Search Results

Search found 48927 results on 1958 pages for 'connection string'.

Page 9/1958 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

• Split a long JSON string into lines in Ruby

  - by David J.

  First, the background: I'm writing a Ruby app that uses SendGrid to send mass emails. SendGrid uses a custom email header (in JSON format) to set recipients, values to substitute, etc. SendGrid's documentation recommends splitting up the header so that the lines are shorter than 1,000 bytes. My question, then, is this: given a long JSON string, how can I split it into lines < 1,000 so that lines are split at appropriate places (i.e., after a comma) rather than in the middle of a word? This is probably unnecessary, but here's an example of the sort of string I'd like to split: X-SMTPAPI: {"sub": {"pet": ["dog", "cat"]}, "to": ["[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]"]} Thanks in advance for any help you can provide!

  Read the article

• String.IsNullOrWhiteSpace

  - by Scott Dorman

  An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); }   return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty("   ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; }   Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

  Read the article

• How do I concatenate 2 strings in NSIS

  - by Apoc

  How do I concatenate 2 strings in NSIS?

  Read the article

• how to create a string literal as a function argument via string concatenation in c

  - by Reed Debaets

  I need to pass a string literal to a function myfunction("arg1" CONSTANT "arg1"); now part of that constructed string literal needs to be a function return stmp = createString(); myfunction("arg1" stmp "arg2"); is there any way to do this in one line? myfunction("arg1" createString() "arg2"); //doesn't work ... why not? what instead? NOTE: C only please.

  Read the article

• String replacement problem.

  - by fastcodejava

  I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

  Read the article

• PHP String tokenizer not working correctly

  - by asdadas

  I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

  Read the article

• Finding multiple values in a string Jquery / Javascript

  - by user257503

  I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• PPTP connection fails with errors 800/806

  - by Mark S. Rasmussen

  I've got a client (Server 2008 R2) that won't connect to our production environment PPTP VPN server (Server 2003, running RRAS). The server is behind a firewall that has TCP1723 open as well as GRE. Other clients at our office are able to connect just fine. Our office is behind a Juniper SSG5-Serial firewall, but all outgoing traffic is allowed, and multiple other clients are able to connect to VPN servers without issues. I've also setup a completely different VPN server on another network outside of our office. The functioning clients connect just fine - the Server 2008 R2 machine doesn't. Thus it's definitely a problem with this machine in particular. I've rebooted it. I've disabled the firewall, no dice on either. I've run PPTPSRV and PPTPCLNT on the server/client and they're able to communicate perfectly - indicating there's no problem using neither TCP1723 nor GRE. The Server 2008 R2 machine is also running as a VPN server itself (incoming connection) and that's working perfectly. We have the issues no matter if there are active incoming connections or not. I'm not sure what my next debugging step would be; any suggestions? EDIT: The event log on the server has the following warning from RasMan: A connection between the VPN server and the VPN client xxx.xxx.xxx.xxx has been established, but the VPN connection cannot be completed. The most common cause for this is that a firewall or router between the VPN server and the VPN client is not configured to allow Generic Routing Encapsulation (GRE) packets (protocol 47). Verify that the firewalls and routers between your VPN server and the Internet allow GRE packets. Make sure the firewalls and routers on the user's network are also configured to allow GRE packets. If the problem persists, have the user contact the Internet service provider (ISP) to determine whether the ISP might be blocking GRE packets. Obviously this points to GRE being a potential problem. But seeing as I have other clients connectiong without problems, as well as PPTPSRV and PPTPCLNT being able to communicate, I'm suspecting this might be a red herring. EDIT: Here are the anonymized events logged by the client in chronological order: CoId={742CB15C-A7E0-47B7-8240-0EFA1139CBD9}: The user XXX\YYY has started dialing a VPN connection using a per-user connection profile named ZZZ. The connection settings are: Dial-in User = XXX\YYY VpnStrategy = PPTP DataEncryption = Require PrerequisiteEntry = AutoLogon = No UseRasCredentials = Yes Authentication Type = CHAP/MS-CHAPv2 Ipv4DefaultGateway = No Ipv4AddressAssignment = By Server Ipv4DNSServerAssignment = By Server Ipv6DefaultGateway = Yes Ipv6AddressAssignment = By Server Ipv6DNSServerAssignment = By Server IpDnsFlags = Register primary domain suffix IpNBTEnabled = Yes UseFlags = Private Connection ConnectOnWinlogon = No. CoId={742CB15C-A7E0-47B7-8240-0EFA1139CBD9}: The user XXX\YYY is trying to establish a link to the Remote Access Server for the connection named ZZZ using the following device: Server address/Phone Number = XXX.YYY.ZZZ.KKK Device = WAN Miniport (PPTP) Port = VPN3-4 MediaType = VPN. CoId={742CB15C-A7E0-47B7-8240-0EFA1139CBD9}: The user XXX\YYY has successfully established a link to the Remote Access Server using the following device: Server address/Phone Number = XXX.YYY.ZZZ.KKK Device = WAN Miniport (PPTP) Port = VPN3-4 MediaType = VPN. CoId={742CB15C-A7E0-47B7-8240-0EFA1139CBD9}: The link to the Remote Access Server has been established by user XXX\YYY. CoId={742CB15C-A7E0-47B7-8240-0EFA1139CBD9}: The user XXX\YYY dialed a connection named ZZZ which has failed. The error code returned on failure is 806. Running Wireshark on the client shows it trying and retrying to send a "71 Configuration Request" While the server shows the incoming client requests, but apparently without replying: Given that this is GRE traffic, I think rules out the GRE traffic being blocked. Question is, why doesn't the server reply? This is the Configuration Request the server receives from the non functioning client (meaning no response is sent to the client request): And this is the Configuration Request the server receives from the working client: To me they seem identical, except for differing keys and magic numbers, and the fact that one client receives a response while the other doesn't.

