x8c): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xa4): multiple definition of `_pcre_utf8_table3' .objs.release/cx_pcre_tables.o:(.rodata+0xa4): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0xc0): multiple definition of `_pcre_utf8_table4' .objs.release/cx_pcre_tables.o:(.rodata+0xc0): first defined here ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x180): multiple definition of `_pcre_utt_names' .objs.release/cx_pcre_tables.o:(.rodata+0x100): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt_names' changed from 657 in .objs.release/cx_pcre_tables.o to 740 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x480): multiple definition of `_pcre_utt' .objs.release/cx_pcre_tables.o:(.rodata+0x3a0): first defined here /usr/bin/ld: Warning: size of symbol `_pcre_utt' changed from 630 in .objs.release/cx_pcre_tables.o to 696 in ../external/out.release/lib/libpcre.a(pcre_tables.o) ../external/out.release/lib/libpcre.a(pcre_tables.o):(.rodata+0x738): multiple definition of `_pcre_utt_size' .objs.release/cx_pcre_tables.o:(.rodata+0x618): first defined here .objs.release/cx_pcre_exec.o: In function `match(doc_byte_iter, unsigned char const*, doc_byte_iter, int, match_data*, unsigned long, eptrblock*, int, unsigned int)': cx_pcre_exec.cpp:(.text+0x1c2a): undefined reference to `_pcre_ord2utf8(int, unsigned char*)' .objs.release/eauibook.o: In function `eAuiNotebook::LoadPerspective(wxString const&)': eauibook.cpp:(.text+0x9ad): undefined reference to `wxTabFrame::SetTabCtrlHeight(int)' .objs.release/PreviewDlg.o: In function `global constructors keyed to _ZN10PreviewDlg13sm_eventTableE': PreviewDlg.cpp:(.text+0x11b2): undefined reference to `wxEVT_WEB_TITLECHANGE' PreviewDlg.cpp:(.text+0x11ee): undefined reference to `wxEVT_WEB_DOMCONTENTLOADED' .objs.release/PreviewDlg.o: In function `PreviewDlg::RefreshBrowser(PreviewDlg::cxUpdateMode)': PreviewDlg.cpp:(.text+0x2a47): undefined reference to `wxWebControl::OpenURI(wxString const&, unsigned int, wxWebPostData*, bool)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnWebDocumentComplete(wxWebEvent&)': PreviewDlg.cpp:(.text+0x3259): undefined reference to `wxWebControl::GetCurrentURI() const' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x4984): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x49c5): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x562f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::PreviewDlg(EditorFrame&)': PreviewDlg.cpp:(.text+0x68e4): undefined reference to `wxWebControl::IsInitialized()' PreviewDlg.cpp:(.text+0x6925): undefined reference to `wxWebControl::wxWebControl(wxWindow*, int, wxPoint const&, wxSize const&)' PreviewDlg.cpp:(.text+0x758f): undefined reference to `wxWebControl::InitEngine(wxString const&)' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonForward(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x132): undefined reference to `wxWebControl::GoForward()' .objs.release/PreviewDlg.o: In function `PreviewDlg::OnButtonBack(wxCommandEvent&)': PreviewDlg.cpp:(.text+0x182): undefined reference to `wxWebControl::GoBack()' ../ecore/libecore.so(cxInternal.o): In function `cxInternal::MoveOldSettings(eSettings&)': cxInternal.cpp:(.text+0x4d29): undefined reference to `eSettings::SetPageSettings(unsigned int, wxString const&, doc_id, int, int, wxString const&, std::vector<unsigned int, std::allocator<unsigned int> > const&, std::vector<cxBookmark, std::allocator<cxBookmark> > const&, eSettings::SubPage)' collect2: ld returned 1 exit status make: *** [e] Error 1 EDIT: Forgot the link http://github.com/etexteditor/e

    Read the article

  • Haskell Parsec Numeration

    - by Martin
    I'm using Text.ParserCombinators.Parsec and Text.XHtml to parse an input like this: - First type A\n -- First type B\n - Second type A\n -- First type B\n --Second type B\n And my output should be: <h11 First type A\n</h1 <h21.1 First type B\n</h2 <h12 Second type A\n</h2 <h22.1 First type B\n</h2 <h22.2 Second type B\n</h2 I have come to this part, but I cannot get any further: title1= do{ ;(count 1 (char '-')) ;s <- many1 anyChar newline ;return (h1 << s) } title2= do{ ;(count 2 (char '--')) ;s <- many1 anyChar newline ;return (h1 << s) } text=do { ;many (choice [try(title1),try(title2)]) } main :: IO () main = do t putStr "Error: " print err Right x - putStrLn $ prettyHtml x This is ok, but it does not include the numbering. Any ideas? Thanks!

    Read the article

  • Specifying a no-indent for a list, with LaTeX

    - by Andreas Grech
    I have the following: This is just normal text... \begin{enumerate} \item First Item ?\\\\ This is the text of the first item \item Second Item ?\\\\ This is the text of the second item \end{enumerate} Which renders the following: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item I want to specify that the text of the items has no indentation. Basically, I want it to be rendered like such: This is just normal text... 1. First Item ? This is the text of the first item 2. Second Item ? This is the text of the second item How can I specify this form of no indentation?

    Read the article

  • How to Bind Data and manipulate it in a GridView with MVP

    - by DotNetDan
    I am new to the whole MVP thing and slowly getting my head around it all. The a problem I am having is how to stay consistent with the MVP methodology when populating GridViews (and ddls, but we will tackle that later). Is it okay to have it connected straight to an ObjectDataSourceID? To me this seems wrong because it bypasses all the separation of concerns MVP was made to do. So, with that said, how do I do it? How do I handle sorting (do I send over handler events to the presentation layer, if so how does that look in code)? Right now I have a GridView that has no sorting. Code below. ListCustomers.aspx.cs: public partial class ListCustomers : System.Web.UI.Page, IlistCustomer { protected void Page_Load(object sender, EventArgs e) { //On every page load, create a new presenter object with //constructor recieving the // page's IlistCustomer view ListUserPresenter ListUser_P = new ListUserPresenter(this); //Call the presenter's PopulateList to bind data to gridview ListUser_P.PopulateList(); } GridView IlistCustomer.UserGridView { get { return gvUsers; } set { gvUsers = value; } } } Interface ( IlistCustomer.cs): is this bad sending in an entire Gridview control? public interface IlistCustomer { GridView UserGridView { set; get; } } The Presenter (ListUserPresenter.cs): public class ListUserPresenter { private IlistCustomer view_listCustomer; private GridView gvListCustomers; private DataTable objDT; public ListUserPresenter( IlistCustomer view) { //Handle an error if an Ilistcustomer was not sent in) if (view == null) throw new ArgumentNullException("ListCustomer View cannot be blank"); //Set local IlistCustomer interface view this.view_listCustomer = view; } public void PopulateList() { //Fill local Gridview with local IlistCustomer gvListCustomers = view_listCustomer.UserGridView; // Instantiate a new CustomerBusiness object to contact database CustomerBusiness CustomerBiz = new CustomerBusiness(); //Call CustomerBusiness's GetListCustomers to fill DataTable object objDT = CustomerBiz.GetListCustomers(); //Bind DataTable to gridview; gvListCustomers.DataSource = objDT; gvListCustomers.DataBind(); } }

    Read the article

  • php compare array keys, not values

    - by user271619
    I am successfully using the array_key_exists(), as described by php.net Example: <?php $search_array = array('first' => 1, 'second' => 4); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> But, take out the values, and it doesn't work. <?php $search_array = array('first', 'second'); if (array_key_exists('first', $search_array)) { echo "The 'first' element is in the array"; } ?> Not sure how to only compare 2 arrays by their keys only.

    Read the article

  • Record the timestamps of slide changes during a live Powerpoint presentation?

    - by StackedCrooked
    I am planning to implement a lecture capture solution. One of the requirements is to record both the presenter and the slideshow. The presenter is recorded with a videocamera obviously, and the slideshow will probably be captured using a tool like Camtasia. Now during playback three components are visible: the presenter, the slides and a table of contents. Clicking a chapter title in the TOC causes the video to navigate to the corresponding section. This means that a mapping must be made between chapter titles and their timestamps in the video. Usually a change of topic is accompanied with a slide change in the Powerpoint presentation. So the timestamps could be deduced from the slidechanges. However, this requires me to detect slide changes during the live presentation. And I don't know how to do that. Anyone here knows how to do detect slide changes? Is there a Powerpoint API where I can connect event handlers or something like that? I'd greatly appreciate your help! Edit This issue is no longer relevant for my current work so this question will not be updated by me. However, you are still free to help others by posting your answers/insights here.

    Read the article

  • Browser back button broken between hidden div's

    - by Linda
    First of all, these pages will never be on the web but will be in internal memory. They are a group of linked documents---an ebook. http://www.anmldr.com/testdivs When I click on the link in the first div, the second div becomes visible and the first div is hidden. The problem is with the browser's back button. If you then click on the back button, the URL updates but the first div does not show again. How can I correct the back button so that the first div shows? The link from the second div to the first div works fine but it is the browser back button that I do not know how to work with. Thanks, Linda P.S. These are using CSS3 so it is better to use a WebKit based browser.

    Read the article

  • Jquery load DIV inside another DIV at same page

    - by Sergio
    HTML: <div class="someclass" rel="first">text 1</div> <div class="someclass" rel="second">text 2</div></div></div> <div class="info_ly">here is some text</div> <div class="first" > the first DIV </div> <div class="second" > the second DIV </div> CSS: .first{ display:none} .second{ display:none} Jquery: $(".someclass").click(function() { $(".info_ly").html($(this).attr('rel')); }); I want to call and load the "rel" DIV inside "info_ly" DIV. With this Jquery code I get only text "first" or "second" inside "info_ly" DIV. How can I load the DIV with the class "first" or DIV with the class "second" inside "info_ly" DIV?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Help with this reg. exp. in PHP

    - by Jonathan
    Hi, i don't know about regular expressions, I asked here for one that: gets either anything up to the first parenthesis/colon or the first word inside the first parenthesis. This was the answer: preg_match('/(?:^[^(:]+|(?<=^\\()[^\\s)]+)/', $var, $match); I need an improvement, I need to get either anything up to the first parenthesis/colon/quotation marks or the first word inside the first parenthesis. So if I have something like: $var = 'story "The Town in Hell"s Backyard'; // I get this: $match = 'story'; $var = "screenplay (based on)"; // I get this: $match = 'screenplay'; $var = "(play)"; // I get this: $match = 'play'; $var = "original screen"; // I get this: $match = 'original screen'; Thanks!

    Read the article

  • Why has my computer started to make noises when I turn it on after I put it into sleep mode for the first time a week ago?

    - by Acid2
    I would usually have my pc on all day and fully shut it down at night time before I went to bed. I decided to put it into sleep mode instead the other day and everything was fine but when I woke it from sleep, I was presented with the blue screen of death and it started with some weird noise that sounded like some spinning part was off balance or possibly hitting something periodically. Sounds like it could be a fan or maybe the HDD. I'm not sure why sleep mode would mess up the hardware. Anyway, now sometimes, randomly, when I turn my computer on from a previous shut down, I still get to hear the noise but the start-up is normal. Sometimes I don't hear anything for the entire duration while I have it on and sometimes it goes away after a few minutes and sometimes it doesn't and I have to restart, like it isn't going away right now. I can hear the noise as I type this. Anyone got possible solutions? I don't want to open the system and mess up other stuff. I'm also not sure if I should take it somewhere to have it fixed - it might not make the noise then and work like normal and nothing would seem like needing to be fixed. Add: I'm running Windows 7, if that's of any relevance.

    Read the article

  • DOM class injection in PHP

    - by Adam Kiss
    idea Via jQuery, I was able to mark all :first-child and :last-child elements in document (well, almost all :)) with class first which could I later style (i.e. first li in ul#navigation would be easily adressable as ul#navigation .first). I used following code: var $f = $('*:first-child') $f.addClass('first'); var $l = $('body *:last-child') $l.addClass('last'); question Now, my question is if it's possible to do the same via php, so non-JS users/gadgets could have the same effects and additional styling and also it would be less overkill on browser. So, is it possible to capture output, parse it as html and inject this class easily in php?

    Read the article

  • PHP: Is there an elegant way to foreach through multiple items (groups) at a time?

    - by acheong87
    Given an array of N items: $arr = array('a', 'b', 'c', 'd', 'e', 'f'); What's the most elegant way to loop through in groups of M items (assuming N is divisible by M)? I tried foreach (array_chunk($arr, 2) as list($first, $second)) { // do stuff with $first and $second } but this resulted in a syntax error. In other words, I want to emulate what in Tcl would look like this: set arr [a b c d e f] foreach {first second} $arr { // do stuff with $first and $second } For now I've resorted to the obvious measure: foreach (array_chunk($arr, 2) as $group) { $first = $group[0]; $second = $group[1]; // do stuff with $first and $second } But I'm hoping someone has a more elegant method...

    Read the article

  • Excel file reading with 2007 office connection string.

    - by p-vasuu
    Actually in my system having 2007 office then i am reading the 2003 .xls file with using the 2007 connection string string ConnectionString = "Provider=Microsoft.ACE.OLEDB.12.0;Data Source=" + Filename + ";Extended Properties=\"Excel 8.0;HDR=YES;\""; data is not reading. But if the first row first column data length is lessthen 255 then the following first columns data is cutting up to 255 character. If the First row first column is morethan the 255 character then the following first columns data is reading fine. Is there any back word computability is there?

    Read the article

  • recursively reverse linked list.

    - by Amanda
    I am implementing a function to recursively reverse a linked-list, but getting seg-fault. typedef struct _node { int data; struct _node *next; } Node, *NodeP; NodeP recursiveReverseList(NodeP first){ if(first == NULL) return NULL; if(first->next == NULL) return head; NodeP rest = recursiveReverseList(head->next); rest->next = first; first->next = NULL; return first; } Can you please help. P.S. The iterative version is working fine though. Its not homework. Just practicing C.

    Read the article

  • C++ : Swapping template class elements of different types?

    - by metamemetics
    template< class T1, class T2 > class Pair { T1 first; T2 second; }; I'm being asked to write a swap() method so that the first element becomes the second and the second the first. I have: Pair<T2,T1> swap() { return Pair<T2,T1>(second, first); } But this returns a new object rather than swapping, where I think it needs to be a void method that changes its own data members. Is this possible to do since T1 and T2 are potentially different class types? In other words I can't simply set temp=first, first=second, second=temp because it would try to convert them to different types. I'm not sure why you would potentially want to have a template object that changes order of its types as it seems that would cause confusion but that appears to be what I'm being asked to do.

    Read the article

  • How to check whether iterators form a contiguous memory zone?

    - by Vincent
    I currently have the following function to read an array or a vector of raw data (_readStream is a std::ifstream) : template<typename IteratorType> inline bool MyClass::readRawData( const IteratorType& first, const IteratorType& last, typename std::iterator_traits<IteratorType>::iterator_category* = nullptr ) { _readStream.read(reinterpret_cast<char*>(&*first), (last-first)*sizeof(*first)); return _readStream.good(); } First question : does this function seem ok for you ? As we read directly a block of memory, it will only work if the memory block from first to last is contiguous in memory. How to check that ?

    Read the article

  • When the user first visits the page I want all the checkboxes to be checked in my index page. Below is the code from my controller and index.html.haml

    - by user1760920
    I want the checkbox to be checked when the user visits the page for the first time. -# This file is app/views/movies/index.html.haml %h1 All Movies = form_tag movies_path, :method => :get, :id => 'ratings_form' do Include: - @all_ratings.each do |rating| = rating = check_box_tag "ratings[#{rating}]", "1", @checked_ratings.include?(rating), :id => "ratings_#{rating}", = submit_tag 'Refresh', :id => 'ratings_submit' %table#movies %thead %tr %th{:class => ("hilite" if @sort == "title")}= link_to "Movie Title", movies_path( :sort => "title", :ratings => @checked_ratings), :id => "title_header" %th Rating %th{:class => ("hilite" if @sort == "release_date")}= link_to "Release Date", movies_path( :sort => "release_date", :ratings => @checked_ratings), :id => "release_date_header" %th More Info %tbody - @movies.each do |movie| %tr %td= movie.title %td= movie.rating %td= movie.release_date %td= link_to "More about #{movie.title}", movie_path(movie) = link_to 'Add new movie', new_movie_path #This is my Controller class MoviesController < ApplicationController def show id = params[:id] # retrieve movie ID from URI route @movie = Movie.find(id) # look up movie by unique ID # will render app/views/movies/show.<extension> by default end def index #get all the ratings available @all_ratings = Movie.all_ratings @checked_ratings = (params[:ratings].present? ? params[:ratings] : []) @sort = params[:sort] @movies = Movie.scoped if @sort && Movie.attribute_names.include?(@sort) @movies = @movies.order @sort end id @checked_ratings.empty? @checked_ratings = @all_ratings end unless @checked_ratings.empty? @movies = @movies.where :rating => @checked_ratings.keys end end def new # default: render 'new' template end def create @movie = Movie.create!(params[:movie]) flash[:notice] = "#{@movie.title} was successfully created." redirect_to movies_path end def edit @movie = Movie.find params[:id] end def update @movie = Movie.find params[:id] @movie.update_attributes!(params[:movie]) flash[:notice] = "#{@movie.title} was successfully updated." redirect_to movie_path(@movie) end def destroy @movie = Movie.find(params[:id]) @movie.destroy flash[:notice] = "Movie '#{@movie.title}' deleted." redirect_to movies_path end end In the controller, I set the @checked_rating to be @all_rating if the @checked.rating is empty but it does not do anything. I tried putting :checked = true in the index.html.haml on the check_box_tag but that makes the checkboxes checked everytime the page is refreshed. Everytime I check a particular checkbox and hit refresh button the page loads with all the checkboxes checked. Please help me with this. Thank you in Advance.

    Read the article

  • Program crash on deque from queue

    - by SwedishGit
    My first question asked here, so please excuse if I fail to include something... I'm working on a homework project, which basically consists of creating a "Jukebox" (importing/exporting albums from txt files, creating and "playing" a playlist, etc.). I've become stuck on one point: When "playing" the playlist, which consists of a self-made Queue, a copy of it is made from which songs are dequeued and printed out with a time delay. This appears to run fine on the first run through the program, but if the "play" option is chosen again (with the same playlist, created from a different menu option), it crashes before managing to print the first song. It also crashes if creating a new playlist, but then it manages to print some songs (seem to depend on the number of songs in the first/new playlists...) before crashing. With printouts I've been able to track the crashing down to being on the "item = n-data" call in the deque function... but can't get my head around why this would crash. Below is the code I think should be relevant... let me know if there are other parts that would help if I include. Edit: The Debug Error shown on crash is: R6010 abort() has been called The method to play from the playlist: void Jukebox::playList() { if(songList.getNodes() > 0) { Queue tmpList(songList); Song tmpSong; while(tmpList.deque(tmpSong)) { clock_t temp; temp = clock () + 2 * CLOCKS_PER_SEC ; while (clock() < temp) {} } } else cout << "There are no songs in the playlist!" << endl; } Queue: // Queue.h - Projekt-uppgift // Håkan Sjölin 2014-05-31 //----------------------------------------------------------------------------- #ifndef queue_h #define queue_h #include "Song.h" using namespace std; typedef Song Item; class Node; class Queue { private: Node *first; Node *last; int nodes; public: Queue():first(nullptr),last(nullptr),nodes(0){}; ~Queue(); void enque(Item item); bool deque(Item &item); int getNodes() const { return nodes; } void empty(); }; #endif // Queue.cpp - Projekt-uppgift // Håkan Sjölin 2014-05-31 //----------------------------------------------------------------------------- #include "queue.h" using namespace std; class Node { public: Node *next; Item data; Node (Node *n, Item newData) : next(n), data(newData) {} }; //------------------------------------------------------------------------------ // Funktionsdefinitioner för klassen Queue //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // Destruktor //------------------------------------------------------------------------------ Queue::~Queue() { while(first!=0) { Node *tmp = first; first = first->next; delete tmp; } } //------------------------------------------------------------------------------ // Lägg till data sist i kön //------------------------------------------------------------------------------ void Queue::enque(Item item) { Node *pNew = new Node(0,item); if(getNodes() < 1) first = pNew; else last->next = pNew; last = pNew; nodes++; } //------------------------------------------------------------------------------ // Ta bort data först i kön //------------------------------------------------------------------------------ bool Queue::deque(Item &item) { if(getNodes() < 1) return false; //cout << "deque: test2" << endl; Node *n = first; //cout << "deque: test3" << endl; //cout << "item = " << item << endl; //cout << "first = " << first << endl; //cout << "n->data = " << n->data << endl; item = n->data; //cout << "deque: test4" << endl; first = first->next; //delete n; nodes--; if(getNodes() < 1) // Kön BLEV tom last = nullptr; return true; } //------------------------------------------------------------------------------ // Töm kön //------------------------------------------------------------------------------ void Queue::empty() { while (getNodes() > 0) { Item item; deque(item); } } //------------------------------------------------------------------------------ Song: // Song.h - Projekt-uppgift // Håkan Sjölin 2014-05-15 //----------------------------------------------------------------------------- #ifndef song_h #define song_h #include "Time.h" #include <string> #include <iostream> using namespace std; class Song { private: string title; string artist; Time length; public: Song(); Song(string pTitle, string pArtist, Time pLength); // Setfunktioner void setTitle(string pTitle); void setArtist(string pArtist); void setLength(Time pLength); // Getfunktioner string getTitle() const { return title;} string getArtist() const { return artist;} Time getLength() const { return length;} }; ostream &operator<<(ostream &os, const Song &song); istream &operator>>(istream &is, Song &song); #endif // Song.cpp - Projekt-uppgift // Håkan Sjölin 2014-05-15 //----------------------------------------------------------------------------- #include "Song.h" #include "Constants.h" #include <iostream> //------------------------------------------------------------------------------ // Definiering av Songs medlemsfunktioner //------------------------------------------------------------------------------ // Fövald konstruktor //------------------------------------------------------------------------------ Song::Song() { } //------------------------------------------------------------------------------ // Initieringskonstruktor //------------------------------------------------------------------------------ Song::Song(string pTitle, string pArtist, Time pLength) { title = pTitle; artist = pArtist; length = pLength; } //------------------------------------------------------------------------------ // Setfunktioner //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // setTitle // Ange titel //------------------------------------------------------------------------------ void Song::setTitle(string pTitle) { title = pTitle; } //------------------------------------------------------------------------------ // setArtist // Ange artist //------------------------------------------------------------------------------ void Song::setArtist(string pArtist) { artist = pArtist; } //------------------------------------------------------------------------------ // setTitle // Ange titel //------------------------------------------------------------------------------ void Song::setLength(Time pLength) { length = pLength; } //--------------------------------------------------------------------------- // Överlagring av utskriftsoperatorn //--------------------------------------------------------------------------- ostream &operator<<(ostream &os, const Song &song) { os << song.getTitle() << DELIM << song.getArtist() << DELIM << song.getLength(); return os; } //--------------------------------------------------------------------------- // Överlagring av inmatningsoperatorn //--------------------------------------------------------------------------- istream &operator>>(istream &is, Song &song) { string tmpString; Time tmpLength; getline(is, tmpString, DELIM); song.setTitle(tmpString); getline(is, tmpString, DELIM); song.setArtist(tmpString); is >> tmpLength; is.get(); song.setLength(tmpLength); return is; } //--------------------------------------------------------------------------- Album: // Album.h - Projekt-uppgift // Håkan Sjölin 2014-05-17 //----------------------------------------------------------------------------- #ifndef album_h #define album_h #include "Song.h" #include <string> #include <vector> #include <iostream> using namespace std; class Album { private: string name; vector<Song> songs; public: Album(); Album(string pNameTitle, vector<Song> pSongs); // Setfunktioner void setName(string pName); // Getfunktioner string getName() const { return name;} vector<Song> getSongs() const { return songs;} int getNumberOfSongs() const { return songs.size();} Time getTotalTime() const; void addSong(Song pSong); bool operator<(const Album &album) const; }; ostream &operator<<(ostream &os, const Album &album); istream &operator>>(istream &is, Album &album); #endif // Album.cpp - Projekt-uppgift // Håkan Sjölin 2014-05-17 //----------------------------------------------------------------------------- #include "Album.h" #include "Constants.h" #include <iostream> #include <string> //------------------------------------------------------------------------------ // Definiering av Albums medlemsfunktioner //------------------------------------------------------------------------------ // Fövald konstruktor //------------------------------------------------------------------------------ Album::Album() { } //------------------------------------------------------------------------------ // Initieringskonstruktor //------------------------------------------------------------------------------ Album::Album(string pName, vector<Song> pSongs) { name = pName; songs = pSongs; } //------------------------------------------------------------------------------ // Setfunktioner //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // setName // Ange namn //------------------------------------------------------------------------------ void Album::setName(string pName) { name = pName; } //------------------------------------------------------------------------------ // addSong // Lägg till song //------------------------------------------------------------------------------ void Album::addSong(Song pSong) { songs.push_back(pSong); } //------------------------------------------------------------------------------ // getTotalTime // Returnera total speltid //------------------------------------------------------------------------------ Time Album::getTotalTime() const { Time tTime(0,0,0); for(Song s : songs) { tTime = tTime + s.getLength(); } return tTime; } //--------------------------------------------------------------------------- // Mindre än //--------------------------------------------------------------------------- bool Album::operator<(const Album &album) const { return getTotalTime() < album.getTotalTime(); } //--------------------------------------------------------------------------- // Överlagring av utskriftsoperatorn //--------------------------------------------------------------------------- ostream &operator<<(ostream &os, const Album &album) { os << album.getName() << endl; os << album.getNumberOfSongs() << endl; for (size_t i = 0; i < album.getSongs().size(); i++) os << album.getSongs().at(i) << endl; return os; } //--------------------------------------------------------------------------- // Överlagring av inmatningsoperatorn //--------------------------------------------------------------------------- istream &operator>>(istream &is, Album &album) { string tmpString; int tmpNumberOfSongs; Song tmpSong; getline(is, tmpString); album.setName(tmpString); is >> tmpNumberOfSongs; is.get(); for (int i = 0; i < tmpNumberOfSongs; i++) { is >> tmpSong; album.addSong(tmpSong); } return is; } //--------------------------------------------------------------------------- Time: // Time.h - Projekt-uppgift // Håkan Sjölin 2014-05-15 //----------------------------------------------------------------------------- #ifndef time_h #define time_h #include <iostream> using namespace std; class Time { private: int hours; int minutes; int seconds; public: Time(); Time(int pHour, int pMinute, int pSecond); // Setfunktioner void setHour(int pHour); void setMinute(int pMinute); void setSecond(int pSecond); // Getfunktioner int getHour() const { return hours;} int getMinute() const { return minutes;} int getSecond() const { return seconds;} Time operator+(const Time &time) const; bool operator==(const Time &time) const; bool operator<(const Time &time) const; }; ostream &operator<<(ostream &os, const Time &time); istream &operator>>(istream &is, Time &Time); #endif // Time.cpp - Projekt-uppgift // Håkan Sjölin 2014-05-15 //----------------------------------------------------------------------------- #include "Time.h" #include <iostream> //------------------------------------------------------------------------------ // Definiering av Times medlemsfunktioner //------------------------------------------------------------------------------ // Fövald konstruktor //------------------------------------------------------------------------------ Time::Time() { } //------------------------------------------------------------------------------ // Initieringskonstruktor //------------------------------------------------------------------------------ Time::Time(int pHour, int pMinute, int pSecond) { setHour(pHour); setMinute(pMinute); setSecond(pSecond); } //------------------------------------------------------------------------------ // Setfunktioner //------------------------------------------------------------------------------ //------------------------------------------------------------------------------ // setHour // Ange timme //------------------------------------------------------------------------------ void Time::setHour(int pHour) { if(pHour>-1) hours = pHour; else hours = 0; } //------------------------------------------------------------------------------ // setMinute // Ange minut //------------------------------------------------------------------------------ void Time::setMinute(int pMinute) { if(pMinute < 60 && pMinute > -1) { minutes = pMinute; } else minutes = 0; } //------------------------------------------------------------------------------ // setSecond // Ange sekund //------------------------------------------------------------------------------ void Time::setSecond(int pSecond) { if(pSecond < 60 && pSecond > -1) { seconds = pSecond; } else seconds = 0; } //--------------------------------------------------------------------------- // Överlagring av utskriftsoperatorn //--------------------------------------------------------------------------- ostream &operator<<(ostream &os, const Time &time) { os << time.getHour()*3600+time.getMinute()*60+time.getSecond(); return os; } //--------------------------------------------------------------------------- // Överlagring av inmatningsoperatorn //--------------------------------------------------------------------------- istream &operator>>(istream &is, Time &time) { int tmp; is >> tmp; time.setSecond(tmp%60); time.setMinute((tmp/60)%60); time.setHour(tmp/3600); return is; } //--------------------------------------------------------------------------- // Likhet //-------------------------------------------------------------------------- bool Time::operator==(const Time &time) const { return hours == time.getHour() && minutes == time.getMinute() && seconds == time.getSecond(); } //--------------------------------------------------------------------------- // Mindre än //--------------------------------------------------------------------------- bool Time::operator<(const Time &time) const { if(hours == time.getHour()) { if(minutes == time.getMinute()) { return seconds < time.getSecond(); } else { return minutes < time.getMinute(); } } else { return hours < time.getHour(); } } //--------------------------------------------------------------------------- // Addition //--------------------------------------------------------------------------- Time Time::operator+(const Time &time) const { return Time(hours+time.getHour() + (minutes+time.getMinute() + (seconds+time.getSecond())/60)/60, (minutes+time.getMinute() + (seconds+time.getSecond())/60)%60, (seconds+time.getSecond())%60); } //--------------------------------------------------------------------------- Thanks in advance for any help! Edit2: Didn't think of including the more detailed crash info (as it didn't show in the crash pop-up, so to say). Anyway, here it is: Output: 'Jukebox.exe' (Win32): Loaded 'C:\Users\Håkan\Documents\Studier - IT\Objektbaserad programmering i C++\Inlämningsuppgifter\Projekt\Jukebox\Debug\Jukebox.exe'. Symbols loaded. 'Jukebox.exe' (Win32): Loaded 'C:\Windows\SysWOW64\ntdll.dll'. Cannot find or open the PDB file. 'Jukebox.exe' (Win32): Loaded 'C:\Windows\SysWOW64\kernel32.dll'. Cannot find or open the PDB file. 'Jukebox.exe' (Win32): Loaded 'C:\Windows\SysWOW64\KernelBase.dll'. Cannot find or open the PDB file. 'Jukebox.exe' (Win32): Loaded 'C:\Windows\SysWOW64\msvcp110d.dll'. Symbols loaded. 'Jukebox.exe' (Win32): Loaded 'C:\Windows\SysWOW64\msvcr110d.dll'. Symbols loaded. The thread 0xe50 has exited with code 0 (0x0). Unhandled exception at 0x0083630C in Jukebox.exe: 0xC0000005: Access violation reading location 0x0000003C. Call stack: > Jukebox.exe!Song::getLength() Line 27 C++ Jukebox.exe!operator<<(std::basic_ostream<char,std::char_traits<char> > & os, const Song & song) Line 59 C++ Jukebox.exe!Queue::deque(Song & item) Line 55 C++ Jukebox.exe!Jukebox::playList() Line 493 C++ Jukebox.exe!Jukebox::play() Line 385 C++ Jukebox.exe!Jukebox::run() Line 536 C++ Jukebox.exe!main() Line 547 C++ Jukebox.exe!__tmainCRTStartup() Line 536 C Jukebox.exe!mainCRTStartup() Line 377 C kernel32.dll!754d86e3() Unknown [Frames below may be incorrect and/or missing, no symbols loaded for kernel32.dll] ntdll.dll!7748bf39() Unknown ntdll.dll!7748bf0c() Unknown

    Read the article

  • Upgrading Sharepoint MOSS 2007 Farm to Sharepoint 2010 "waiting to get a lock to upgrade the farm"

    - by Wes Weeks
    My first inplace upgrade of a MOSS 2007 farm to sharepoint went pretty smooth. I read the preupgrade documentation and was comfortable with the steps.  Since it was a fairly new installation of Moss changes were minimal and I wasn't anticipating too many problems The one issue I got was after installing the software on all of the farm.  I went to the first machine which ran Sharepoint 2010 central administration and ran the Sharepoint 2010 Products Configuration Wizard.  I received the message that I would need to run the configuration on each server in the farm.  Fair enough, I expected as much. The wizard completed without issue on the first server, but when I tried to run it on the others it hung with a "waiting to get a lock to upgrade the farm" message.  It hung for about 10 minutes and then the wizard failed.  Did a few searches on Google and Bing and got 0 results for that message.  None, Nothing, Zilch.  I'm on my own... For grins, hit the help button on the configuration wizard and it seemed to indicate that the configuration wizard needed to be run on all farm servers simultaneously.  I started it again on the first server to the point I got the message about needing to be run on all servers on the farm and then started the wizard on the other servers and ran it to that point as well.  I then clicked ok on the first server and then the subsuquent servers. It took a while and it did hang on the lock message for some time, but then it did kick off and completed succesfully on all of them.  Yeah! Hope this helps someone else!  Now there should be at least one post with this error message on it!

    Read the article

  • C#: System.Lazy&lt;T&gt; and the Singleton Design Pattern

    - by James Michael Hare
    So we've all coded a Singleton at one time or another.  It's a really simple pattern and can be a slightly more elegant alternative to global variables.  Make no mistake, Singletons can be abused and are often over-used -- but occasionally you find a Singleton is the most elegant solution. For those of you not familiar with a Singleton, the basic Design Pattern is that a Singleton class is one where there is only ever one instance of the class created.  This means that constructors must be private to avoid users creating their own instances, and a static property (or method in languages without properties) is defined that returns a single static instance. 1: public class Singleton 2: { 3: // the single instance is defined in a static field 4: private static readonly Singleton _instance = new Singleton(); 5:  6: // constructor private so users can't instantiate on their own 7: private Singleton() 8: { 9: } 10:  11: // read-only property that returns the static field 12: public static Singleton Instance 13: { 14: get 15: { 16: return _instance; 17: } 18: } 19: } This is the most basic singleton, notice the key features: Static readonly field that contains the one and only instance. Constructor is private so it can only be called by the class itself. Static property that returns the single instance. Looks like it satisfies, right?  There's just one (potential) problem.  C# gives you no guarantee of when the static field _instance will be created.  This is because the C# standard simply states that classes (which are marked in the IL as BeforeFieldInit) can have their static fields initialized any time before the field is accessed.  This means that they may be initialized on first use, they may be initialized at some other time before, you can't be sure when. So what if you want to guarantee your instance is truly lazy.  That is, that it is only created on first call to Instance?  Well, there's a few ways to do this.  First we'll show the old ways, and then talk about how .Net 4.0's new System.Lazy<T> type can help make the lazy-Singleton cleaner. Obviously, we could take on the lazy construction ourselves, but being that our Singleton may be accessed by many different threads, we'd need to lock it down. 1: public class LazySingleton1 2: { 3: // lock for thread-safety laziness 4: private static readonly object _mutex = new object(); 5:  6: // static field to hold single instance 7: private static LazySingleton1 _instance = null; 8:  9: // property that does some locking and then creates on first call 10: public static LazySingleton1 Instance 11: { 12: get 13: { 14: if (_instance == null) 15: { 16: lock (_mutex) 17: { 18: if (_instance == null) 19: { 20: _instance = new LazySingleton1(); 21: } 22: } 23: } 24:  25: return _instance; 26: } 27: } 28:  29: private LazySingleton1() 30: { 31: } 32: } This is a standard double-check algorithm so that you don't lock if the instance has already been created.  However, because it's possible two threads can go through the first if at the same time the first time back in, you need to check again after the lock is acquired to avoid creating two instances. Pretty straightforward, but ugly as all heck.  Well, you could also take advantage of the C# standard's BeforeFieldInit and define your class with a static constructor.  It need not have a body, just the presence of the static constructor will remove the BeforeFieldInit attribute on the class and guarantee that no fields are initialized until the first static field, property, or method is called.   1: public class LazySingleton2 2: { 3: // because of the static constructor, this won't get created until first use 4: private static readonly LazySingleton2 _instance = new LazySingleton2(); 5:  6: // Returns the singleton instance using lazy-instantiation 7: public static LazySingleton2 Instance 8: { 9: get { return _instance; } 10: } 11:  12: // private to prevent direct instantiation 13: private LazySingleton2() 14: { 15: } 16:  17: // removes BeforeFieldInit on class so static fields not 18: // initialized before they are used 19: static LazySingleton2() 20: { 21: } 22: } Now, while this works perfectly, I hate it.  Why?  Because it's relying on a non-obvious trick of the IL to guarantee laziness.  Just looking at this code, you'd have no idea that it's doing what it's doing.  Worse yet, you may decide that the empty static constructor serves no purpose and delete it (which removes your lazy guarantee).  Worse-worse yet, they may alter the rules around BeforeFieldInit in the future which could change this. So, what do I propose instead?  .Net 4.0 adds the System.Lazy type which guarantees thread-safe lazy-construction.  Using System.Lazy<T>, we get: 1: public class LazySingleton3 2: { 3: // static holder for instance, need to use lambda to construct since constructor private 4: private static readonly Lazy<LazySingleton3> _instance 5: = new Lazy<LazySingleton3>(() => new LazySingleton3()); 6:  7: // private to prevent direct instantiation. 8: private LazySingleton3() 9: { 10: } 11:  12: // accessor for instance 13: public static LazySingleton3 Instance 14: { 15: get 16: { 17: return _instance.Value; 18: } 19: } 20: } Note, you need your lambda to call the private constructor as Lazy's default constructor can only call public constructors of the type passed in (which we can't have by definition of a Singleton).  But, because the lambda is defined inside our type, it has access to the private members so it's perfect. Note how the Lazy<T> makes it obvious what you're doing (lazy construction), instead of relying on an IL generation side-effect.  This way, it's more maintainable.  Lazy<T> has many other uses as well, obviously, but I really love how elegant and readable it makes the lazy Singleton.

    Read the article

  • Reusable VS clean code - where's the balance?

    - by Radek Šimko
    Let's say I have a data model for a blog posts and have two use-cases of that model - getting all blogposts and getting only blogposts which were written by specific author. There are basically two ways how I can realize that. 1st model class Articles { public function getPosts() { return $this->connection->find() ->sort(array('creation_time' => -1)); } public function getPostsByAuthor( $authorUid ) { return $this->connection->find(array('author_uid' => $authorUid)) ->sort(array('creation_time' => -1)); } } 1st usage (presenter/controller) if ( $GET['author_uid'] ) { $posts = $articles->getPostsByAuthor($GET['author_uid']); } else { $posts = $articles->getPosts(); } 2nd one class Articles { public function getPosts( $authorUid = NULL ) { $query = array(); if( $authorUid !== NULL ) { $query = array('author_uid' => $authorUid); } return $this->connection->find($query) ->sort(array('creation_time' => -1)); } } 2nd usage (presenter/controller) $posts = $articles->getPosts( $_GET['author_uid'] ); To sum up (dis)advantages: 1) cleaner code 2) more reusable code Which one do you think is better and why? Is there any kind of compromise between those two?

    Read the article

  • What's brewing in the world of Java? (Dec 22nd 2010)

    - by Jacob Lehrbaum
    The nights are getting darker, the email traffic seems to be getting lighter and the holiday season feels like its right around the corner - but the world of Java is still as active as ever and shows no signs of taking a break!  Let's take a look at everything that has been brewing over the past couple of weeks:Product Updates and ResourcesJCP Approves JSRs for Java SE 7, Java SE 8, Project Coin and Lambda (read more)Java SE Update 23 Released, delivers improved performance and enhanced support for right-left languages. (read more or download)New Tutorial: JDK 7 Support in NetBeans IDE 7.0Java EE 6 and Glassfish 3.0 have celebrated their respective one year anniversaries!  (read more) So naturally, it's time to start talking about Java EE 7 (read more)WebcastsOn Demand: Developing Rich Clients for the Enterprise with the JavaFX Composer, Part 1Coming soon: Smarter Devices with Oracle's Embedded Java SolutionsPodcastsJava Spotlight Podcast Episode 7: Interview with Adam Messinger, Vice President of Java Development on Java One Brazil, Java SE Development, OpenJDK, JavaFX 2.0 and more!  The NetBeans team released Episode 53 of the NetBeans Podcast series on December 3rd marking the first episode in nearly 12 months.  Sign of things to come?Community and EventsJavaOne was held for the first time in Brazil this year, and by all accounts it was a great success!  Read more about this exciting first in the following posts from Tori Wieldt (JavaOne Latin America Underway) and Janice Heiss (JavaOne in Brazil)JavaOne was also held in Bejing for the first time last week and was also a huge success. Will try to include coverage of this event in the near futureArticles and InterviewsAn update on JavaServer Faces with Oracle's Ed Burns (read more)Interview with Java Champion Matjaz B. Juric on Cloud Computing, SOA, and Java EE 6 (read more)The 2010 JavaOne Java EE 6 Panel: Where We Are and Where We're Going (read more)Oracle MagazineThe latest issue of Oracle Magazine is up and in what will hopefully be a sign of the future, it includes a number of columns and articles on Java.  First is an editorial from Editor-in-Chief Tom Haunert who shares some insight into the long-standing relationship that Oracle has had with Java. Next up is a Oracle Technology Network Chief Justin Kestelyn's Community Bulletin entitled: Java Evolves.  And finally, Java Champion Adam Bien's feature on Java EE 6: Simplicity by DesignEnjoy!

    Read the article

< Previous Page | 82 83 84 85 86 87 88 89 90 91 92 93  | Next Page >