Search Results

Search found 2360 results on 95 pages for 'hash consing'.

Page 90/95 | < Previous Page | 86 87 88 89 90 91 92 93 94 95  | Next Page >

  • Delphi - Read File To StringList, then delete and write back to file.

    - by Jkraw90
    I'm currently working on a program to generate the hashes of files, in Delphi 2010. As part of this I have a option to create User Presets, e.g. pre-defined choice of hashing algo's which the user can create/save/delete. I have the create and load code working fine. It uses a ComboBox and loads from a file "fhpre.ini", inside this file is the users presets stored in format of:- PresetName PresetCode (a 12 digit string using 0 for don't hash and 1 for do) On application loading it loads the data from this file into the ComboBox and an Array with the ItemIndex of ComboBox matching the corrisponding correct string of 0's and 1's in the Array. Now I need to implement a feature to have the user delete a preset from the list. So far my code is as follows, procedure TForm1.Panel23Click(Sender : TObject); var fil : textfile; contents : TStringList; x,i : integer; filline : ansistring; filestream : TFileStream; begin //Start Procedure //Load data into StringList contents := TStringList.Create; fileStream := TFileStream.Create((GetAppData+'\RFA\fhpre.ini'), fmShareDenyNone); Contents.LoadFromStream(fileStream); fileStream.Destroy(); //Search for relevant Preset i := 0; if ComboBox4.Text <> Contents[i] then begin Repeat i := i + 1; Until ComboBox4.Text = Contents[i]; end; contents.Delete(i); //Delete Relevant Preset Name contents.Delete(i); //Delete Preset Digit String //Write StringList back to file. AssignFile(fil,(GetAppData+'\RFA\fhpre.ini')); ReWrite(fil); for i := 0 to Contents.Count -1 do WriteLn(Contents[i]); CloseFile(fil); Contents.Free; end; However if this is run, I get a 105 error when it gets to the WriteLn section. I'm aware that the code isn't great, for example doesn't have checks for presets with same name, but that will come, I want to get the base code working first then can tweak and add extra checks etc. Any help would be appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Java replacement for C macros

    - by thkala
    Recently I refactored the code of a 3rd party hash function from C++ to C. The process was relatively painless, with only a few changes of note. Now I want to write the same function in Java and I came upon a slight issue. In the C/C++ code there is a C preprocessor macro that takes a few integer variables names as arguments and performs a bunch of bitwise operations with their contents and a few constants. That macro is used in several different places, therefore its presence avoids a fair bit of code duplication. In Java, however, there is no equivalent for the C preprocessor. There is also no way to affect any basic type passed as an argument to a method - even autoboxing produces immutable objects. Coupled with the fact that Java methods return a single value, I can't seem to find a simple way to rewrite the macro. Avenues that I considered: Expand the macro by hand everywhere: It would work, but the code duplication could make things interesting in the long run. Write a method that returns an array: This would also work, but it would repeatedly result into code like this: long tmp[] = bitops(k, l, m, x, y, z); k = tmp[0]; l = tmp[1]; m = tmp[2]; x = tmp[3]; y = tmp[4]; z = tmp[5]; Write a method that takes an array as an argument: This would mean that all variable names would be reduced to array element references - it would be rather hard to keep track of which index corresponds to which variable. Create a separate class e.g. State with public fields of the appropriate type and use that as an argument to a method: This is my current solution. It allows the method to alter the variables, while still keeping their names. It has the disadvantage, however, that the State class will get more and more complex, as more macros and variables are added, in order to avoid copying values back and forth among different State objects. How would you rewrite such a C macro in Java? Is there a more appropriate way to deal with this, using the facilities provided by the standard Java 6 Development Kit (i.e. without 3rd party libraries or a separate preprocessor)?

    Read the article

  • Database schema for simple stats project

    - by Bubnoff
    Backdrop: I have a file hierarchy of cvs files for multiple locations named by dates they cover ...by month specifically. Each cvs file in the folder is named after the location. eg', folder name: 2010-feb contains: location1.csv location2.csv Each CSV file holds records like this: 2010-06-28, 20:30:00 , 0 2010-06-29, 08:30:00 , 0 2010-06-29, 09:30:00 , 0 2010-06-29, 10:30:00 , 0 2010-06-29, 11:30:00 , 0 meaning of record columns ( column names ): Date, time, # of sessions I have a perl script that pulls the data from this mess and originally I was going to store it as json files, but am thinking a database might be more appropriate long term ...comparing year to year trends ...fun stuff like that. Pt 2 - My question/problem: So I now have a REST service that coughs up json with a test database. My question is [ I suck at db design ], how best to design a database backend for this? I am thinking the following tables would suffice and keep it simple: Location: (PK)location_code, name session: (PK)id, (FK)location_code, month, hour, num_sessions I need to be able to average sessions (plus min and max) for each hour across days of week in addition to days of week in a given month or months. I've been using perl hashes to do this and am trying to decide how best to implement this with a database. Do you think stored procedures should be used? As to the database, depending on info gathered here, it will be postgresql or sqlite. If there is no compelling reason for postgresql I'll stick with sqlite. How and where should I compare the data to hours of operation. I am storing the hours of operation in a yaml file. I currently 'match' the hour in the data to a hash from the yaml to do this. Would a database open simpler methods? I am thinking I would do this comparison as I do now then insert the data. Can be recalled with: SELECT hour, num_sessions FROM session WHERE location_code=LOC1 Since only hours of operation are present, I do not need to worry about it. Should I calculate all results as I do now then store as a stats table for different 'reports'? This, rather than processing on demand? How would this look? Anyway ...I ramble. Thanks for reading! Bubnoff

    Read the article

  • Jquery-UI tabs : Double loading of the default tab with

    - by Stephane
    I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

    Read the article

  • ScrollTo and toggle div

    - by user1466260
    I'm a big fan ov 8020.com and my goal is to create a porfolio with the same functionality like the one they have. Here is my markup This section should be hidden <section id="work-container"> <div id="work-list-51" class="work-details"> <h1> <div class="close-project"> </div> <div id="work-list-52" class="work-details"> <h1> <div class="close-project"> </div> <div id="work-list-53" class="work-details"> <h1> <div class="close-project"> </div> </section> This section will hold the thumbnails. When you click a thumbnail you will scroll to the top and the div will slidetoggle. <ul id="work-list"> <li id="work-list-51"><a data-page="51" href="#work-list-51"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> <li id="work-list-52"><a data-page="52" href="#work-list-52"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> <li id="work-list-53"><a data-page="53" href="#work-list-53"> <img width="230" height="230" alt="Mariann Rosa" src="sites/default/files/styles/square_thumbnail/public/field/image/mariann.jpg"> </a></li> </ul> I have come this far: $(document).ready(function(){ $("#work-list a").click(function(event){ event.preventDefault(); $('html, body').animate ( {scrollTop: $('#top').offset().top}, 800 ); }); $('#work-list a').click(function(e) { $('#work-container > div').hide(); $(this.hash).slideToggle(1600); }); }); It scrolls to top and the div becomes visible but it does not work correctly :)

    Read the article

  • Infinite Refresh Loop in Firefox 3.0

    - by Martin Gordon
    I'm having a strange issue with my Javascript in Firefox 3.0.x. In Firefox 3.0.12, the page constantly reloads as soon as the list body is loaded. Neither Firefox 3.5, Safari 4 nor Chrome 5 (all on Mac) experience this issue. EDIT: I've created an isolated example rather than pulling this from my existing code. test.js function welcomeIndexOnLoad() { $("#options a").live('click', function () { optionClicked($(this), "get_list_body.html"); return false; }); $(document).ready(function() { optionClicked(null, "get_list_body.html"); }); } function optionClicked(sender, URL) { queryString = ""; if (sender != null) { queryString = $(sender).attr("rel"); } $("#list_body").load(URL + "?" + queryString, function(resp, status, AJAXReq) { console.log(resp); console.log("" + status); location.hash = queryString; }); }? test.html <html> <head> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.js"></script> <script type="text/javascript" src="test.js"></script> <script> welcomeIndexOnLoad(); </script> </head> <body> <div id="container"> Outside of list body. <div id="list_body"> </div> </div> </body> </html> get_list_body.html <h3> <div id="options"> <a href="#" rel="change_list">Change List</a> </div> <ul> <li>li</li> </ul> jQuery line 5252 (an xhr.send() call) shows up in the console as soon as the page reloads: xhr.send( type === "POST" || type === "PUT" || type === "DELETE" ? s.data : null );

    Read the article

  • Python: (sampling with replacement): efficient algorithm to extract the set of UNIQUE N-tuples from a set

    - by Homunculus Reticulli
    I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

    Read the article

  • Python: (sampling with replacement): efficient algorithm to extract the set of DISSIMILAR N-tuples from a set

    - by Homunculus Reticulli
    I have a set of items, from which I want to select DISSIMILAR tuples (more on the definition of dissimilar touples later). The set could contain potentially several thousand items, although typically, it would contain only a few hundreds. I am trying to write a generic algorithm that will allow me to select N items to form an N-tuple, from the original set. The new set of selected N-tuples should be DISSIMILAR. A N-tuple A is said to be DISSIMILAR to another N-tuple B if and only if: Every pair (2-tuple) that occurs in A DOES NOT appear in B Note: For this algorithm, A 2-tuple (pair) is considered SIMILAR/IDENTICAL if it contains the same elements, i.e. (x,y) is considered the same as (y,x). This is a (possible variation on the) classic Urn Problem. A trivial (pseudocode) implementation of this algorithm would be something along the lines of def fetch_unique_tuples(original_set, tuple_size): while True: # randomly select [tuple_size] items from the set to create first set # create a key or hash from the N elements and store in a set # store selected N-tuple in a container if end_condition_met: break I don't think this is the most efficient way of doing this - and though I am no algorithm theorist, I suspect that the time for this algorithm to run is NOT O(n) - in fact, its probably more likely to be O(n!). I am wondering if there is a more efficient way of implementing such an algo, and preferably, reducing the time to O(n). Actually, as Mark Byers pointed out there is a second variable m, which is the size of the number of elements being selected. This (i.e. m) will typically be between 2 and 5. Regarding examples, here would be a typical (albeit shortened) example: original_list = ['CAGG', 'CTTC', 'ACCT', 'TGCA', 'CCTG', 'CAAA', 'TGCC', 'ACTT', 'TAAT', 'CTTG', 'CGGC', 'GGCC', 'TCCT', 'ATCC', 'ACAG', 'TGAA', 'TTTG', 'ACAA', 'TGTC', 'TGGA', 'CTGC', 'GCTC', 'AGGA', 'TGCT', 'GCGC', 'GCGG', 'AAAG', 'GCTG', 'GCCG', 'ACCA', 'CTCC', 'CACG', 'CATA', 'GGGA', 'CGAG', 'CCCC', 'GGTG', 'AAGT', 'CCAC', 'AACA', 'AATA', 'CGAC', 'GGAA', 'TACC', 'AGTT', 'GTGG', 'CGCA', 'GGGG', 'GAGA', 'AGCC', 'ACCG', 'CCAT', 'AGAC', 'GGGT', 'CAGC', 'GATG', 'TTCG'] # Select 3-tuples from the original list should produce a list (or set) similar to: [('CAGG', 'CTTC', 'ACCT') ('CAGG', 'TGCA', 'CCTG') ('CAGG', 'CAAA', 'TGCC') ('CAGG', 'ACTT', 'ACCT') ('CAGG', 'CTTG', 'CGGC') .... ('CTTC', 'TGCA', 'CAAA') ] [[Edit]] Actually, in constructing the example output, I have realized that the earlier definition I gave for UNIQUENESS was incorrect. I have updated my definition and have introduced a new metric of DISSIMILARITY instead, as a result of this finding.

    Read the article

  • Is there some way to make variables like $a and $b in regard to strict?

    - by Axeman
    In light of Michael Carman's comment, I have decided to rewrite the question. Note that 11 comments appear before this edit, and give credence to Michael's observation that I did not write the question in a way that made it clear what I was asking. Question: What is the standard--or cleanest way--to fake the special status that $a and $b have in regard to strict by simply importing a module? First of all some setup. The following works: #!/bin/perl use strict; print "\$a=$a\n"; print "\$b=$b\n"; If I add one more line: print "\$c=$c\n"; I get an error at compile time, which means that none of my dazzling print code gets to run. If I comment out use strict; it runs fine. Outside of strictures, $a and $b are mainly special in that sort passes the two values to be compared with those names. my @reverse_order = sort { $b <=> $a } @unsorted; Thus the main functional difference about $a and $b--even though Perl "knows their names"--is that you'd better know this when you sort, or use some of the functions in List::Util. It's only when you use strict, that $a and $b become special variables in a whole new way. They are the only variables that strict will pass over without complaining that they are not declared. : Now, I like strict, but it strikes me that if TIMTOWTDI (There is more than one way to do it) is Rule #1 in Perl, this is not very TIMTOWDI. It says that $a and $b are special and that's it. If you want to use variables you don't have to declare $a and $b are your guys. If you want to have three variables by adding $c, suddenly there's a whole other way to do it. Nevermind that in manipulating hashes $k and $v might make more sense: my %starts_upper_1_to_25 = skim { $k =~ m/^\p{IsUpper}/ && ( 1 <= $v && $v <= 25 ) } %my_hash ;` Now, I use and I like strict. But I just want $k and $v to be visible to skim for the most compact syntax. And I'd like it to be visible simply by use Hash::Helper qw<skim>; I'm not asking this question to know how to black-magic it. My "answer" below, should let you know that I know enough Perl to be dangerous. I'm asking if there is a way to make strict accept other variables, or what is the cleanest solution. The answer could well be no. If that's the case, it simply does not seem very TIMTOWTDI.

    Read the article

  • Hibernate/Spring: getHibernateTemplate().save(...) Freezes/Hangs

    - by ashes999
    I'm using Hibernate and Spring with the DAO pattern (all Hibernate dependencies in a *DAO.java class). I have nine unit tests (JUnit) which create some business objects, save them, and perform operations on them; the objects are in a hash (so I'm reusing the same objects all the time). My JUnit setup method calls my DAO.deleteAllObjects() method which calls getSession().createSQLQuery("DELETE FROM <tablename>").executeUpdate() for my business object table (just one). One of my unit tests (#8/9) freezes. I presumed it was a database deadlock, because the Hibernate log file shows my delete statement last. However, debugging showed that it's simply HibernateTemplate.save(someObject) that's freezing. (Eclipse shows that it's freezing on HibernateTemplate.save(Object), line 694.) Also interesting to note is that running this test by itself (not in the suite of 9 tests) doesn't cause any problems. How on earth do I troubleshoot and fix this? Also, I'm using @Entity annotations, if that matters. Edit: I removed reuse of my business objects (use unique objects in every method) -- didn't make a difference (still freezes). Edit: This started trickling into other tests, too (can't run more than one test class without getting something freezing) Transaction configuration: <bean id="txManager" class="org.springframework.jdbc.datasource.DataSourceTransactionManager"> <property name="dataSource" ref="dataSource" /> </bean> <tx:advice id="txAdvice" transaction-manager="txManager"> <!-- the transactional semantics... --> <tx:attributes> <!-- all methods starting with 'get' are read-only --> <tx:method name="get*" read-only="true" /> <tx:method name="find*" read-only="true" /> <!-- other methods use the default transaction settings (see below) --> <tx:method name="*" /> </tx:attributes> </tx:advice> <!-- my bean which is exhibiting the hanging behavior --> <aop:config> <aop:pointcut id="beanNameHere" expression="execution(* com.blah.blah.IMyDAO.*(..))" /> <aop:advisor advice-ref="txAdvice" pointcut-ref="beanNameHere" /> </aop:config>

    Read the article

  • Please Describe Your Struggles with Minimizing Use of Global Variables

    - by MetaHyperBolic
    Most of the programs I write are relatively flowchartable processes, with a defined start and hoped-for end. The problems themselves can be complex but do not readily lean towards central use of objects and event-driven programming. Often, I am simply churning through great varied batches of text data to produce different text data. Only occasionally do I need to create a class: As an example, to track warnings, errors, and debugging message, I created a class (Problems) with one instantiation (myErr), which I believe to be an example of the Singleton design pattern. As a further factor, my colleagues are more old school (procedural) than I and are unacquainted with object-oriented programming, so I am loath to create things they could not puzzle through. And yet I hear, again and again, how even the Singleton design pattern is really an anti-pattern and ought to be avoided because Global Variables Are Bad. Minor functions need few arguments passed to them and have no need to know of configuration (unchanging) or program state (changing) -- I agree. However, the functions in the middle of the chain, which primarily control program flow, have a need for a large number of configuration variables and some program state variables. I believe passing a dozen or more arguments along to a function is a "solution," but hardly an attractive one. I could, of course, cram variables into a single hash/dict/associative array, but that seems like cheating. For instance, connecting to the Active Directory to make a new account, I need such configuration variables as an administrative username, password, a target OU, some default groups, a domain, etc. I would have to pass those arguments down through a variety of functions which would not even use them, merely shuffle them off down through a chain which would eventually lead to the function that actually needs them. I would at least declare the configuration variables to be constant, to protect them, but my language of choice these days (Python) provides no simple manner to do this, though recipes do exist as workarounds. Numerous Stack Overflow questions have hit on the why? of the badness and the requisite shunning, but do not often mention tips on living with this quasi-religious restriction. How have you resolved, or at least made peace with, the issue of global variables and program state? Where have you made compromises? What have your tricks been, aside from shoving around flocks of arguments to functions?

    Read the article

  • How to merge two test into one RSpec

    - by thefonso
    Both the last two test work individually...but when both are set to run (non pending) I get problems. question: can I create a test that merges the two into one? How would this look?(yes, I am new to rspec) require_relative '../spec_helper' # the universe is vast and infinite....and...it is empty describe "tic tac toe game" do context "the game class" do before (:each) do player_h = Player.new("X") player_c = Player.new("O") @game = Game.new(player_h, player_c) end it "method drawgrid must return a 3x3 game grid" do @game.drawgrid.should eq("\na #{$thegrid[:a1]}|#{$thegrid[:a2]}|#{$thegrid[:a3]} \n----------\nb #{$thegrid[:b1]}|#{$thegrid[:b2]}|#{$thegrid[:b3]} \n----------\nc #{$thegrid[:c1]}|#{$thegrid[:c2]}|#{$thegrid[:c3]} \n----------\n 1 2 3 \n") @game.drawgrid end #FIXME - last two test here - how to merge into one? it "play method must display 3x3 game grid" do STDOUT.should_receive(:puts).and_return("\na #{$thegrid[:a1]}|#{$thegrid[:a2]}|#{$thegrid[:a3]} \n----------\nb #{$thegrid[:b1]}|#{$thegrid[:b2]}|#{$thegrid[:b3]} \n----------\nc #{$thegrid[:c1]}|#{$thegrid[:c2]}|#{$thegrid[:c3]} \n----------\n 1 2 3 \n").with("computer move") @game.play end it "play method must display 3x3 game grid" do STDOUT.should_receive(:puts).with("computer move") @game.play end end end just for info here is the code containing the play method require_relative "player" # #Just a Tic Tac Toe game class class Game #create players def initialize(player_h, player_c) #bring into existence the board and the players @player_h = player_h @player_c = player_c #value hash for the grid lives here $thegrid = { :a1=>" ", :a2=>" ", :a3=>" ", :b1=>" ", :b2=>" ", :b3=>" ", :c1=>" ", :c2=>" ", :c3=>" " } #make a global var for drawgrid which is used by external player class $gamegrid = drawgrid end #display grid on console def drawgrid board = "\n" board << "a #{$thegrid[:a1]}|#{$thegrid[:a2]}|#{$thegrid[:a3]} \n" board << "----------\n" board << "b #{$thegrid[:b1]}|#{$thegrid[:b2]}|#{$thegrid[:b3]} \n" board << "----------\n" board << "c #{$thegrid[:c1]}|#{$thegrid[:c2]}|#{$thegrid[:c3]} \n" board << "----------\n" board << " 1 2 3 \n" return board end #start the game def play #draw the board puts drawgrid #external call to player class @player = @player_c.move_computer("O") end end player_h = Player.new("X") player_c = Player.new("O") game = Game.new(player_h, player_c) game.play

    Read the article

  • What's the purpose of arrays starting with nonzero index?

    - by helios35
    I tried to find answers, but all I got was answers on how to realize arrays starting with nonzero indexes. Some languages, such as pascal, provide this by default, e.g., you can create an array such as var foobar: array[1..10] of string; I've always been wondering: Why would you want to have the array index not to start with 0? I guess it may be more familiar for beginners to have arrays starting with 1 and the last index being the size of the array, but on a long-term basis, programmers should get used to values starting with 0. Another purpose I could think of: In some cases, the index could actually represent something thats contained in the respective array-entry. e.g., you want to get all capital letters in an array, it may be handy to have an index being the ASCII-Code of the respective letter. But its pretty easy just to subtract a constant value. In this example, you could (in C) simply do something like this do get all capital letters and access the letter with ascii-code 67: #define ASCII_SHIFT 65 main() { int capital_letters[26]; int i; for (i=0; i<26; i++){ capital_letters[i] = i+ASCII_SHIFT; } printf("%c\n", capital_letters[67-ASCII_SHIFT]); } Also, I think you should use hash tables if you want to access entries by some sort of key. Someone might retort: Why should the index always start with 0? Well, it's a hell of a lot simpler this way. You'll be faster when you just have to type one index when declaring an array. Also, you can always be sure that the first entry is array[0] and the last one is array[length_of_array-1]. It is also common that other data structures start with 0. e.g., if you read a binary file, you start with the 0th byte, not the first. Now, why do some programming languages have this "feature" and why do some people ask how to achieve this in languages such as C/C++?, is there any situation where an array starting with a nonzero index is way more useful, or even, something simply cannot be done with an array starting at 0?

    Read the article

  • Registration form validation not validating

    - by jgray
    I am a noob when it comes to web development. I am trying to validate a registration form and to me it looks right but it will not validate.. This is what i have so far and i am validating through a repository or database. Any help would be greatly appreciated. thanks <?php session_start(); $title = "User Registration"; $keywords = "Name, contact, phone, e-mail, registration"; $description = "user registration becoming a member."; require "partials/_html_header.php"; //require "partials/_header.php"; require "partials/_menu.php"; require "DataRepository.php"; // if all validation passed save user $db = new DataRepository(); // form validation goes here $first_nameErr = $emailErr = $passwordErr = $passwordConfirmErr = ""; $first_name = $last_name = $email = $password = $passwordConfirm = ""; if(isset($_POST['submit'])) { $valid = TRUE; // check if all fields are valid { if ($_SERVER["REQUEST_METHOD"] == "POST") { if (empty($_POST["first_name"])) {$first_nameErr = "Name is required";} else { // $first_name = test_input($_POST["first_name"]); // check if name only contains letters and whitespace if (!preg_match("/^[a-zA-Z ]*$/",$first_name)) { $first_nameErr = "Only letters and white space allowed"; } } if (empty($_POST["email"])) {$emailErr = "Email is required";} else { // $email = test_input($_POST["email"]); // check if e-mail address syntax is valid if (!preg_match("/([\w\-]+\@[\w\-]+\.[\w\-]+)/",$email)) { $emailErr = "Invalid email format"; } } if (!preg_match("/(......)/",$password)) { $passwordErr = "Subject must contain THREE or more characters!"; } if ($_POST['password']!= $_POST['passwordConfirm']) { echo("Oops! Password did not match! Try again. "); } function test_input($data) { $data = trim($data); $data = stripslashes($data); $data = htmlspecialchars($data); return $data; } } } if(!$db->isEmailUnique($_POST['email'])) { $valid = FALSE; //display errors in the correct places } // if still valid save the user if($valid) { $new_user = array( 'first_name' => $_POST['first_name'], 'last_name' => $_POST['last_name'], 'email' => $_POST['email'], 'password' => $_POST['password'] ); $results = $db->saveUser($new_user); if($results == TRUE) { header("Location: login.php"); } else { echo "WTF!"; exit; } } } ?> <head> <style> .error {color: #FF0000;} </style> </head> <h1 class="center"> World Wide Web Creations' User Registration </h1> <p><span class="error"></span><p> <form method="POST" action="<?php echo htmlspecialchars($_SERVER["PHP_SELF"]);?>" onsubmit="return validate_form()" > First Name: <input type="text" name="first_name" id="first_name" value="<?php echo $first_name;?>" /> <span class="error"> <?php echo $first_nameErr;?></span> <br /> <br /> Last Name(Optional): <input type="text" name="last_name" id="last_name" value="<?php echo $last_name;?>" /> <br /> <br /> E-mail: <input type="email" name="email" id="email" value="<?php echo $email;?>" /> <span class="error"> <?php echo $emailErr;?></span> <br /> <br /> Password: <input type="password" name="password" id="password" value="" /> <span class="error"> <?php echo $passwordErr;?></span> <br /> <br /> Confirmation Password: <input type="password" name="passwordConfirm" id="passwordConfirm" value="" /> <span class="error"> <?php echo $passwordConfirmErr;?></span> <br /> <br /> <br /> <br /> <input type="submit" name="submit" id="submit" value="Submit Data" /> <input type="reset" name="reset" id="reset" value="Reset Form" /> </form> </body> </html> <?php require "partials/_footer.php"; require "partials/_html_footer.php"; ?> class DataRepository { // version number private $version = "1.0.3"; // turn on and off debugging private static $debug = FALSE; // flag to (re)initialize db on each call private static $initialize_db = FALSE; // insert test data on initialization private static $load_default_data = TRUE; const DATAFILE = "203data.txt"; private $data = NULL; private $errors = array(); private $user_fields = array( 'id' => array('required' => 0), 'created_at' => array('required' => 0), 'updated_at' => array('required' => 0), 'first_name' => array('required' => 1), 'last_name' => array('required' => 0), 'email' => array('required' => 1), 'password' => array('required' => 1), 'level' => array('required' => 0, 'default' => 2), ); private $post_fields = array( 'id' => array('required' => 0), 'created_at' => array('required' => 0), 'updated_at' => array('required' => 0), 'user_id' => array('required' => 1), 'title' => array('required' => 1), 'message' => array('required' => 1), 'private' => array('required' => 0, 'default' => 0), ); private $default_user = array( 'id' => 1, 'created_at' => '2013-01-01 00:00:00', 'updated_at' => '2013-01-01 00:00:00', 'first_name' => 'Admin Joe', 'last_name' => 'Tester', 'email' => '[email protected]', 'password' => 'a94a8fe5ccb19ba61c4c0873d391e987982fbbd3', 'level' => 1, ); private $default_post = array( 'id' => 1, 'created_at' => '2013-01-01 00:00:00', 'updated_at' => '2013-01-01 00:00:00', 'user_id' => 1, 'title' => 'My First Post', 'message' => 'This is the message of the first post.', 'private' => 0, ); // constructor will load existing data into memory // if it does not exist it will create it and initialize if desired public function __construct() { // check if need to reset if(DataRepository::$initialize_db AND file_exists(DataRepository::DATAFILE)) { unlink(DataRepository::DATAFILE); } // if file doesn't exist, create the initial datafile if(!file_exists(DataRepository::DATAFILE)) { $this->log("Data file does not exist. Attempting to create it... (".__FUNCTION__.":".__LINE__.")"); // create initial file $this->data = array( 'users' => array( ), 'posts' => array() ); // load default data if needed if(DataRepository::$load_default_data) { $this->data['users'][1] = $this->default_user; $this->data['posts'][1] = $this->default_post; } $this->writeTheData(); } // load the data into memory for use $this->loadTheData(); } private function showErrors($break = TRUE, $type = NULL) { if(count($this->errors) > 0) { echo "<div style=\"color:red;font-weight: bold;font-size: 1.3em\":<h3>$type Errors</h3><ol>"; foreach($this->errors AS $error) { echo "<li>$error</li>"; } echo "</ol></div>"; if($break) { "</br></br></br>Exiting because of errors!"; exit; } } } private function writeTheData() { $this->log("Attempting to write the datafile: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); file_put_contents(DataRepository::DATAFILE, json_encode($this->data)); $this->log("Datafile written: ".DataRepository::DATAFILE." (line: ".__LINE__.")"); } private function loadTheData() { $this->log("Attempting to load the datafile: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); $this->data = json_decode(file_get_contents(DataRepository::DATAFILE), true); $this->log("Datafile loaded: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")", $this->data); } private function validateFields(&$info, $fields, $pre_errors = NULL) { // merge in any pre_errors if($pre_errors != NULL) { $this->errors = array_merge($this->errors, $pre_errors); } // check all required fields foreach($fields AS $field => $reqs) { if(isset($reqs['required']) AND $reqs['required'] == 1) { if(!isset($info[$field]) OR strlen($info[$field]) == 0) { $this->errors[] = "$field is a REQUIRED field"; } } // set any default values if not present if(isset($reqs['default']) AND (!isset($info[$field]) OR $info[$field] == "")) { $info[$field] = $reqs['default']; } } $this->showErrors(); if(count($this->errors) == 0) { return TRUE; } else { return FALSE; } } private function validateUser(&$user_info) { // check if the email is already in use $this->log("About to check pre_errors: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")", $user_info); $pre_errors = NULL; if(isset($user_info['email'])) { if(!$this->isEmailUnique($user_info['email'])) { $pre_errors = array('The email: '.$user_info['email'].' is already used in our system'); } } $this->log("After pre_error check: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")", $pre_errors); return $this->validateFields($user_info, $this->user_fields, $pre_errors); } private function validatePost(&$post_info) { // check if the user_id in the post actually exists $this->log("About to check pre_errors: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")", $post_info); $pre_errors = NULL; if(isset($post_info['user_id'])) { if(!isset($this->data['users'][$post_info['user_id']])) { $pre_errors = array('The posts must belong to a valid user. (User '.$post_info['user_id'].' does not exist in the data'); } } $this->log("After pre_error check: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")", $pre_errors); return $this->validateFields($post_info, $this->post_fields, $pre_errors); } private function log($message, $data = NULL) { $style = "background-color: #F8F8F8; border: 1px solid #DDDDDD; border-radius: 3px; font-size: 13px; line-height: 19px; overflow: auto; padding: 6px 10px;"; if(DataRepository::$debug) { if($data != NULL) { $dump = "<div style=\"$style\"><pre>".json_encode($data, JSON_PRETTY_PRINT)."</pre></div>"; } else { $dump = NULL; } echo "<code><b>Debug:</b> $message</code>$dump<br />"; } } public function saveUser($user_info) { $this->log("Entering saveUser: (".__FUNCTION__.":".__LINE__.")", $user_info); $mydata = array(); $update = FALSE; // check for existing data if(isset($user_info['id']) AND $this->data['users'][$user_info['id']]) { $mydata = $this->data['users'][$user_info['id']]; $this->log("Loaded prior user: ".print_r($mydata, TRUE)." (".__FUNCTION__.":".__LINE__.")"); } // copy over existing values $this->log("Before copying over existing values: (".__FUNCTION__.":".__LINE__.")", $mydata); foreach($user_info AS $k => $v) { $mydata[$k] = $user_info[$k]; } $this->log("After copying over existing values: (".__FUNCTION__.":".__LINE__.")", $mydata); // check required fields if($this->validateUser($mydata)) { // hash password if new if(isset($mydata['password'])) { $mydata['password'] = sha1($mydata['password']); } // if no id, add the next available one if(!isset($mydata['id']) OR (int)$mydata['id'] < 1) { $this->log("No id set: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); if(count($this->data['users']) == 0) { $mydata['id'] = 1; $this->log("Setting id to 1: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); } else { $mydata['id'] = max(array_keys($this->data['users']))+1; $this->log("Found max id and added 1 [".$mydata['id']."]: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); } } // set created date if null if(!isset($mydata['created_at'])) { $mydata['created_at'] = date ("Y-m-d H:i:s", time()); } // update modified time $mydata['modified_at'] = date ("Y-m-d H:i:s", time()); // copy into data and save $this->log("Before data save: (".__FUNCTION__.":".__LINE__.")", $this->data); $this->data['users'][$mydata['id']] = $mydata; $this->writeTheData(); } return TRUE; } public function getUserById($id) { if(isset($this->data['users'][$id])) { return $this->data['users'][$id]; } else { return array(); } } public function isEmailUnique($email) { // find the user that has the right username/password foreach($this->data['users'] AS $k => $v) { $this->log("Checking unique email: {$v['email']} == $email (".__FUNCTION__.":".__LINE__.")", NULL); if($v['email'] == $email) { $this->log("FOUND NOT unique email: {$v['email']} == $email (".__FUNCTION__.":".__LINE__.")", NULL); return FALSE; break; } } $this->log("Email IS unique: $email (".__FUNCTION__.":".__LINE__.")", NULL); return TRUE; } public function login($username, $password) { // hash password for validation $password = sha1($password); $this->log("Attempting to login with $username / $password: (".__FUNCTION__.":".__LINE__.")", NULL); $user = NULL; // find the user that has the right username/password foreach($this->data['users'] AS $k => $v) { if($v['email'] == $username AND $v['password'] == $password) { $user = $v; break; } } $this->log("Exiting login: (".__FUNCTION__.":".__LINE__.")", $user); return $user; } public function savePost($post_info) { $this->log("Entering savePost: (".__FUNCTION__.":".__LINE__.")", $post_info); $mydata = array(); // check for existing data if(isset($post_info['id']) AND $this->data['posts'][$post_info['id']]) { $mydata = $this->data['posts'][$post_info['id']]; $this->log("Loaded prior posts: ".print_r($mydata, TRUE)." (".__FUNCTION__.":".__LINE__.")"); } $this->log("Before copying over existing values: (".__FUNCTION__.":".__LINE__.")", $mydata); foreach($post_info AS $k => $v) { $mydata[$k] = $post_info[$k]; } $this->log("After copying over existing values: (".__FUNCTION__.":".__LINE__.")", $mydata); // check required fields if($this->validatePost($mydata)) { // if no id, add the next available one if(!isset($mydata['id']) OR (int)$mydata['id'] < 1) { $this->log("No id set: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); if(count($this->data['posts']) == 0) { $mydata['id'] = 1; $this->log("Setting id to 1: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); } else { $mydata['id'] = max(array_keys($this->data['posts']))+1; $this->log("Found max id and added 1 [".$mydata['id']."]: ".DataRepository::DATAFILE." (".__FUNCTION__.":".__LINE__.")"); } } // set created date if null if(!isset($mydata['created_at'])) { $mydata['created_at'] = date ("Y-m-d H:i:s", time()); } // update modified time $mydata['modified_at'] = date ("Y-m-d H:i:s", time()); // copy into data and save $this->data['posts'][$mydata['id']] = $mydata; $this->log("Before data save: (".__FUNCTION__.":".__LINE__.")", $this->data); $this->writeTheData(); } return TRUE; } public function getAllPosts() { return $this->loadPostsUsers($this->data['posts']); } public function loadPostsUsers($posts) { foreach($posts AS $id => $post) { $posts[$id]['user'] = $this->getUserById($post['user_id']); } return $posts; } public function dump($line_number, $temp = 'NO') { // if(DataRepository::$debug) { if($temp == 'NO') { $temp = $this->data; } echo "<pre>Dumping from line: $line_number\n"; echo json_encode($temp, JSON_PRETTY_PRINT); echo "</pre>"; } } } /* * Change Log * * 1.0.0 * - first version * 1.0.1 * - Added isEmailUnique() function for form validation and precheck on user save * 1.0.2 * - Fixed getAllPosts() to include the post's user info * - Added loadPostsUsers() to load one or more posts with their user info * 1.0.3 * - Added autoload to always add admin Joe. */

    Read the article

  • PHP send batch email [closed]

    - by qalbiol
    Possible Duplicate: Sending mass email using PHP I have a PHP script that sends an individual email to all users in my DB, such as a monthly / weekly newsletter. The code I am using goes as follows: $subject = $_POST['subject']; $message = $_POST['message']; // Get all the mailing list subscribers. $query = $db->prepare("SELECT * FROM maildb"); $query->execute(); // Loop through all susbcribers, and send and individual email. foreach ($query as $row) { // Setting maximum time limit to infinite. set_time_limit(0); $newMessage = '<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> </head> <body>'; // Search for the [unsubscribe] tag and replace it with a URL for the user to unsubscribe $newMessage .= str_replace("[unsubscribe]", "<a href='".BASE_URL."unsubscribe/".$row['hash']."/".$row['email']."'>unsubscribe</a>", $message); $newMessage .= '</body></html>'; $to = $row['email']; // Establish content headers $headers = "From: [email protected]"."\n"; $headers .= "Reply-To: [email protected]"."\n"; $headers .= "X-Mailer: PHP v.". phpversion()."\n"; $headers .= "MIME-Version: 1.0"."\n"; $headers .= "Content-Type: text/html; charset=iso-8859-1"."\n"; $headers .= "Content-Transfer-Encoding: 8bit;"; mail($to, $subject, $newMessage, $headers); // Send email to each individual user } This code works perfectly with a REALLY small database... I recently populated my test db with 200k+ users, and obviously this script fails, gets out of memory, and dies... I know this is a bad way to send so many emails, thats why I'd like to ask you for much more efficient ways to do this! Thank you very much!

    Read the article

  • Postfix/SMTPD Relay Access Denied when sending outside the network

    - by David
    I asked a very similar question some 4 or 5 months ago, but haven't tracked down a suitable answer. I decided to post a new question so that I can ... a) Post updated info b) post my most current postconf -n output When a user sends mail from inside the network (via webmail) to email addresses both inside and outside the network, the email is delivered. When a user with an email account on the system sends mail from outside the network, using the server as the relay, to addresses inside the network, the email is delivered. But [sometimes] when a user connects via SMTPD to send email to an external address, a Relay Access Denied error is returned: Feb 25 19:33:49 myers postfix/smtpd[8044]: NOQUEUE: reject: RCPT from host-68-169-158-182.WISOLT2.epbfi.com[68.169.158.182]: 554 5.7.1 <host-68-169-158-182.WISOLT2.epbfi.com[68.169.158.182]>: Client host rejected: Access denied; from=<[email protected]> to=<[email protected]> proto=ESMTP helo=<my-computer-name> Feb 25 19:33:52 myers postfix/smtpd[8044]: disconnect from host-68-169-158-182.WISOLT2.epbfi.com[68.169.158.182] Sending this through Microsoft Outlook 2003 generates the above log. However, sending through my iPhone, with the exact same settings, goes through fine: Feb 25 19:37:18 myers postfix/qmgr[3619]: A2D861302C9: from=<[email protected]>, size=1382, nrcpt=1 (queue active) Feb 25 19:37:18 myers amavis[2799]: (02799-09) FWD via SMTP: <[email protected]> -> <[email protected]>,BODY=7BIT 250 2.0.0 Ok, id=02799-09, from MTA([127.0.0.1]:10025): 250 2.0.0 Ok: queued as A2D861302C9 Feb 25 19:37:18 myers amavis[2799]: (02799-09) Passed CLEAN, [68.169.158.182] [68.169.158.182] <[email protected]> -> <[email protected]>, Message-ID: <[email protected]>, mail_id: yMLvzVQJloFV, Hits: -9.607, size: 897, queued_as: A2D861302C9, 6283 ms Feb 25 19:37:18 myers postfix/lmtp[8752]: 2ED3A1302C8: to=<[email protected]>, relay=127.0.0.1[127.0.0.1]:10024, delay=6.6, delays=0.25/0.01/0.19/6.1, dsn=2.0.0, status=sent (250 2.0.0 Ok, id=02799-09, from MTA([127.0.0.1]:10025): 250 2.0.0 Ok: queued as A2D861302C9) Feb 25 19:37:18 myers postfix/qmgr[3619]: 2ED3A1302C8: removed Outgoing Settings on Outlook 2003 match the settings on my iPhone: SMTP server: mail.my-domain.com Username: My full email address Uses SSL Server Port 587 Now, here's postconf -n. I realize the "My Networks" Parameter is a bit nasty. I have these IP addresses in here for just this reason, as others have been complaining of this problem too: alias_database = hash:/etc/postfix/aliases alias_maps = $alias_database append_dot_mydomain = no biff = no broken_sasl_auth_clients = yes command_directory = /usr/sbin config_directory = /etc/postfix content_filter = amavisfeed:[127.0.0.1]:10024 daemon_directory = /usr/libexec/postfix debug_peer_level = 2 disable_vrfy_command = yes html_directory = no inet_interfaces = all mail_owner = postfix mail_spool_directory = /var/spool/mail mailbox_size_limit = 0 mailq_path = /usr/bin/mailq manpage_directory = /usr/share/man message_size_limit = 20480000 mydestination = $myhostname, localhost, localhost.$mydomain mydomain = my-domain.com myhostname = myers.my-domain.com mynetworks = 127.0.0.0/8, 74.125.113.27, 74.125.82.49, 74.125.79.27, 209.85.161.0/24, 209.85.214.0/24, 209.85.216.0/24, 209.85.212.0/24, 209.85.160.0/24 myorigin = $myhostname newaliases_path = /usr/bin/newaliases queue_directory = /var/spool/postfix readme_directory = /usr/share/doc/postfix-2.3.3/README_FILES receive_override_options = no_address_mappings recipient_delimiter = + relay_domains = $mydestination sample_directory = /usr/share/doc/postfix-2.3.3/samples sendmail_path = /usr/sbin/sendmail setgid_group = postdrop smtp_bind_address = my-primary-server's IP address smtpd_banner = mail.my-domain.com smtpd_helo_required = yes smtpd_sasl_auth_enable = yes smtpd_sasl_path = private/auth smtpd_sasl_type = dovecot smtpd_tls_auth_only = yes smtpd_tls_cert_file = /etc/ssl/mailserver/postfix.pem smtpd_tls_key_file = /etc/ssl/mailserver/private/postfix.pem smtpd_tls_loglevel = 3 smtpd_tls_received_header = no smtpd_tls_session_cache_timeout = 3600s smtpd_use_tls = yes tls_random_source = dev:/dev/urandom unknown_local_recipient_reject_code = 554 virtual_alias_maps = mysql:/etc/postfix/mysql-virtual-alias-maps.cf,mysql:/etc/postfix/mysql-email2email.cf virtual_gid_maps = static:5000 virtual_mailbox_base = /var/vmail virtual_mailbox_domains = mysql:/etc/postfix/mysql-virtual-mailbox-domains.cf virtual_mailbox_maps = mysql:/etc/postfix/mysql-virtual-mailbox-maps.cf virtual_minimum_uid = 5000 virtual_transport = dovecot virtual_uid_maps = static:5000 If anyone has any ideas and can help me finally solve this issue once and for all, I'd be eternally grateful.

    Read the article

  • Huawei b153 limit of devices

    - by bdecaf
    I set up my home network all through this 3G wifi router. Problem is it only allows 5 devices to connect. That's not much especially if a wifi printer and gaming consoles keep hogging these slots. On the other hand I don't see the point on blocking these devices. They are (should) not doing anything online just intern in my network. The documentation I can find is surpirisingly unhelpful and focuses how to plug the device in a power socket. So what would be my options. Notes: I have already been able to get a shell on the device using ssh. It's running some Busybox. But I fail to find the how and where this limit is enforced/created. Notes 2: Specifically my device is a 3WebCube - unfortunately not specifically marked with the Huawei Model number. Successes so far After enabling ssh in the options I can login: ssh -T [email protected] [email protected]'s password: ------------------------------- -----Welcome to ATP Cli------ ------------------------------- unfortunately because of this -T - the tab key does not work for autocomplete and all inputted commands will be echoed. Also no history with arrow keys. ATP interface this custom interface is not very useful: ATP>help help Welcome to ATP command line tool. If any question, please input "?" at the end of command. ATP>? ? cls debug help save ? exit ATP>save? save? Command failed. ATP>save ? save ? ATP>debug ? debug ? display set trace ? Shell BUT undocumented - I somehow found on a auto translated chinese website - all you need to do is input sh ATP>sh sh BusyBox vv1.9.1 (2011-03-27 11:59:11 CST) built-in shell (ash) Enter 'help' for a list of built-in commands. # builtin commands # help Built-in commands: ------------------- . : alias bg break cd chdir command continue eval exec exit export false fg getopts hash help jobs kill let local pwd read readonly return set shift source times trap true type ulimit umask unalias unset wait shows standard unix structure: # ls / var tmp proc linuxrc init etc bin usr sbin mnt lib html dev in /bin # ls /bin zebra strace ppps ln echo cat wscd startbsp pppc klog ebtables busybox wlancmd sshd ping kill dns brctl web sntp netstat iwpriv dhcps auth usbdiagd sms mount iwcontrol dhcpc atserver upnp sleep mknod iptables date atcmd upg siproxd mkdir ipcheck cp at umount sh mini_upnpd ip console ash test_at rm mic igmpproxy cms telnetd ripd ls ethcmd cmgr swapdev ps log equipcmd cli in /sbin # ls /sbin vconfig reboot insmod ifconfig arp route poweroff init halt using tftp after installing tftp on my desktop I was able to send files with tftp -s -l curcfg.xml 192.168.1.103 and to download onto the huawei with tftp -g -r curcfg.xml 192.168.1.103 I think I'll need that - because I don't see any editor installed. readout stuff (still playing around where I would get interesting info) For confirmation of hardware: # cat /var/log/modem_hardware_name ^HWVER:"WL1B153M001"# # cat /var/log/modem_software_name 1096.11.03.02.107 # cat /var/log/product_name B153

    Read the article

  • DCOM Authentication Fails to use Kerberos, Falls back to NTLM

    - by Asa Yeamans
    I have a webservice that is written in Classic ASP. In this web service it attempts to create a VirtualServer.Application object on another server via DCOM. This fails with Permission Denied. However I have another component instantiated in this same webservice on the same remote server, that is created without problems. This component is a custom-in house component. The webservice is called from a standalone EXE program that calls it via WinHTTP. It has been verified that WinHTTP is authenticating with Kerberos to the webservice successfully. The user authenticated to the webservice is the Administrator user. The EXE to webservice authentication step is successful and with kerberos. I have verified the DCOM permissions on the remote computer with DCOMCNFG. The default limits allow administrators both local and remote activation, both local and remote access, and both local and remote launch. The default component permissions allow the same. This has been verified. The individual component permissions for the working component are set to defaults. The individual component permissions for the VirtualServer.Application component are also set to defaults. Based upon these settings, the webservice should be able to instantiate and access the components on the remote computer. Setting up a Wireshark trace while running both tests, one with the working component and one with the VirtualServer.Application component reveals an intresting behavior. When the webservice is instantiating the working, custom, component, I can see the request on the wire to the RPCSS endpoint mapper first perform the TCP connect sequence. Then I see it perform the bind request with the appropriate security package, in this case kerberos. After it obtains the endpoint for the working DCOM component, it connects to the DCOM endpoint authenticating again via Kerberos, and it successfully is able to instantiate and communicate. On the failing VirtualServer.Application component, I again see the bind request with kerberos go to the RPCC endpoing mapper successfully. However, when it then attempts to connect to the endpoint in the Virtual Server process, it fails to connect because it only attempts to authenticate with NTLM, which ultimately fails, because the webservice does not have access to the credentials to perform the NTLM hash. Why is it attempting to authenticate via NTLM? Additional Information: Both components run on the same server via DCOM Both components run as Local System on the server Both components are Win32 Service components Both components have the exact same launch/access/activation DCOM permissions Both Win32 Services are set to run as Local System The permission denied is not a permissions issue as far as I can tell, it is an authentication issue. Permission is denied because NTLM authentication is used with a NULL username instead of Kerberos Delegation Constrained delegation is setup on the server hosting the webservice. The server hosting the webservice is allowed to delegate to rpcss/dcom-server-name The server hosting the webservice is allowed to delegate to vssvc/dcom-server-name The dcom server is allowed to delegate to rpcss/webservice-server The SPN's registered on the dcom server include rpcss/dcom-server-name and vssvc/dcom-server-name as well as the HOST/dcom-server-name related SPNs The SPN's registered on the webservice-server include rpcss/webservice-server and the HOST/webservice-server related SPNs Anybody have any Ideas why the attempt to create a VirtualServer.Application object on a remote server is falling back to NTLM authentication causing it to fail and get permission denied? Additional information: When the following code is run in the context of the webservice, directly via a testing-only, just-developed COM component, it fails on the specified line with Access Denied. COSERVERINFO csi; csi.dwReserved1=0; csi.pwszName=L"terahnee.rivin.net"; csi.pAuthInfo=NULL; csi.dwReserved2=NULL; hr=CoGetClassObject(CLSID_VirtualServer, CLSCTX_ALL, &csi, IID_IClassFactory, (void **) &pClsFact); if(FAILED( hr )) goto error1; // Fails here with HRESULT_FROM_WIN32(ERROR_ACCESS_DENIED) hr=pClsFact->CreateInstance(NULL, IID_IUnknown, (void **) &pUnk); if(FAILED( hr )) goto error2; Ive also noticed that in the Wireshark Traces, i see the attempt to connect to the service process component only requests NTLMSSP authentication, it doesnt even attmept to use kerberos. This suggests that for some reason the webservice thinks it cant use kerberos...

    Read the article

  • Cisco ASA (Client VPN) to LAN - through second VPN to second LAN

    - by user50855
    We have 2 site that is linked by an IPSEC VPN to remote Cisco ASAs: Site 1 1.5Mb T1 Connection Cisco(1) 2841 Site 2 1.5Mb T1 Connection Cisco 2841 In addition: Site 1 has a 2nd WAN 3Mb bonded T1 Connection Cisco 5510 that connects to same LAN as Cisco(1) 2841. Basically, Remote Access (VPN) users connecting through Cisco ASA 5510 needs access to a service at the end of Site 2. This is due to the way the service is sold - Cisco 2841 routers are not under our management and it is setup to allow connection from local LAN VLAN 1 IP address 10.20.0.0/24. My idea is to have all traffic from Remote Users through Cisco ASA destined for Site 2 to go via the VPN between Site 1 and Site 2. The end result being all traffic that hits Site 2 has come via Site 1. I'm struggling to find a great deal of information on how this is setup. So, firstly, can anyone confirm that what I'm trying to achieve is possible? Secondly, can anyone help me to correct the configuration bellow or point me in the direction of an example of such a configuration? Many Thanks. interface Ethernet0/0 nameif outside security-level 0 ip address 7.7.7.19 255.255.255.240 interface Ethernet0/1 nameif inside security-level 100 ip address 10.20.0.249 255.255.255.0 object-group network group-inside-vpnclient description All inside networks accessible to vpn clients network-object 10.20.0.0 255.255.255.0 network-object 10.20.1.0 255.255.255.0 object-group network group-adp-network description ADP IP Address or network accessible to vpn clients network-object 207.207.207.173 255.255.255.255 access-list outside_access_in extended permit icmp any any echo-reply access-list outside_access_in extended permit icmp any any source-quench access-list outside_access_in extended permit icmp any any unreachable access-list outside_access_in extended permit icmp any any time-exceeded access-list outside_access_in extended permit tcp any host 7.7.7.20 eq smtp access-list outside_access_in extended permit tcp any host 7.7.7.20 eq https access-list outside_access_in extended permit tcp any host 7.7.7.20 eq pop3 access-list outside_access_in extended permit tcp any host 7.7.7.20 eq www access-list outside_access_in extended permit tcp any host 7.7.7.21 eq www access-list outside_access_in extended permit tcp any host 7.7.7.21 eq https access-list outside_access_in extended permit tcp any host 7.7.7.21 eq 5721 access-list acl-vpnclient extended permit ip object-group group-inside-vpnclient any access-list acl-vpnclient extended permit ip object-group group-inside-vpnclient object-group group-adp-network access-list acl-vpnclient extended permit ip object-group group-adp-network object-group group-inside-vpnclient access-list PinesFLVPNTunnel_splitTunnelAcl standard permit 10.20.0.0 255.255.255.0 access-list inside_nat0_outbound_1 extended permit ip 10.20.0.0 255.255.255.0 10.20.1.0 255.255.255.0 access-list inside_nat0_outbound_1 extended permit ip 10.20.0.0 255.255.255.0 host 207.207.207.173 access-list inside_nat0_outbound_1 extended permit ip 10.20.1.0 255.255.255.0 host 207.207.207.173 ip local pool VPNPool 10.20.1.100-10.20.1.200 mask 255.255.255.0 route outside 0.0.0.0 0.0.0.0 7.7.7.17 1 route inside 207.207.207.173 255.255.255.255 10.20.0.3 1 crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto ipsec security-association lifetime seconds 28800 crypto ipsec security-association lifetime kilobytes 4608000 crypto dynamic-map outside_dyn_map 20 set transform-set ESP-3DES-SHA crypto dynamic-map outside_dyn_map 20 set security-association lifetime seconds 288000 crypto dynamic-map outside_dyn_map 20 set security-association lifetime kilobytes 4608000 crypto dynamic-map outside_dyn_map 20 set reverse-route crypto map outside_map 20 ipsec-isakmp dynamic outside_dyn_map crypto map outside_map interface outside crypto map outside_dyn_map 20 match address acl-vpnclient crypto map outside_dyn_map 20 set security-association lifetime seconds 28800 crypto map outside_dyn_map 20 set security-association lifetime kilobytes 4608000 crypto isakmp identity address crypto isakmp enable outside crypto isakmp policy 20 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 group-policy YeahRightflVPNTunnel internal group-policy YeahRightflVPNTunnel attributes wins-server value 10.20.0.9 dns-server value 10.20.0.9 vpn-tunnel-protocol IPSec password-storage disable pfs disable split-tunnel-policy tunnelspecified split-tunnel-network-list value acl-vpnclient default-domain value YeahRight.com group-policy YeahRightFLVPNTunnel internal group-policy YeahRightFLVPNTunnel attributes wins-server value 10.20.0.9 dns-server value 10.20.0.9 10.20.0.7 vpn-tunnel-protocol IPSec split-tunnel-policy tunnelspecified split-tunnel-network-list value YeahRightFLVPNTunnel_splitTunnelAcl default-domain value yeahright.com tunnel-group YeahRightFLVPN type remote-access tunnel-group YeahRightFLVPN general-attributes address-pool VPNPool tunnel-group YeahRightFLVPNTunnel type remote-access tunnel-group YeahRightFLVPNTunnel general-attributes address-pool VPNPool authentication-server-group WinRadius default-group-policy YeahRightFLVPNTunnel tunnel-group YeahRightFLVPNTunnel ipsec-attributes pre-shared-key *

    Read the article

  • Varnish + Nginx + multiple IP addresses

    - by adnan
    This is my first shot at making Varnish work on my dedicated server which hosts 2 domains with 2 separate IP-addresses. My simplified setup is as follows: Nginx conf server { listen ip-address-1:8080; } server { listen ip-address-2:8080; } Varnish vcl backend default { .host = "127.0.0.1"; .port = "80"; } And in the varnish conf I have defined VARNISH_LISTEN_PORT=80 Varnish and Nginx (and php-fpm) are running properly but when I try to go to my website it shows the welcome to nginx page. The headers don't have the x-varnish in it. It seems that for some reason varnish is not listening to port 80. I'm suspecting this has to do with the vcl file where it is listening to the 127.0.0.1 host. I'm running two wordpress sites. Where should I look for to get Varnish working properly? Cheers, Adnan EDIT: Nginx seems to be in 8080 correctly but Varnish is not listening to the right ip address. Using Jens multiple varnish ip addresses netstat -lnp yields: Proto Recv-Q Send-Q Local Address Foreign Address State PID/Program name tcp 0 0 46.105.40.241:8080 0.0.0.0:* LISTEN 21610/nginx tcp 0 0 5.135.166.39:8080 0.0.0.0:* LISTEN 21610/nginx tcp 0 0 0.0.0.0:80 0.0.0.0:* LISTEN 21610/nginx tcp 0 0 127.0.0.1:53 0.0.0.0:* LISTEN 2544/named tcp 0 0 0.0.0.0:21 0.0.0.0:* LISTEN 1195/vsftpd tcp 0 0 0.0.0.0:22 0.0.0.0:* LISTEN 1184/sshd tcp 0 0 127.0.0.1:953 0.0.0.0:* LISTEN 2544/named tcp 0 0 46.105.40.241:443 0.0.0.0:* LISTEN 21610/nginx tcp 0 0 5.135.166.39:443 0.0.0.0:* LISTEN 21610/nginx tcp 0 0 127.0.0.1:6082 0.0.0.0:* LISTEN 21350/varnishd tcp 0 0 :::80 :::* LISTEN 21351/varnishd tcp 0 0 ::1:53 :::* LISTEN 2544/named tcp 0 0 :::22 :::* LISTEN 1184/sshd tcp 0 0 ::1:953 :::* LISTEN 2544/named udp 0 0 127.0.0.1:53 0.0.0.0:* 2544/named udp 0 0 ::1:53 :::* 2544/named default.vcl backend ikhebeenbril { .host = "5.135.166.39"; .port = "8080"; } backend sunculture { .host = "46.105.40.241"; .port = "8080"; } sub vcl_recv { if (server.ip == "5.135.166.39") { set req.backend = ikhebeenbril; } else { set req.backend = sunculture; } ... } sub vcl_hash { hash_data(server.ip); if (req.http.host) { hash_data(req.http.host); } hash_data(req.url); if (req.http.Accept-Encoding) { hash_data(req.http.Accept-Encoding); } return (hash); } nginx server blocks server { listen 5.135.166.39:80; listen 5.135.166.39:443 default ssl spdy; server_name www.ikhebeenbril.nl; } server { listen 46.105.40.241:80; listen 46.105.40.241:443 default ssl spdy; server_name www.thesunculture.com; }

    Read the article

  • Cisco ASA 5505 site to site IPSEC VPN won't route from multiple LANs

    - by franklundy
    Hi I've set up a standard site to site VPN between 2 ASA 5505s (using the wizard in ASDM) and have the VPN working fine for traffic between Site A and Site B on the directly connected LANs. But this VPN is actually to be used for data originating on LAN subnets that are one hop away from the directly connected LANs. So actually there is another router connected to each ASA (LAN side) that then route to two completely different LAN ranges, where the clients and servers reside. At the moment, any traffic that gets to the ASA that has not originated from the directly connected LAN gets sent straight to the default gateway, and not through the VPN. I've tried adding the additional subnets to the "Protected Networks" on the VPN, but that has no effect. I have also tried adding a static route to each ASA trying to point the traffic to the other side, but again this hasn't worked. Here is the config for one of the sites. This works for traffic to/from the 192.168.144.x subnets perfectly. What I need is to be able to route traffic from 10.1.0.0/24 to 10.2.0.0/24 for example. ASA Version 8.0(3) ! hostname Site1 enable password ** encrypted names name 192.168.144.4 Site2 ! interface Vlan1 nameif inside security-level 100 ip address 192.168.144.2 255.255.255.252 ! interface Vlan2 nameif outside security-level 0 ip address 10.78.254.70 255.255.255.252 (this is a private WAN circuit) ! interface Ethernet0/0 switchport access vlan 2 ! interface Ethernet0/1 ! interface Ethernet0/2 ! interface Ethernet0/3 ! interface Ethernet0/4 ! interface Ethernet0/5 ! interface Ethernet0/6 ! interface Ethernet0/7 ! passwd ** encrypted ftp mode passive access-list inside_access_in extended permit ip any any access-list outside_access_in extended permit icmp any any echo-reply access-list outside_1_cryptomap extended permit ip 192.168.144.0 255.255.255.252 Site2 255.255.255.252 access-list inside_nat0_outbound extended permit ip 192.168.144.0 255.255.255.252 Site2 255.255.255.252 pager lines 24 logging enable logging asdm informational mtu inside 1500 mtu outside 1500 icmp unreachable rate-limit 1 burst-size 1 asdm image disk0:/asdm-603.bin no asdm history enable arp timeout 14400 global (outside) 1 interface nat (inside) 0 access-list inside_nat0_outbound nat (inside) 1 0.0.0.0 0.0.0.0 access-group inside_access_in in interface inside access-group outside_access_in in interface outside route outside 0.0.0.0 0.0.0.0 10.78.254.69 1 timeout xlate 3:00:00 timeout conn 1:00:00 half-closed 0:10:00 udp 0:02:00 icmp 0:00:02 timeout sunrpc 0:10:00 h323 0:05:00 h225 1:00:00 mgcp 0:05:00 mgcp-pat 0:05:00 timeout sip 0:30:00 sip_media 0:02:00 sip-invite 0:03:00 sip-disconnect 0:02:00 timeout uauth 0:05:00 absolute dynamic-access-policy-record DfltAccessPolicy aaa authentication ssh console LOCAL http server enable http 0.0.0.0 0.0.0.0 outside http 192.168.1.0 255.255.255.0 inside no snmp-server location no snmp-server contact snmp-server enable traps snmp authentication linkup linkdown coldstart crypto ipsec transform-set ESP-3DES-SHA esp-3des esp-sha-hmac crypto map outside_map 1 match address outside_1_cryptomap crypto map outside_map 1 set pfs crypto map outside_map 1 set peer 10.78.254.66 crypto map outside_map 1 set transform-set ESP-3DES-SHA crypto map outside_map interface outside crypto isakmp enable outside crypto isakmp policy 10 authentication pre-share encryption 3des hash sha group 2 lifetime 86400 no crypto isakmp nat-traversal telnet timeout 5 ssh 0.0.0.0 0.0.0.0 outside ssh timeout 5 console timeout 0 management-access inside threat-detection basic-threat threat-detection statistics port threat-detection statistics protocol threat-detection statistics access-list group-policy DfltGrpPolicy attributes vpn-idle-timeout none username enadmin password * encrypted privilege 15 tunnel-group 10.78.254.66 type ipsec-l2l tunnel-group 10.78.254.66 ipsec-attributes pre-shared-key * ! ! prompt hostname context

    Read the article

  • Mpd as pppoe server with authorisation by freeradius2

    - by Korjavin Ivan
    I install freeradius2, add to raddb/users: test Cleartext-Password := "test1" Service-Type = Framed-User, Framed-Protocol = PPP, Framed-IP-Address = 10.36.0.2, Framed-IP-Netmask = 255.255.255.0, start radiusd, and check auth: radtest test test1 127.0.0.1 1002 testing123 Sending Access-Request of id 199 to 127.0.0.1 port 1812 User-Name = "test" User-Password = "test1" NAS-IP-Address = 127.0.0.1 NAS-Port = 1002 Message-Authenticator = 0x00000000000000000000000000000000 rad_recv: Access-Accept packet from host 127.0.0.1 port 1812, id=199, length=44 Service-Type = Framed-User Framed-Protocol = PPP Framed-IP-Address = 10.36.0.2 Framed-IP-Netmask = 255.255.255.0 Works fine. Next step. Add to mpd.conf: radius: set auth disable internal set auth max-logins 1 CI set auth enable radius-auth set radius timeout 90 set radius retries 2 set radius server 127.0.0.1 testing123 1812 1813 set radius me 127.0.0.1 create link template L pppoe set link action bundle B set link max-children 1000 set link no multilink set link no shortseq set link no pap chap-md5 chap-msv1 chap-msv2 set link enable chap set pppoe acname Internet load radius create link template em1 L set pppoe iface em1 set link enable incoming And trying to connect, auth failed, here is mpd log: mpd: [em1-2] LCP: auth: peer wants nothing, I want CHAP mpd: [em1-2] CHAP: sending CHALLENGE #1 len: 21 mpd: [em1-2] LCP: LayerUp mpd: [em1-2] CHAP: rec'd RESPONSE #1 len: 58 mpd: [em1-2] Name: "test" mpd: [em1-2] AUTH: Trying RADIUS mpd: [em1-2] RADIUS: Authenticating user 'test' mpd: [em1-2] RADIUS: Rec'd RAD_ACCESS_REJECT for user 'test' mpd: [em1-2] AUTH: RADIUS returned: failed mpd: [em1-2] AUTH: ran out of backends mpd: [em1-2] CHAP: Auth return status: failed mpd: [em1-2] CHAP: Reply message: ^AE=691 R=1 mpd: [em1-2] CHAP: sending FAILURE #1 len: 14 mpd: [em1-2] LCP: authorization failed Then i start freeradius as radiusd -fX, and get this log: rad_recv: Access-Request packet from host 127.0.0.1 port 46400, id=223, length=282 NAS-Identifier = "rubin.svyaz-nt.ru" NAS-IP-Address = 127.0.0.1 Message-Authenticator = 0x14d36639bed8074ec2988118125367ea Acct-Session-Id = "815965-em1-2" NAS-Port = 2 NAS-Port-Type = Ethernet Service-Type = Framed-User Framed-Protocol = PPP Calling-Station-Id = "00e05290b3e3 / 00:e0:52:90:b3:e3 / em1" NAS-Port-Id = "em1" Vendor-12341-Attr-12 = 0x656d312d32 Tunnel-Medium-Type:0 = IEEE-802 Tunnel-Client-Endpoint:0 = "00:e0:52:90:b3:e3" User-Name = "test" MS-CHAP-Challenge = 0xbb1e68d5bbc30f228725a133877de83e MS-CHAP2-Response = 0x010088746ae65b68e435e9d045ad6f9569b60000000000000000b56991b4f20704cb6c68e5982eec5e98a7f4b470c109c1b9 # Executing section authorize from file /usr/local/etc/raddb/sites-enabled/default +- entering group authorize {...} ++[preprocess] returns ok ++[chap] returns noop [mschap] Found MS-CHAP attributes. Setting 'Auth-Type = mschap' ++[mschap] returns ok [eap] No EAP-Message, not doing EAP ++[eap] returns noop [files] users: Matched entry DEFAULT at line 172 ++[files] returns ok Found Auth-Type = MSCHAP # Executing group from file /usr/local/etc/raddb/sites-enabled/default +- entering group MS-CHAP {...} [mschap] No Cleartext-Password configured. Cannot create LM-Password. [mschap] No Cleartext-Password configured. Cannot create NT-Password. [mschap] Creating challenge hash with username: test [mschap] Client is using MS-CHAPv2 for test, we need NT-Password [mschap] FAILED: No NT/LM-Password. Cannot perform authentication. [mschap] FAILED: MS-CHAP2-Response is incorrect ++[mschap] returns reject Failed to authenticate the user. Login incorrect: [test] (from client localhost port 2 cli 00e05290b3e3 / 00:e0:52:90:b3:e3 / em1) Using Post-Auth-Type REJECT # Executing group from file /usr/local/etc/raddb/sites-enabled/default +- entering group REJECT {...} [attr_filter.access_reject] expand: %{User-Name} -> test attr_filter: Matched entry DEFAULT at line 11 ++[attr_filter.access_reject] returns updated Delaying reject of request 2 for 1 seconds Going to the next request Waking up in 0.9 seconds. Sending delayed reject for request 2 Sending Access-Reject of id 223 to 127.0.0.1 port 46400 MS-CHAP-Error = "\001E=691 R=1" Why i have error "[mschap] No Cleartext-Password configured. Cannot create LM-Password." ? I define cleartext-password in users. I check raddb/sites-enabled/default authorize { chap mschap eap { ok = return } files } looks ok for me. Whats wrong with mpd/chap/radius ?

    Read the article

  • Varnish cached 'MISS status' object?

    - by Hesey
    My site uses nginx, varnish, jboss. And some url will be cached by varnish, it depends a response header from jboss. The first time, jboss tells varnish doesn't cache this url. Then the second request, jboss tells varnish to cache, but varnish won't cache it. I used varnishstat and found that 1 object is cached in Varnish, is that the 'MISS status' object? I remove grace code and the problem still exists. When I PURGE this url, varnish works fine and cache the url then. But I can't PURGE so much urls every startup time, how can I fix this? The configuration: acl local { "localhost"; } backend default { .host = "localhost"; .port = "8080"; .probe = { .url = "/preload.htm"; .interval = 3s; .timeout = 1s; .window = 5; .threshold = 3; } } sub vcl_deliver { if (req.request == "PURGE") { remove resp.http.X-Varnish; remove resp.http.Via; remove resp.http.Age; remove resp.http.Content-Type; remove resp.http.Server; remove resp.http.Date; remove resp.http.Accept-Ranges; remove resp.http.Connection; set resp.http.keeplive="true"; } else { if (obj.hits > 0) { set resp.http.X-Cache = "HIT"; } else { set resp.http.X-Cache = "MISS"; } } } sub vcl_recv { if(req.url ~ "/check.htm"){ error 404 "N"; } if( req.http.host ~ "store." || req.request == "POST"){ return (pipe); } if (req.backend.healthy) { set req.grace = 30s; } else { set req.grace = 10m; } set req.http.x-cacheKey = "0"; if(req.url ~ "/shop/view_shop.htm" || req.url ~ "/shop/viewShop.htm" || req.url ~ "/index.htm"){ if(req.url ~ "search=y"){ set req.http.x-cacheKey = req.http.host + "/search.htm"; }else if(req.url !~ "bbs=y" && req.url !~ "shopIntro=y" && req.url !~ "shop_intro=y"){ set req.http.x-cacheKey = req.http.host + "/index.htm"; } }else if(req.url ~ "/search"){ set req.http.x-cacheKey = req.http.host + "/search.htm"; } if( req.http.x-cacheKey == "0" && req.url !~ "/i/"){ return (pipe); } if (req.request == "PURGE") { if (client.ip ~ local) { return (lookup); } else { error 405 "Not allowed."; } } if (req.url ~ "/i/") { set req.http.x-shop-url = req.original_url; }else { unset req.http.cookie; } } sub vcl_fetch { set beresp.grace = 10m; #unset beresp.http.x-cacheKey; if (req.url ~ "/i/" || req.url ~ "status" ){ set beresp.ttl = 0s; /* ttl=0 for dynamic content */ } else if(beresp.http.x-varnish-cache != "1"){ set beresp.do_esi = true; /* Do ESI processing */ set beresp.ttl = 0s; unset beresp.http.set-cookie; } else { set beresp.do_esi = true; /* Do ESI processing */ set beresp.ttl = 1800s; unset beresp.http.set-cookie; } } sub vcl_hash { hash_data(req.http.x-cacheKey); return (hash); } sub vcl_error { if (req.request == "PURGE") { return (deliver); } else { set obj.http.Content-Type = "text/html; charset=gbk"; synthetic {"<!--ve-->"}; return (deliver); } } sub vcl_hit { if (req.request == "PURGE") { set obj.ttl = 0s; error 200 "Purged."; } } sub vcl_miss { if (req.request == "PURGE") { error 404 "N"; } }

    Read the article

< Previous Page | 86 87 88 89 90 91 92 93 94 95  | Next Page >