  Read the article

• C# collection/string .Contains vs collection/string.IndexOf

  - by Daniel

  Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

  Read the article

• Making a string out of a string and an integer in Python

  - by Waterfox

  I get this error when trying to take an integer and prepend "b" to it, converting it into a string: File "program.py", line 19, in getname name = "b" + num TypeError: Can't convert 'int' object to str implicitly That's related to this function: num = random.randint(1,25) name = "b" + num

  Read the article

• Findind string in another string in PHP

  - by Mamadou

  Hi everybody I got a string like this : $str1 = "mod 1 + mode 2 + comp 1 + toto" I would like to test even " mod 1" is in $str1. I used strpos but this function dosen't help Pliz can anyone give an idea to fix this problem thank u.

  Read the article

• Finding substring of a word found in joining a string from another string

  - by 2er0

  Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

  Read the article

• Ruby string compare regardless of string case

  - by Steven

  Hi I need to check for "Apple" = "Apple" TRUE "Apple" = "APPLE" TRUE "Apple" = "Apple1" FALSE in ruby I need a string comparison but for the check to not be case sensitive. thks

  Read the article

• Enable: Asp.net connection pool monitoring with performance monitor

  - by BlackHawkDesign

  If this question is at the wrong forum, be free to tell me. I'm a c# developer, but I'm running in a system management issue here. Intro: Im suspecting that an asp.net application is having some issues with the connection pool and that the pool is flooding from time to time. So to make sure, I want to monitor the connection pool. After some searching I found this article : http://blog.idera.com/sql-server/performance-and-monitoring/ensure-proper-sql-server-connection-pooling-2/ Basicly it explains stuff about connection pools and how you can monitor the application pool with performance monitor. The problem: So I logged in to the asp.net server(The sql database is hosted on a different server) which hosts the website. Started performance monitor. But when I want to select 'Current # pooled and nonpooled connections', I have no instance to select. There fore I can't add it. Question How can I create/supply an instance so I can monitor the connection pool? Thanks in advance BHD

  Read the article

• Connection speed drops from 1 Gbps to 10 Mbps (Vista 64)

  - by Kevin Hakanson

  I recently got a Windows Home Server (HP MediaSmart Server EX490) setup so I could do backups and other things. However, I am having trouble on my Vista 64 PC. The backup will be making great progress, then it will just slow down. At one point, I noticed the lights on my Netgear GS105 indicated it was not using a 1000 Mbps connection, but a 10 Mbps one. I checked the Status of Local Area Connection (Intel(R) 82567V-2 Gigabit Network Connection) and that also showed the same slow speed. This has happened several times in the last couple days. When I disabled the network device, and then enabled it, it established the 1 Gpbs connection again. However, some of the times the Sent Bytes Activity on the Status windows indicate that the data flow is still slow (100 to 1000 bytes every couple seconds). Obviously, at this rate I could backup faster to floppy disk. :) My question is how to diagnose and fix this problem. When I look at the Administrative Events, I do a Errors: Bonjour Service 456: ERROR: read_msg errno 10054 (An existing connection was forcibly closed by the remote host.) And a Warning: e1yexpress Intel(R) 82567V-2 Gigabit Network Connection Link has been disconnected. I am suspicious there is some power saving mode. I found a post suggesting System Idle Power Saver(SIPS) may be the issue. I am going to try that, but looking for other suggestions or diagnostic advice. I have several new items in this configuration: server, client software, switch and cat6 cables.

  Read the article

• Remove characters after specific character in string, then remove substring?

  - by sah302

  I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

  Read the article

• How to extract specific variables from a string?

  - by David

  Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

  Read the article

• String formatting error

  - by wrongusername

  Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

  Read the article

• How to replace round bracket tag in javascript string

  - by tomaszs

  I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

  Read the article

• Use FlurryAgent.onEvent(String eventId, Map<String, String> parameters)

  - by Shalini Singh

  hello, Please anybody tell how to use FlurryAgent.onEvent(String eventId, Map parameters) in an android activity to track events with flurry ?

  Read the article

• Problem converting path string from "/", "\"

  - by justjoe

  i got this code $current_path = str_replace('\', '/', getcwd()); //c://xampp/htdoc Why it fail replace '\' with '/' in directory patch ? why is the reason and how to handle this problem ?

  Read the article

• PHP: Format a numeric string by inserting comma

  - by gameover

  I need a way to convert a number into formatted way by inserting comma at suitable places. Can it be done using regex? Example: 12345 => 12,345 1234567 =>1,234,567

  Read the article

• Windows 7 Cable Connection Rehabilitation

  - by Giovanni De Gaetano

  I recently switched the operating system of my laptop from Windows XP to Windows 7. My web-connection is such that I need to identify everytime before connecting. Since there is no automatic identification request, while using Windows XP I was used to de-abilitate and rehabilitate the cable connection after every switching on. I successfully installed the web-connection on Windows 7, and later on I switched the computer off and on (simply because I had to sleep!). After restarting the computer, since there was no automatic identification request, I de-abilitate the cable connection. But this time I didn't find any way to rehabilitate it! Do you have any suggestions on how to solve the problem? My "Wired AutoConfiguration" has the startup type "Automatic", but it's not enough to restart automatically the cable connection! I tried to do some standard things like restart the computer, unplug and plug in again the cable, reinstall the web-connection from the scratch... But nothing worked! Thank you very much for your help!

  Read the article

• Problem with Replacing special characters in a string

  - by Hossein

  Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

  Read the article

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >