Search Results

Search found 18841 results on 754 pages for 'path finding'.

Page 90/754 | < Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >

  • A tool for finding duplicate code in PHP

    - by Toby
    Are there any tools available that can scan multiple .php files and report back duplicated lines/chunks of code? It doesn't have to be really smart but basically give me a starting point for manual scans to improve the codebase of some of my apps.

    Read the article

  • Finding images on the web

    - by Britt
    I sent someone a photo of me and they replied that this particular photo was all over the web. How do I find out where this photo is and is there any way that I can see if there are other photos of myself that someoe has shared without my knowledge? I am very worried about this and want to find out where these pictures are please help me!

    Read the article

  • Finding object count where a field is unique in Django

    - by Johnd
    I have a model that is something like this: class Input(models.Model): details = models.CharField(max_length=1000) user = models.ForeignKey(User) class Case(Input): title = models.CharField(max_length=200) views = models.IntegerField() class Argument(Input): case = models.ForeignKey(Case) side = models.BooleanField() A user can submit many arguments, per case. I want to be able to say how many users have submitted side=true arguments. I mean if 1 user had 10 arguments and another user had 2 arguments (both side=true) I'd want the count to be 2, not 12.

    Read the article

  • Finding number of different paths

    - by peiska
    I have a game that one player X wants to pass a ball to player Y, but he can be playing with more than one player and the others players can pass the ball to Y. I want to know how many different paths can the ball take from X to Y? for example if he is playing with 3 players there are 5 different paths, 4 players 16 paths, if he is playing with 20 players there are 330665665962404000 paths, and 40 players 55447192200369381342665835466328897344361743780 that the ball can take. the number max. of players that he can play with is 500. I was thinking in using Catalan Numbers? do you think is a correct approach to solve this? Can you give me some tips.

    Read the article

  • Python finding repeating sequence in list of integers?

    - by tijko
    I have a list of lists and each list has a repeating sequence. I'm trying to count the length of repeated sequence of integers in the list: list_a = [111,0,3,1,111,0,3,1,111,0,3,1] list_b = [67,4,67,4,67,4,67,4,2,9,0] list_c = [1,2,3,4,5,6,7,8,9,0,1,2,3,4,5,6,7,8,9,0,23,18,10] Which would return: list_a count = 4 (for [111,0,3,1]) list_b count = 2 (for [67,4]) list_c count = 10 (for [1,2,3,4,5,6,7,8,9,0]) Any advice or tips would be welcome. I'm trying to work it out with re.compile right now but, its not quite right.

    Read the article

  • Help Needed Finding a Programmer

    - by ssean
    Good Morning, I am trying to find a programmer to code a piece of custom software for my business. I plan on using this software to manage my business, and possibly sell it to other companies (in the same industry) at a later date. I've never hired a programmer before, so I'm not sure what to expect or where to begin. I know exactly what features I need, and how I want it laid out, I just need someone who can take my ideas and make it happen. This software will be used to manage customer information, and keep track of orders. What I think I need: * SQL Server or similar database that will be located at our office. * Desktop Application, that connects via LAN to the database server (cannot be browser based) * Multiple User Support (Simultaneous users accesing the system) * Needs to be scalable (currently we have 5 employees, but who knows what the future will bring) * Multi-Platform Support (Windows, Linux) I posted a job offer through elance, which seems to raise more questions than answers. How do I decide what language(s) will work best for my situation? (I have received offers for C#, Eclipse, .NET, Powerbuilder, etc. - I want to make sure that I choose the best one now, so I don't run into problems later) Does the programmer hold any rights to the software? (I plan to offer the software for sale at a later date) Any help or insight would be appreciated, and I'd be happy to clarify anything if it helps. Thanks in advance!

    Read the article

  • finding middle element of an array

    - by senthil
    Hi all, I came cross a question in my interview. Question: Array of integers will be given as the input and you should find out the middle element when sorted , but without sorting. For Example. Input: 1,3,5,4,2 Output: 3 When you sort the given input array, it will be 1,2,3,4,5 where middle element is 3. You should find this in one pass without sorting. Any solutions for this?

    Read the article

  • Django template Path

    - by user74283
    Hi I m following the tutorial on http://docs.djangoproject.com/en/dev/intro/tutorial02/#intro-tutorial02 in windows 7 envoirement. my settings file is TEMPLATE_DIRS = ( 'C:/django-project/myapp/mytemplates/admin' ) i got the base_template from the template admin/base_site.html from within the default Django admin template directory in the source code of Django itself (django/contrib/admin/templates) into an admin subdirectory of myapp directory as the tutorial instructed. It doesn't seem to take affect for some reason. Any clue of what might be the problem? Do i have to do a sync db ?

    Read the article

  • jQuery: Finding file size and adding it to the link

    - by Ricardo
    Let me start by saying that I'm not a jQuery guru by any means and I genuinely know this is over my head, that's why I've come to SO. Is there a way with jQuery to find the file size of a link on a page and then inject/add the text of the file size next to the link? Here's my problem On one of my pages, I have a link to my resume which is a PDF file and to improve usability it's proper to have the file type and file size next to the link so the users have the option to decide if they want to click on that link or not. So the link would read something like "Download my resume (PDF / 80KB)" The problem is that I'm constantly updating my resume and uploading a new PDF file which, of course, has a different file size so I'm always going back to the HTML and changing the text to reflect the new file size. Is there a way to automate this with jQuery... or plain JavaScript for that matter? I found this script and made a demo here in Codepen but it doesn't seem to work. Any help with this would be greatly appreciated.

    Read the article

  • Finding whether a point lies inside a rectangle or not

    - by avd
    The rectangle can be oriented in any way...need not be axis aligned. Now I want to find whether a point lies inside the rectangle or not. One method I could think of was to rotate the rectangle and point coordinates to make the rectangle axis aligned and then by simply testing the coordinates of point whether they lies within that of rectangle's or not. The above method requires rotation and hence floating point operations. Is there any other efficient way to do this??

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Finding center of fingerprints.

    - by an_ant
    If we suppose that every fingerprint is made of concentric curves (ellipses or circles) - and I'm aware of the fact that not every fingerprint is - how can I find center of those concentric curves? Let's take this "ideal" fingerprint and try to find out its center ... My approaches were to try: Find the spectrum through columns/rows of the image and try to find columns/rows that maximize particular band of the spectrum. I thought that column going through the center would have most regular pattern of changing amplitudes - therefore, most recognizible harmonic. My second approach was to try to count the changes of black-and-white also through the columns and rows, and to maximize that amount among rows and columns also. While these methods work to the some extant, with some additional filtering, they fail, when fingerprint is "not ideal as this one is". Can you think of any different approach? Are there standard ways to do it?

    Read the article

  • Finding minimum value in a Map

    - by Sunny
    I have a map and I want to find the minimum value (right hand side) in the map. Right now here is how I did it bool compare(std::pair<std::string ,int> i, pair<std::string, int> j) { return i.second < j.second; } //////////////////////////////////////////////////// std::map<std::string, int> mymap; mymap["key1"] = 50; mymap["key2"] = 20; mymap["key3"] = 100; std::pair<char, int> min = *min_element(mymap.begin(), mymap.end(), compare); std::cout << "min " << min.second<< " " << std::endl; This works fine and I'm able to get the minimum value the problem is when I put this code inside my class it doesn't seem to work int MyClass::getMin(std::map<std::string, int> mymap) { std::pair<std::string, int> min = *min_element(mymap.begin(), mymap.end(), (*this).compare); //error probably due to this return min.second; } bool MyClass::compare( std::pair<std::string, int> i, std::pair<std::string, int> j) { return i.second < j.second; } Also is there a better solution not involving to writing the additional compare function

    Read the article

  • finding character in string C language

    - by iSight
    Hi, I am searching a character at first occurence in string using the following code. But, it is taking some time when the character is too long or the character that i am searching is at far extend, which makes delay in other operations. How could i tackle with this problem. The code is below here. Note: attrPtr is a char* which holds a reference to a string containing '"' character at far extend. int position = 0; char qolon = '"';//character to search while (*(attrPtr + position++) != qolon); char* attrValue = NULL; attrValue = (char*)malloc(position * sizeof(char)); strncpy(attrValue, attrPtr, position-1);

    Read the article

  • Python finding n consecutive numbers in a list

    - by lost_in_code
    I want to know how to find if there is a certain amount of consecutive numbers in a row in my list e.g. For example if I am looking for two 1's then: list = [1, 1, 1, 4, 6] #original list list = ["true", "true", 1, 4, 6] #after my function has been through the list. If I am looking for three 1's then: list = [1, 1, 1, 4, 6] #original list list = ["true", "true", "true", 4, 6] #after my function has been through the list. I have tried: list = [1, 1, 2, 1] 1,1,1 in list #typed into shell, returns "(1, 1, True)" Any help would be greatly appreciated, I mainly would like to understand whats going on, and how to check if the next element in the list is the same as the first x amount.

    Read the article

  • SQLite Asp.net Path Problem

    - by drorhan
    when using data source=|DataDirectory|\mydb.sqlite in visual studio 2008 i can not see the tables in query builder and in dataset designer. How can i fix this? it is a web application for .net 3.5 thanks a lot

    Read the article

< Previous Page | 86 87 88 89 90 91 92 93 94 95 96 97  | Next Page >