Search Results

Search found 45441 results on 1818 pages for 'string to date'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 9/1818 | < Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >

  • String replacement problem.

    - by fastcodejava
    I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • How can I set the date format to my country setting?

    - by Jamina Meissner
    I am German, but I use only English software. Hence, I am also using English Ubuntu. It's not because I don't know how to install German Ubuntu. It's because I prefer to work with English software environment. However, I would like to keep date & time format in German format, just as I use a German keyboard layout in English Ubuntu. I can set the time format to 24h time. But how can I set the date format to German time format? It is irritating for me to have the day number before the time numbers: In other words, instead of "Oct 14 15:16" I want it to display "14 Okt" or (if only English language is available) "14 Oct 15:16" or "14th Oct 15:16". At least, the number of the day should be displayed before the month. In Windows, it was no problem to choose time/date/currency settings according to a chosen country. Where can I do this in Ubuntu? The best would be if I could freely enter the date/time format myself with variables (DD.MM hh.mm.ss etc). I found answers for Ubuntu 11.04, but not for Ubuntu 12.04. I am using Ubuntu 12.04, 64-bit. Keep in mind that I am a beginner. So I'd like to be able to do this via GUI, if possible. EDIT: I found the answer in a forum. Go to System Settings... and choose Language Support. There are two tabs, Language and Reginal Formats. You are by default on the Language tab. On the Language tab, click Install / Remove Languages. A window with a list of languages opens. Mark the language(s) you want to add for your time/date/currency format. Click Apply Changes. Ubuntu will now download and install the additional language files, as well as help files of other applications in this language. So don't be irritated. When Ubuntu has finished applying the changes, switch to Regional Formats tab. (Do not change the Language for menus and windows on the Language tab if you only want to change the date/time/unit format). There you can choose from the dropdown list the language for your preferred format for date/time/currency/unit. Log out and log in again to have the changes take effect.

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Date object to Calendar [Java]

    - by Samuel
    Hello World, I have a class Movie in it i have a start Date, a duration and a stop Date. Start and stop Date are Date Objects (private Date startDate ...) (It's an assignment so i cant change that) now i want to automatically calculate the stopDate by adding the duration (in min) to the startDate. By my knowledge working with the time manipulating functions of Date is deprecated hence bad practice but on the other side i see no way to convert the Date object to a calendar object in order to manipulate the time and reconvert it to a Date object. Is there a way? And if there is what would be best practice Thanks in advance Samuel

    Read the article

  • control panel date&time is considered while using "new date()" javascript function.

    - by Rupa
    Hi, I am getting a client date in javscript function using "new date()" object. But this object is considering the properties set for Date&Time control in the control panel of the system. For example, If I check the check box of Date&Time control of the system (control panel) "Automatically adjust clock for daylight saving changes", then I am getting the date(from javscript) according to the Daylight savings time and if I uncheck it, I am getting the date according to the standard time. What I need is to get the date from a Javscript function irrespective of the Date&Time control of the control panel. Thanks Rupa.

    Read the article

  • How to determine whether there is date in the string or not with different date format ?

    - by Harikrishna
    I am parsing table information from the html table.Now I want to check whether there is date in the records for one particular column.Means I want to check whether there is date in the string or not .And date can be in different format like the string can be FUTIDX 26FEB2009 NIFTY 0 -- There is date in the string. FUTIDX MINIFTY 30 Jul 2009 -- There is date in the string. FUTSTK ONGC 27 Mar 2008 -- There is date in the string. How can I do that ?

    Read the article

  • R graphics plotting a linegraph with date/time horizontally along x-axis

    - by user2978586
    I want to get a linegraph in R which has Time along x and temperature along y. Originally I had the data in dd/mm/yyyy hh:mm format, with a time point every 30 minutes. https://www.dropbox.com/s/q35y1rfila0va1h/Data_logger_S65a_Ania.csv Since I couldn't find a way of reading this into R, I formatted the data to make it into dd/mm/yyyy and added a column 'time' with 1-48 for all the time points for each day https://www.dropbox.com/s/65ogxzyvuzteqxv/temp.csv This is what I have so far: temp<-read.csv("temp.csv",as.is=T) temp$date<-as.Date(temp$date, format="%d/%m/%Y") #inputting date in correct format plot(temperature ~ date, temp, type="n") #drawing a blank plot with axes, but without data lines(temp$date, temp$temperature,type="o") #type o is a line overlaid on top of points. This stacks the points up vertically, which is not what I want, and stacks all the time points (1-48) for each day all together on the same date. Any advice would be much appreciated on how to get this horizontal, and ordered by time as well as date.

    Read the article

  • What be the regex to determine whether there is date in the string or not with different date format

    - by Harikrishna
    I am parsing table information from the html table.Now I want to check whether there is date in the records for one particular column.Means I want to check whether there is date in the string or not .And date can be in different format like the string can be FUTIDX 26FEB2009 NIFTY 0 -- There is date in the string. FUTIDX MINIFTY 30 Jul 2009 -- There is date in the string. FUTSTK ONGC 27 Mar 2008 -- There is date in the string. What should be the regular expression for that ?

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • Customise date-time format in Windows.

    - by infant programmer
    Is it possible to customize data (or date-time) format in Windows [I am using windows XP]? The current format which is followed by the OS [to show date-modified, etc.] is MM/DD/YYYY or M/D/YYYY, whereas I have been comfortable with DD/MM/YYYY or D/M/YYYY format. I am finding it hard to refer Date-modified [which I use often] of files and folders.

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 5 6 7 8 9 10 11 12 13 14 15 16  | Next Page >