Search Results

Search found 9932 results on 398 pages for 'pseudo element'.

Page 97/398 | < Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >

  • jQuery: Sort div's according to content of different sub divs

    - by rayne
    I'm trying to create a somewhat complex sorting feature which neither uses divs nor lists. Unfortunately two hours of googling didn't help me. Here is the basic setup of my HTML: <div id="all_elements"> <!-- one element --> <div class="element"> <div class="wrapper"> <a href="/" title="links"> <img src="/img/image.jpg" border="0" alt="image" class="image" /></a> <div class="details"> <h3><a href="/" title="title">Name (Sort Argument 1)</a></h3> <div class="title"><a href="/" title="title">Title (Sort Argument 2)</a></div> <div class="year">2010 (Sort Argumentt 3)</div> <div class="country">Great Britain (Sort Argument 4)</div> </div><!-- details --> </div><!-- wrapper --> </div><!-- element --> </div> <!--all_elements--> The setup is a bit complex, but basically .element is the element that needs to be sorted alphabetically according to either the contents of h3, div.title, div.year or div.country. So the user will be able to view the contents of the site either sorted by name, by year, by country or by title. I have this jQuery snippet from a website, but all my attempts on trying to tell it to use the contents of e.g. h3 to sort have failed. Right now it sorts pretty much randomly. jQuery.fn.sort = function() { return this.pushStack([].sort.apply(this, arguments), []); }; function sortAscending(a, b) { return a.innerHTML > b.innerHTML ? 1 : -1; }; function sortDescending(a, b) { return a.innerHTML < b.innerHTML ? 1 : -1; }; $(document).ready(function() { $("#sort").toggle( function() { $('#all_elements .element').sort(sortDescending).appendTo('#all_elements'); $(this).text("Sort Asc"); }, function() { $('#all_elements .element').sort(sortAscending).appendTo('#all_elements'); $(this).text("Sort Desc"); }); }); How can I customize the function to sort the contents of my h3 or divs?

    Read the article

  • How to stream XML data using XOM?

    - by Jonik
    Say I want to output a huge set of search results, as XML, into a PrintWriter or an OutputStream, using XOM. The resulting XML would look like this: <?xml version="1.0" encoding="UTF-8"?> <resultset> <result> [child elements and data] </result> ... ... [1000s of result elements more] </resultset> Because the resulting XML document could be big (tens or hundreds of megabytes, perhaps), I want to output it in a streaming fashion (instead of creating the whole Document in memory and then writing that). The granularity of outputting one <result> at a time is fine, so I want to generate one <result> after another, and write it into the stream. Assume there's already a method that helps with iterating the results and generating Element objects: public nu.xom.Element getNextResult(); So I'd simply like to do something like this pseudocode (automatic flushing enabled, so don't worry about that) : open stream/writer write declaration write start tag for <resultset> while more results: write next <result> element write end tag for <resultset> close stream/writer I've been looking at Serializer, but the necessary methods, writeStartTag(Element), writeEndTag(Element), write(DocType) are protected, not public! Is there no other way than to subclass Serializer to be able to use those methods, or to manually write the start and end tags directly into the stream as Strings, bypassing XOM altogether? (The latter wouldn't be too bad in this simple example, but in the general case it would get quite ugly.) Am I missing something or is XOM just not made for this? With dom4j I could do this easily using XMLWriter - it has constructors that take a Writer or OutputStream, and methods writeOpen(Element), writeClose(Element), writeDocType(DocumentType) etc. Compare to XOM's Serializer where the only public write method is the one that takes a whole Document. Please refrain from answering if you're not familiar with XOM! I specifically want to know if and how you can do this kind of streaming with that library. (This is related to my question about the best dom4j replacement where XOM is a strong contender.)

    Read the article

  • XSL transformation and special XML entities escaping

    - by Tomas R
    I have an XML file which is transformed with XSL. Some elements have to be changed, some have to be left as is - specifically, text with entities &quot;, &amp;, &apos;, &lt;, &gt; should be left as is, and in my case &quot; and &apos; are changed to " and ' accordingly. Test XML: <?xml version="1.0" encoding="UTF-8" ?> <root> <element> &quot; &amp; &apos; &lt; &gt; </element> </root> transformation file: <?xml version="1.0" encoding="UTF-8"?> <xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0"> <xsl:output method="xml" encoding="UTF-8" omit-xml-declaration="no" indent="no" /> <xsl:template match="element"> <xsl:copy> <xsl:value-of disable-output-escaping="no" select="." /> </xsl:copy> </xsl:template> </xsl:stylesheet> result: <?xml version="1.0" encoding="UTF-8"?> <element> " &amp; ' &lt; &gt; </element> desired result: <?xml version="1.0" encoding="UTF-8"?> <element> &quot; &amp; &apos; &lt; &gt; </element> I have 2 questions: why does some of those entities are transformed and other not? how can I get a desired result?

    Read the article

  • Writing to a xml file in java

    - by user243680
    import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • Handling HumanTask attachments in Oracle BPM 11g PS4FP+ (II)

    - by ccasares
    Retrieving uploaded attachments -UCM- As stated in my previous blog entry, Oracle BPM 11g 11.1.1.5.1 (aka PS4FP) introduced a new cool feature whereby you can use Oracle WebCenter Content (previously known as Oracle UCM) as the repository for the human task attached documents. For more information about how to use or enable this feature, have a look here. The attachment scope (either TASK or PROCESS) also applies to UCM-attachments. But even with this other feature, one question might arise when using UCM attachments. How can I get them from within the process? The first answer would be to use the same getTaskAttachmentContents() XPath function already explained in my previous blog entry. In fact, that's the way it should be. But in Oracle BPM 11g 11.1.1.5.1 (PS4FP) and 11.1.1.6.0 (PS5) there's a bug that prevents you to do that. If you invoke such function against a UCM-attachment, you'll get a null content response (bug#13907552). Even if the attachment was correctly uploaded. While this bug gets fixed, next I will show a workaround that lets me to retrieve the UCM-attached documents from within a BPM process. Besides, the sample will show how to interact with WCC API from within a BPM process.Aside note: I suggest you to read my previous blog entry about Human Task attachments where I briefly describe some concepts that are used next, such as the execData/attachment[] structure. Sample Process I will be using the following sample process: A dummy UserTask using "HumanTask2" Human Task, followed by an Embedded Subprocess that will retrieve the attachments payload. In this case, and here's the key point of the sample, we will retrieve such payload using WebCenter Content WebService API (IDC): and once retrieved, we will write each of them back to a file in the server using a File Adapter service: In detail:  We will use the same attachmentCollection XSD structure and same BusinessObject definition as in the previous blog entry. However we create a separate variable, named attachmentUCM, based on such BusinessObject. We will still need to keep a copy of the HumanTask output's execData structure. Therefore we need to create a new variable of type TaskExecutionData (different one than the other used for non-UCM attachments): As in the non-UCM attachments flow, in the output tab of the UserTask mapping, we'll keep a copy of the execData structure: Now we get into the embedded subprocess that will retrieve the attachments' payload. First, and using an XSLT transformation, we feed the attachmentUCM variable with the following information: The name of each attachment (from execData/attachment/name element) The WebCenter Content ID of the uploaded attachment. This info is stored in execData/attachment/URI element with the format ecm://<id>. As we just want the numeric <id>, we need to get rid of the protocol prefix ("ecm://"). We do so with some XPath functions as detailed below: with these two functions being invoked, respectively: We, again, set the target payload element with an empty string, to get the <payload></payload> tag created. The complete XSLT transformation is shown below. Remember that we're using the XSLT for-each node to create as many target structures as necessary.  Once we have fed the attachmentsUCM structure and so it now contains the name of each of the attachments along with each WCC unique id (dID), it is time to iterate through it and get the payload. Therefore we will use a new embedded subprocess of type MultiInstance, that will iterate over the attachmentsUCM/attachment[] element: In each iteration we will use a Service activity that invokes WCC API through a WebService. Follow these steps to create and configure the Partner Link needed: Login to WCC console with an administrator user (i.e. weblogic). Go to Administration menu and click on "Soap Wsdls" link. We will use the GetFile service to retrieve a file based on its dID. Thus we'll need such service WSDL definition that can be downloaded by clicking the GetFile link. Save the WSDL file in your JDev project folder. In the BPM project's composite view, drag & drop a WebService adapter to create a new External Reference, based on the just added GetFile.wsdl. Name it UCM_GetFile. WCC services are secured through basic HTTP authentication. Therefore we need to enable the just created reference for that: Right-click the reference and click on Configure WS Policies. Under the Security section, click "+" to add the "oracle/wss_username_token_client_policy" policy The last step is to set the credentials for the security policy. For the sample we will use the admin user for WCC (weblogic/welcome1). Open the composite.xml file and select the Source view. Search for the UCM_GetFile entry and add the following highlighted elements into it:   <reference name="UCM_GetFile" ui:wsdlLocation="GetFile.wsdl">     <interface.wsdl interface="http://www.stellent.com/GetFile/#wsdl.interface(GetFileSoap)"/>     <binding.ws port="http://www.stellent.com/GetFile/#wsdl.endpoint(GetFile/GetFileSoap)"                 location="GetFile.wsdl" soapVersion="1.1">       <wsp:PolicyReference URI="oracle/wss_username_token_client_policy"                            orawsp:category="security" orawsp:status="enabled"/>       <property name="weblogic.wsee.wsat.transaction.flowOption"                 type="xs:string" many="false">WSDLDriven</property>       <property name="oracle.webservices.auth.username"                 type="xs:string">weblogic</property>       <property name="oracle.webservices.auth.password"                 type="xs:string">welcome1</property>     </binding.ws>   </reference> Now the new external reference is ready: Once the reference has just been created, we should be able now to use it from our BPM process. However we find here a problem. The WCC GetFile service operation that we will use, GetFileByID, accepts as input a structure similar to this one, where all element tags are optional: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">    <get:dID>?</get:dID>   <get:rendition>?</get:rendition>   <get:extraProps>      <get:property>         <get:name>?</get:name>         <get:value>?</get:value>      </get:property>   </get:extraProps></get:GetFileByID> and we need to fill up just the <get:dID> tag element. Due to some kind of restriction or bug on WCC, the rest of the tag elements must NOT be sent, not even empty (i.e.: <get:rendition></get:rendition> or <get:rendition/>). A sample request that performs the query just by the dID, must be in the following format: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/">   <get:dID>12345</get:dID></get:GetFileByID> The issue here is that the simple mapping in BPM does create empty tags being a sample result as follows: <get:GetFileByID xmlns:get="http://www.stellent.com/GetFile/"> <get:dID>12345</get:dID> <get:rendition/> <get:extraProps/> </get:GetFileByID> Although the above structure is perfectly valid, it is not accepted by WCC. Therefore, we need to bypass the problem. The workaround we use (many others are available) is to add a Mediator component between the BPM process and the Service that simply copies the input structure from BPM but getting rid of the empty tags. Follow these steps to configure the Mediator: Drag & drop a new Mediator component into the composite. Uncheck the creation of the SOAP bindings and use the Interface Definition from WSDL template and select the existing GetFile.wsdl Double click in the mediator to edit it. Add a static routing rule to the GetFileByID operation, of type Service and select References/UCM_GetFile/GetFileByID target service: Create the request and reply XSLT mappers: Make sure you map only the dID element in the request: And do an Auto-mapper for the whole response: Finally, we can now add and configure the Service activity in the BPM process. Drag & drop it to the embedded subprocess and select the NormalizedGetFile service and getFileByID operation: Map both the input: ...and the output: Once this embedded subprocess ends, we will have all attachments (name + payload) in the attachmentsUCM variable, which is the main goal of this sample. But in order to test everything runs fine, we finish the sample writing each attachment to a file. To that end we include a final embedded subprocess to concurrently iterate through each attachmentsUCM/attachment[] element: On each iteration we will use a Service activity that invokes a File Adapter write service. In here we have two important parameters to set. First, the payload itself. The file adapter awaits binary data in base64 format (string). We have to map it using XPath (Simple mapping doesn't recognize a String as a base64-binary valid target): Second, we must set the target filename using the Service Properties dialog box: Again, note how we're making use of the loopCounter index variable to get the right element within the embedded subprocess iteration. Final blog entry about attachments will handle how to inject documents to Human Tasks from the BPM process and how to share attachments between different User Tasks. Will come soon. Again, once I finish will all posts on this matter, I will upload the whole sample project to java.net.

    Read the article

  • VNC error: "Could not connect to session bus: Failed to connect to socket"

    - by GJ
    I started a vncserver on display :1 on an ubuntu machine. When I connect to it, I get a grey X window with an error message Could not connect to session bus: Failed to connect to socket. The vnc log is: Xvnc Free Edition 4.1.1 - built Apr 9 2010 15:59:33 Copyright (C) 2002-2005 RealVNC Ltd. See http://www.realvnc.com for information on VNC. Underlying X server release 40300000, The XFree86 Project, Inc Sun Mar 20 15:33:59 2011 vncext: VNC extension running! vncext: Listening for VNC connections on port 5901 vncext: created VNC server for screen 0 error opening security policy file /etc/X11/xserver/SecurityPolicy Could not init font path element /usr/X11R6/lib/X11/fonts/Type1/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/Speedo/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/misc/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/75dpi/, removing from list! Could not init font path element /usr/X11R6/lib/X11/fonts/100dpi/, removing from list! cat: /var/run/gdm/auth-for-link2-eGnVvf/database: No such file or directory gnome-session[24880]: WARNING: Could not make bus activated clients aware of DISPLAY=:1.0 environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused gnome-session[24880]: WARNING: Could not make bus activated clients aware of GNOME_DESKTOP_SESSION_ID=this-is-deprecated environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused gnome-session[24880]: WARNING: Could not make bus activated clients aware of SESSION_MANAGER=local/dell:@/tmp/.ICE-unix/24880,unix/dell:/tmp/.ICE-unix/24880 environment variable: Failed to connect to socket /tmp/dbus-FhdHHIq8jt: Connection refused Sun Mar 20 15:34:10 2011 Connections: accepted: 0.0.0.0::51620 SConnection: Client needs protocol version 3.8 SConnection: Client requests security type VncAuth(2) VNCSConnST: Server default pixel format depth 16 (16bpp) little-endian rgb565 VNCSConnST: Client pixel format depth 16 (16bpp) little-endian rgb565 gnome-session[24880]: Gtk-CRITICAL: gtk_main_quit: assertion `main_loops != NULL' failed gnome-session[24880]: CRITICAL: dbus_g_proxy_new_for_name: assertion `connection != NULL' failed Any ideas how to fix it?

    Read the article

  • Windows cannot open directory with too long name created by Linux

    - by Tim
    Hello! My laptop has two OSes: Windows 7 and Ubuntu 10.10. A partition of Windows 7 of format NTFS is mounted in Ubuntu. In Ubuntu, I created a directory under somehow deep path and with a long name for itself, specifically, the name for that directory is "a set of size-measurable subsets ie sigma algebra". Now in Windows, I cannot open the directory, which I guess is because of the name is too long, nor can I rename it. I was wondering if there is some way to access that directory under Windows? Better without changing the directory if possible, but will have to if necessary. Thanks and regards! Update: This is the output using "DIR /X" in cmd.exe, which does not shorten the directory name: F:\science\math\Foundations of mathematics\set theory\whether element of a set i s also a set\when element is set\when element sets are subsets of a universal se t\closed under some set operations\sigma algebra of sets>DIR /X Volume in drive F is Data Volume Serial Number is 0492-DD90 Directory of F:\science\math\Foundations of mathematics\set theory\whether elem ent of a set is also a set\when element is set\when element sets are subsets of a universal set\closed under some set operations\sigma algebra of sets 03/14/2011 10:43 AM <DIR> . 03/14/2011 10:43 AM <DIR> .. 03/08/2011 10:09 AM <DIR> a set of size-measurable sub sets ie sigma algebra 02/12/2011 04:08 AM <DIR> example 02/17/2011 12:30 PM <DIR> general 03/13/2011 02:28 PM <DIR> mapping from sigma algebra t o R or C i.e. measure 02/12/2011 04:10 AM <DIR> msbl mapping from general ms bl space to Borel msbl R or C 02/12/2011 04:10 AM 4,928 new file~ 03/14/2011 10:42 AM <DIR> temp 03/02/2011 10:58 AM <DIR> with Cartesian product of se ts 1 File(s) 4,928 bytes 9 Dir(s) 39,509,340,160 bytes free

    Read the article

  • Silverlight 3.0 Custom Cursor in Chart

    - by Wonko the Sane
    Hello All, I'm probably overlooking something that will be obvious when I see the solution, but for now... I am attempting to use a custom cursor inside the chart area of a Toolkit chart. I have created a ControlTemplate for the chart, and a grid to contain the cursors. I show/hide the cursors, and attempt to move the containing Grid, using various Mouse events. The cursor is being displayed at the correct times, but I cannot get it to move to the correct position. Here is the ControlTemplate (the funky colors are just attempts to confirm what the different pieces of the template pertain to): <dataVisTK:Title Content="{TemplateBinding Title}" Style="{TemplateBinding TitleStyle}"/> <Grid Grid.Row="1"> <!-- Remove the Legend --> <!--<dataVisTK:Legend x:Name="Legend" Title="{TemplateBinding LegendTitle}" Style="{TemplateBinding LegendStyle}" Grid.Column="1"/>--> <chartingPrimitivesTK:EdgePanel x:Name="ChartArea" Background="#EDAEAE" Style="{TemplateBinding ChartAreaStyle}" Grid.Column="0"> <Grid Canvas.ZIndex="-1" Background="#2008AE" Style="{TemplateBinding PlotAreaStyle}"> </Grid> <Border Canvas.ZIndex="1" BorderBrush="#FF250010" BorderThickness="3" /> <Grid x:Name="gridHandCursors" Canvas.ZIndex="5" Width="32" Height="32" Visibility="Collapsed"> <Image x:Name="cursorGrab" Width="32" Source="Resources/grab.png" /> <Image x:Name="cursorGrabbing" Width="32" Source="Resources/grabbing.png" Visibility="Collapsed"/> </Grid> </chartingPrimitivesTK:EdgePanel> </Grid> </Grid> </Border> and here are the mouse events (in particular, the MouseMove): void TimelineChart_Loaded(object sender, RoutedEventArgs e) { chartTimeline.UpdateLayout(); List<FrameworkElement> chartChildren = GetLogicalChildrenBreadthFirst(chartTimeline).ToList(); mChartArea = chartChildren.Where(element => element.Name.Equals("ChartArea")).FirstOrDefault() as Panel; if (mChartArea != null) { grabCursor = chartChildren.Where(element => element.Name.Equals("cursorGrab")).FirstOrDefault() as Image; grabbingCursor = chartChildren.Where(element => element.Name.Equals("cursorGrabbing")).FirstOrDefault() as Image; mGridHandCursors = chartChildren.Where(element => element.Name.Equals("gridHandCursors")).FirstOrDefault() as Grid; mChartArea.Cursor = Cursors.None; mChartArea.MouseMove += new MouseEventHandler(mChartArea_MouseMove); mChartArea.MouseLeftButtonDown += new MouseButtonEventHandler(mChartArea_MouseLeftButtonDown); mChartArea.MouseLeftButtonUp += new MouseButtonEventHandler(mChartArea_MouseLeftButtonUp); if (mGridHandCursors != null) { mChartArea.MouseEnter += (s, e2) => mGridHandCursors.Visibility = Visibility.Visible; mChartArea.MouseLeave += (s, e2) => mGridHandCursors.Visibility = Visibility.Collapsed; } } } void mChartArea_MouseLeftButtonUp(object sender, MouseButtonEventArgs e) { if (grabCursor != null) grabCursor.Visibility = Visibility.Visible; if (grabbingCursor != null) grabbingCursor.Visibility = Visibility.Collapsed; } void mChartArea_MouseLeftButtonDown(object sender, MouseButtonEventArgs e) { if (grabCursor != null) grabCursor.Visibility = Visibility.Collapsed; if (grabbingCursor != null) grabbingCursor.Visibility = Visibility.Visible; } void mChartArea_MouseMove(object sender, MouseEventArgs e) { if (mGridHandCursors != null) { Point pt = e.GetPosition(null); mGridHandCursors.SetValue(Canvas.LeftProperty, pt.X); mGridHandCursors.SetValue(Canvas.TopProperty, pt.Y); } } Any help past this roadblock would be greatly appreciated! Thanks, wTs

    Read the article

  • Calling a WCF service from Java

    - by Ian Kemp
    As the title says, I need to get some Java 1.5 code to call a WCF web service. I've downloaded and used Metro to generate Java proxy classes, but they aren't generating what I expect, and I believe this is because of the WSDL that the WCF service generates. My WCF classes look like this (full code omitted for brevity): public class TestService : IService { public TestResponse DoTest(TestRequest request) { TestResponse response = new TestResponse(); // actual testing code... response.Result = ResponseResult.Success; return response; } } public class TestResponse : ResponseMessage { public bool TestSucceeded { get; set; } } public class ResponseMessage { public ResponseResult Result { get; set; } public string ResponseDesc { get; set; } public Guid ErrorIdentifier { get; set; } } public enum ResponseResult { Success, Error, Empty, } and the resulting WSDL (when I browse to http://localhost/TestService?wsdl=wsdl0) looks like this: <xsd:element name="TestResponse"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="TestSucceeded" type="xsd:boolean" /> </xsd:sequence> </xsd:complexType> </xsd:element> <xsd:element name="ErrorIdentifier" type="q1:guid" xmlns:q1="http://schemas.microsoft.com/2003/10/Serialization/" /> <xsd:simpleType name="ResponseResult"> <xsd:restriction base="xsd:string"> <xsd:enumeration value="Error" /> <xsd:enumeration value="Success" /> <xsd:enumeration value="EmptyResult" /> </xsd:restriction> </xsd:simpleType> <xsd:element name="ResponseResult" nillable="true" type="tns:ResponseResult" /> <xsd:element name="Result" type="tns:ResponseResult" /> <xsd:element name="ResultDesc" nillable="true" type="xsd:string" /> ... <xs:element name="guid" nillable="true" type="tns:guid" /> <xs:simpleType name="guid"> <xs:restriction base="xs:string"> <xs:pattern value="[\da-fA-F]{8}-[\da-fA-F]{4}-[\da-fA-F]{4}-[\da-fA-F]{4}-[\da-fA-F]{12}" /> </xs:restriction> </xs:simpleType> Immediately I see an issue with this WSDL: TestResponse does not contain the properties inherited from ResponseMessage. Since this service has always worked in Visual Studio I've never questioned this before, but maybe that could be causing my problem? Anyhow, when I run Metro's wsimport.bat on the service the following error message is generated: [WARNING] src-resolve.4.2: Error resolving component 'q1:guid' and the outputted Java version of TestResponse lacks any of the properties from ResponseMessage. I hacked the WSDL a bit and changed ErrorIdentifier to be typed as xsd:string, which makes the message about resolving the GUID type go away, but I still don't get any of ResponseMessage's properties. Finally, I altered the WSDL to include the 3 properties from ResponseMessage in TestResponse, and of course the end result is that the generated .java file contains them. However, when I actually call the WCF service from Java, those 3 properties are always null. Any advice, apart from writing the proxy classes myself?

    Read the article

  • Set attribute to all child elements via xsl:choose

    - by Camal
    Hi, assuming I got following XML file : <?xml version="1.0" encoding="ISO-8859-1" ?> <MyCarShop> <Car gender="Boy"> <Door>Lamborghini</Door> <Key>Skull</Key> </Car> <Car gender="Girl"> <Door>Normal</Door> <Key>Princess</Key> </Car> </MyCarShop> I want to perform a transformation so the xml looks like this : <?xml version="1.0" encoding="ISO-8859-1" ?> <MyCarShop> <Car gender="Boy"> <Door color="blue">Lamborghini</Door> <Key color="blue">Skull</Key> </Car> <Car gender="Girl"> <Door color="red">Normal</Door> <Key color="red">Princess</Key> </Car> </MyCarShop> So I want to add a color attribut to each subelement of Car depending on the gender information. I came up with this XSLT but it doesnt work : <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" > <xsl:output method="xml" indent="yes"/> <!--<xsl:template match="@* | node()"> <xsl:copy> <xsl:apply-templates select="@* | node()"/> </xsl:copy> </xsl:template>--> <xsl:template match="/"> <xsl:element name="MyCarShop"> <xsl:attribute name="version">1.0</xsl:attribute> <xsl:apply-templates/> </xsl:element> </xsl:template> <xsl:template match="Car"> <xsl:element name="Car"> <xsl:apply-templates/> </xsl:element> </xsl:template> <xsl:template match="Door"> <xsl:element name="Door"> <xsl:attribute name="ViewSideIndicator"> <xsl:choose> <xsl:when test="gender = 'Boy' ">Front</xsl:when> <xsl:when test="gender = 'Girl ">Front</xsl:when> </xsl:choose> </xsl:attribute> </xsl:element> </xsl:template> <xsl:template match="Key"> <xsl:element name="Key"> <xsl:apply-templates/> </xsl:element> </xsl:template> </xsl:stylesheet> Does anybody know what might be wrong ? Thanks again!

    Read the article

  • XmlException - inserting attribute gives "unexpected token" exception

    - by Anders Svensson
    Hi, I have an XmlDocument object in C# that I transform, using XslTransform, to html. In the stylesheet I insert an id attribute in a span tag, taking the id from an element in the XmlDocument. Here is the template for the element: <xsl:template match="word"> <span> <xsl:attribute name="id"><xsl:value-of select="@id"></xsl:value-of></xsl:attribute> <xsl:apply-templates/> </span> </xsl:template> But then I want to process the result document as an xhtml document (using the XmlDocument dom). So I'm taking a selected element in the html, creating a range out of it, and try to load the element using XmlLoad(): wordElem.LoadXml(range.htmlText); But this gives me the following exception: "'598' is an unexpected token. The expected token is '"' or '''. Line 1, position 10." And if I move the cursor over the range.htmlText, I see the tags for the element, and the "id" shows without quotes, which confuses me (i.e.SPAN id=598 instead of SPAN id="598"). To confuse the matter further, if I insert a blank space or something like that in the value of the id in the stylesheet, it works fine, i.e.: <span> <xsl:attribute name="id"><xsl:text> </xsl:text> <xsl:value-of select="@id"></xsl:value-of></xsl:attribute> <xsl:apply-templates/> </span> (Notice the whitespace in the xsl:text element). Now if I move the cursor over the range.htmlText, I see an id with quotes as usual in attributes (and as it shows if I open the html file in notepad or something). What is going on here? Why can't I insert an attribute this way and have a result that is acceptable as xhtml for XmlDocument to read? I feel I am missing something fundamental, but all this surprises me, since I do this sort of transformations using xsl:attribute to insert attributes all the time for other types of xsl transformations. Why doesn't XmlDocument accept this value? By the way, it doesn't matter if it is an id attribute. i have tried with the "class" attribute, "style" etc, and also using literal values such as "style" and setting the value to "color:red" and so on. The compiler always complains it is an unvalid token, and does not include quotes for the value unless there is a whitespace or something else in there (linebreaks etc.). I hope I have provided enough information. Any help will be greatly appreciated. Basically, what I want to accomplish is set an id in a span element in html, select a word in a webbrowser control with this document loaded, and get the id attribute out of the selected element. I've accomplished everything, and can actually do what I want, but only if I use regex e.g. to get the attribute value, and I want to be able to use XmlDocument instead to simply get the value out of the attribute directly. I'm sure I'm missing something simple, but if so please tell me. Regards, Anders

    Read the article

  • add the same qtreewidgetitems into the second column

    - by srinu
    hello i am using the following program to display the qtreewidget. main.cpp include include "qdomsimple.h" include include "qdomsimple.h" int main(int argc, char *argv[]) { QApplication a(argc, argv); QStringList filelist; filelist.push_back("C:\department1.xml"); filelist.push_back("C:\department2.xml"); filelist.push_back("C:\department3.xml"); QDOMSimple w(filelist); w.resize(260,200); w.show(); return a.exec(); } qdomsimple.cpp include "qdomsimple.h" include include QDOMSimple::QDOMSimple(QStringList strlst,QWidget *parent) : QWidget(parent) { k=0; // DOM document QDomDocument doc("title"); QStringList headerlabels; headerlabels.push_back("Chemistry"); headerlabels.push_back("Mechanical"); headerlabels.push_back("IT"); m_tree = new QTreeWidget( this ); m_tree->setColumnCount(3); m_tree->setHeaderLabels(headerlabels); QStringList::iterator it; for(it=strlst.begin();it<strlst.end();it++) { QFile file(*it); if ( file.open( QIODevice::ReadOnly | QIODevice::Text )) { // The tree view to be filled with xml data // (m_tree is a class member variable) // Creating the DOM tree doc.setContent( &file ); file.close(); // Root of the document QDomElement root = doc.documentElement(); // Taking the first child node of the root QDomNode child = root.firstChild(); // Setting the root as the header of the tree //QTreeWidgetItem* header = new QTreeWidgetItem; //header->setText(k,root.nodeName()); //m_tree->setHeaderItem(header); // Parse until the end of document while (!child.isNull()) { //Convert a DOM node to DOM element QDomElement element = child.toElement(); //Parse only if the node is a really an element if (!element.isNull()) { //Parse the element recursively parseElement( element,0); //Go to the next sibling child = child.nextSiblingElement(); } } //m_tree->setGeometry( QApplication::desktop()->availableGeometry() ); //setGeometry( QApplication::desktop()->availableGeometry() ); } k++; } } void QDOMSimple::parseElement( QDomElement& aElement, QTreeWidgetItem *aParentItem ) { // A map of all attributes of an element QDomNamedNodeMap attrMap = aElement.attributes(); // List all attributes QStringList attrList; for ( int i = 0; i < attrMap.count(); i++ ) { // Attribute name //QString attr = attrMap.item( i ).nodeName(); //attr.append( "-" ); /* Attribute value QString attr; attr.append( attrMap.item( i ).nodeValue() );*/ //attrList.append( attr ); attrList.append(attrMap.item( i).nodeValue()); } QTreeWidgetItem* item; // Create a new view item for elements having child nodes if (aParentItem) { item = new QTreeWidgetItem(aParentItem); } // Create a new view item for elements without child nodes else { item = new QTreeWidgetItem( m_tree ); } //Set tag name and the text QString tagNText; tagNText.append( aElement.tagName() ); //tagNText.append( "------" ); //tagNText.append( aElement.text() ); item->setText(0, tagNText ); // Append attributes to the element node of the tree for ( int i = 0; i < attrList.count(); i++ ) { QTreeWidgetItem* attrItem = new QTreeWidgetItem( item ); attrItem->setText(0, attrList[i] ); } // Repeat the process recursively for child elements QDomElement child = aElement.firstChildElement(); while (!child.isNull()) { parseElement( child, item ); child = child.nextSiblingElement(); } } QDOMSimple::~QDOMSimple() { } for this i got the qtreewidget like this +file1 +file2 +file3 but actual wanted output is +file1 +file2 +file3 i don't know how to do it.Thanks in advance

    Read the article

  • How to find specific value of the node in xml file

    - by user2735149
    I am making windows phone 8 app based the webservices. This is my xml code: - <response> <timestamp>2013-10-31T08:30:56Z</timestamp> <resultsOffset>0</resultsOffset> <status>success</status> <resultsLimit>8</resultsLimit> <resultsCount>38</resultsCount> - <headlines> - <headlinesItem> <headline>City edge past Toon</headline> <keywords /> <lastModified>2013-10-30T23:45:22Z</lastModified> <audio /> <premium>false</premium> + <links> - <api> - <news> <href>http://api.espn.com/v1/sports/news/1600444?region=GB</href> </news> </api> - <web> <href>http://espnfc.com/uk/en/report/381799/city-edge-toon?ex_cid=espnapi_public</href> </web> - <mobile> <href>http://m.espn.go.com/soccer/gamecast?gameId=381799&lang=EN&ex_cid=espnapi_public</href> </mobile> </links> <type>snReport</type> <related /> <id>1600444</id> <story>Alvardo Negredo and Edin Dzeko struck in extra-time to book Manchester City's place in the last eight of the Capital One Cup, while Costel Pantilimon kept a clean sheet in the 2-0 win to keep the pressure on Joe Hart. </story> <linkText>Newcastle 0-2 Man City</linkText> - <images> - <imagesItem> <height>360</height> <alt>Man City celebrate after Edin Dzeko scored their second extra-time goal at Newcastle.</alt> <width>640</width> <name>Man City celeb Edin Dzeko goal v nufc 20131030 [640x360]</name> <caption>Man City celebrate after Edin Dzeko scored their second extra-time goal at Newcastle.</caption> <type>inline</type> <url>http://espnfc.com/design05/images/2013/1030/mancitycelebedindzekogoalvnufc20131030_640x360.jpg</url> </imagesItem> </images> Code behind: myData = XDocument.Parse(e.Result, LoadOptions.None); var data = myData.Descendants("headlines").FirstOrDefault(); var data1 = from query in myData.Descendants("headlinesItem") select new UpdataNews { News = (string)query.Element("headline").Value, Desc = (string)query.Element("description"), Newsurl = (string)query.Element("links").Element("mobile").Element("href"), Imageurl=(string)query.Element("images").Element("imagesItem").Element("url").Value, }; lstShow.ItemsSource = data1; I am trying to get value from xml tags and assign them to News,Desc, etc. Everything works fine except Imageurl, it shows NullException. I tried same method for Imageurl, i dont know whats going wrong. Help..

    Read the article

  • Red Sand – An Awesome Fan Made Mass Effect Prequel [Short Movie]

    - by Asian Angel
    Welcome to Mars where humanity has just discovered the Prothean Ruins and Element Zero, but danger abounds as the Red Sand terrorist group seeks to claim Mars for themselves! If you love the Mass Effect game series, then you will definitely want to watch this awesome fan made prequel set 35 years before the events of the first game. Synopsis From YouTube: Serving as a prequel to the MASS EFFECT game series,”Red Sand” is set 35 years before the time of Commander Shepard and tells the story of the discovery of ancient ruins on Mars. Left behind by the mysterious alien race known as the Protheans, the ruins are a treasure trove of advanced technology and the powerful Element Zero, an energy source beyond humanity’s wildest dreams. As the Alliance research team led by Dr. Averroes (Ayman Samman) seeks to unlock the secrets of the ruins, a band of marauders living in the deserts of Mars wants the ruins for themselves. Addicted to refined Element Zero in the form of a narcotic nicknamed “Red Sand” which gives them telekinetic “biotic” powers, these desert-dwelling terrorists will stop at nothing to control the ruins and the rich vein of Element Zero at its core. Standing between them and their goal are Colonel Jon Grissom (Mark Meer), Colonel Lily Sandhurst (Amy Searcy), and a team of Alliance soldiers tasked with defending the ruins at all costs. At stake – the future of humanity’s exploration of the galaxy, and the set up for the MASS EFFECT storyline loved by millions of gamers worldwide. RED SAND: a Mass Effect fan film – starring MARK MEER [via Geeks are Sexy] 7 Ways To Free Up Hard Disk Space On Windows HTG Explains: How System Restore Works in Windows HTG Explains: How Antivirus Software Works

    Read the article

  • Adding and accessing custom sections in your C# App.config

    - by deadlydog
    So I recently thought I’d try using the app.config file to specify some data for my application (such as URLs) rather than hard-coding it into my app, which would require a recompile and redeploy of my app if one of our URLs changed.  By using the app.config it allows a user to just open up the .config file that sits beside their .exe file and edit the URLs right there and then re-run the app; no recompiling, no redeployment necessary. I spent a good few hours fighting with the app.config and looking at examples on Google before I was able to get things to work properly.  Most of the examples I found showed you how to pull a value from the app.config if you knew the specific key of the element you wanted to retrieve, but it took me a while to find a way to simply loop through all elements in a section, so I thought I would share my solutions here.   Simple and Easy The easiest way to use the app.config is to use the built-in types, such as NameValueSectionHandler.  For example, if we just wanted to add a list of database server urls to use in my app, we could do this in the app.config file like so: 1: <?xml version="1.0" encoding="utf-8" ?> 2: <configuration> 3: <configSections> 4: <section name="ConnectionManagerDatabaseServers" type="System.Configuration.NameValueSectionHandler" /> 5: </configSections> 6: <startup> 7: <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.5" /> 8: </startup> 9: <ConnectionManagerDatabaseServers> 10: <add key="localhost" value="localhost" /> 11: <add key="Dev" value="Dev.MyDomain.local" /> 12: <add key="Test" value="Test.MyDomain.local" /> 13: <add key="Live" value="Prod.MyDomain.com" /> 14: </ConnectionManagerDatabaseServers> 15: </configuration>   And then you can access these values in code like so: 1: string devUrl = string.Empty; 2: var connectionManagerDatabaseServers = ConfigurationManager.GetSection("ConnectionManagerDatabaseServers") as NameValueCollection; 3: if (connectionManagerDatabaseServers != null) 4: { 5: devUrl = connectionManagerDatabaseServers["Dev"].ToString(); 6: }   Sometimes though you don’t know what the keys are going to be and you just want to grab all of the values in that ConnectionManagerDatabaseServers section.  In that case you can get them all like this: 1: // Grab the Environments listed in the App.config and add them to our list. 2: var connectionManagerDatabaseServers = ConfigurationManager.GetSection("ConnectionManagerDatabaseServers") as NameValueCollection; 3: if (connectionManagerDatabaseServers != null) 4: { 5: foreach (var serverKey in connectionManagerDatabaseServers.AllKeys) 6: { 7: string serverValue = connectionManagerDatabaseServers.GetValues(serverKey).FirstOrDefault(); 8: AddDatabaseServer(serverValue); 9: } 10: }   And here we just assume that the AddDatabaseServer() function adds the given string to some list of strings.  So this works great, but what about when we want to bring in more values than just a single string (or technically you could use this to bring in 2 strings, where the “key” could be the other string you want to store; for example, we could have stored the value of the Key as the user-friendly name of the url).   More Advanced (and more complicated) So if you want to bring in more information than a string or two per object in the section, then you can no longer simply use the built-in System.Configuration.NameValueSectionHandler type provided for us.  Instead you have to build your own types.  Here let’s assume that we again want to configure a set of addresses (i.e. urls), but we want to specify some extra info with them, such as the user-friendly name, if they require SSL or not, and a list of security groups that are allowed to save changes made to these endpoints. So let’s start by looking at the app.config: 1: <?xml version="1.0" encoding="utf-8" ?> 2: <configuration> 3: <configSections> 4: <section name="ConnectionManagerDataSection" type="ConnectionManagerUpdater.Data.Configuration.ConnectionManagerDataSection, ConnectionManagerUpdater" /> 5: </configSections> 6: <startup> 7: <supportedRuntime version="v4.0" sku=".NETFramework,Version=v4.5" /> 8: </startup> 9: <ConnectionManagerDataSection> 10: <ConnectionManagerEndpoints> 11: <add name="Development" address="Dev.MyDomain.local" useSSL="false" /> 12: <add name="Test" address="Test.MyDomain.local" useSSL="true" /> 13: <add name="Live" address="Prod.MyDomain.com" useSSL="true" securityGroupsAllowedToSaveChanges="ConnectionManagerUsers" /> 14: </ConnectionManagerEndpoints> 15: </ConnectionManagerDataSection> 16: </configuration>   The first thing to notice here is that my section is now using the type “ConnectionManagerUpdater.Data.Configuration.ConnectionManagerDataSection” (the fully qualified path to my new class I created) “, ConnectionManagerUpdater” (the name of the assembly my new class is in).  Next, you will also notice an extra layer down in the <ConnectionManagerDataSection> which is the <ConnectionManagerEndpoints> element.  This is a new collection class that I created to hold each of the Endpoint entries that are defined.  Let’s look at that code now: 1: using System; 2: using System.Collections.Generic; 3: using System.Configuration; 4: using System.Linq; 5: using System.Text; 6: using System.Threading.Tasks; 7:  8: namespace ConnectionManagerUpdater.Data.Configuration 9: { 10: public class ConnectionManagerDataSection : ConfigurationSection 11: { 12: /// <summary> 13: /// The name of this section in the app.config. 14: /// </summary> 15: public const string SectionName = "ConnectionManagerDataSection"; 16: 17: private const string EndpointCollectionName = "ConnectionManagerEndpoints"; 18:  19: [ConfigurationProperty(EndpointCollectionName)] 20: [ConfigurationCollection(typeof(ConnectionManagerEndpointsCollection), AddItemName = "add")] 21: public ConnectionManagerEndpointsCollection ConnectionManagerEndpoints { get { return (ConnectionManagerEndpointsCollection)base[EndpointCollectionName]; } } 22: } 23:  24: public class ConnectionManagerEndpointsCollection : ConfigurationElementCollection 25: { 26: protected override ConfigurationElement CreateNewElement() 27: { 28: return new ConnectionManagerEndpointElement(); 29: } 30: 31: protected override object GetElementKey(ConfigurationElement element) 32: { 33: return ((ConnectionManagerEndpointElement)element).Name; 34: } 35: } 36: 37: public class ConnectionManagerEndpointElement : ConfigurationElement 38: { 39: [ConfigurationProperty("name", IsRequired = true)] 40: public string Name 41: { 42: get { return (string)this["name"]; } 43: set { this["name"] = value; } 44: } 45: 46: [ConfigurationProperty("address", IsRequired = true)] 47: public string Address 48: { 49: get { return (string)this["address"]; } 50: set { this["address"] = value; } 51: } 52: 53: [ConfigurationProperty("useSSL", IsRequired = false, DefaultValue = false)] 54: public bool UseSSL 55: { 56: get { return (bool)this["useSSL"]; } 57: set { this["useSSL"] = value; } 58: } 59: 60: [ConfigurationProperty("securityGroupsAllowedToSaveChanges", IsRequired = false)] 61: public string SecurityGroupsAllowedToSaveChanges 62: { 63: get { return (string)this["securityGroupsAllowedToSaveChanges"]; } 64: set { this["securityGroupsAllowedToSaveChanges"] = value; } 65: } 66: } 67: }   So here the first class we declare is the one that appears in the <configSections> element of the app.config.  It is ConnectionManagerDataSection and it inherits from the necessary System.Configuration.ConfigurationSection class.  This class just has one property (other than the expected section name), that basically just says I have a Collection property, which is actually a ConnectionManagerEndpointsCollection, which is the next class defined.  The ConnectionManagerEndpointsCollection class inherits from ConfigurationElementCollection and overrides the requied fields.  The first tells it what type of Element to create when adding a new one (in our case a ConnectionManagerEndpointElement), and a function specifying what property on our ConnectionManagerEndpointElement class is the unique key, which I’ve specified to be the Name field. The last class defined is the actual meat of our elements.  It inherits from ConfigurationElement and specifies the properties of the element (which can then be set in the xml of the App.config).  The “ConfigurationProperty” attribute on each of the properties tells what we expect the name of the property to correspond to in each element in the app.config, as well as some additional information such as if that property is required and what it’s default value should be. Finally, the code to actually access these values would look like this: 1: // Grab the Environments listed in the App.config and add them to our list. 2: var connectionManagerDataSection = ConfigurationManager.GetSection(ConnectionManagerDataSection.SectionName) as ConnectionManagerDataSection; 3: if (connectionManagerDataSection != null) 4: { 5: foreach (ConnectionManagerEndpointElement endpointElement in connectionManagerDataSection.ConnectionManagerEndpoints) 6: { 7: var endpoint = new ConnectionManagerEndpoint() { Name = endpointElement.Name, ServerInfo = new ConnectionManagerServerInfo() { Address = endpointElement.Address, UseSSL = endpointElement.UseSSL, SecurityGroupsAllowedToSaveChanges = endpointElement.SecurityGroupsAllowedToSaveChanges.Split(',').Where(e => !string.IsNullOrWhiteSpace(e)).ToList() } }; 8: AddEndpoint(endpoint); 9: } 10: } This looks very similar to what we had before in the “simple” example.  The main points of interest are that we cast the section as ConnectionManagerDataSection (which is the class we defined for our section) and then iterate over the endpoints collection using the ConnectionManagerEndpoints property we created in the ConnectionManagerDataSection class.   Also, some other helpful resources around using app.config that I found (and for parts that I didn’t really explain in this article) are: How do you use sections in C# 4.0 app.config? (Stack Overflow) <== Shows how to use Section Groups as well, which is something that I did not cover here, but might be of interest to you. How to: Create Custom Configuration Sections Using Configuration Section (MSDN) ConfigurationSection Class (MSDN) ConfigurationCollectionAttribute Class (MSDN) ConfigurationElementCollection Class (MSDN)   I hope you find this helpful.  Feel free to leave a comment.  Happy Coding!

    Read the article

  • Is there a way to add unique items to an array without doing a ton of comparisons?

    - by hydroparadise
    Please bare with me, I want this to be as language agnostic as possible becuase of the languages I am working with (One of which is a language called PowerOn). However, most languanges support for loops and arrays. Say I have the following list in an aray: 0x 0 Foo 1x 1 Bar 2x 0 Widget 3x 1 Whatsit 4x 0 Foo 5x 1 Bar Anything with a 1 should be uniqely added to another array with the following result: 0x 1 Bar 1x 1 Whatsit Keep in mind this is a very elementry example. In reality, I am dealing with 10's of thousands of elements on the old list. Here is what I have so far. Pseudo Code: For each element in oldlist For each element in newlist Compare If values oldlist.element equals newlist.element, break new list loop If reached end of newlist with with nothing equal from oldlist, add value from old list to new list End End Is there a better way of doing this? Algorithmicly, is there any room for improvement? And as a bonus qeustion, what is the O notation for this type of algorithm (if there is one)?

    Read the article

  • Vector with Constant-Time Remove - still a Vector?

    - by Darrel Hoffman
    One of the drawbacks of most common implementations of the Vector class (or ArrayList, etc. Basically any array-backed expandable list class) is that their remove() operation generally operates in linear time - if you remove an element, you must shift all elements after it one space back to keep the data contiguous. But what if you're using a Vector just to be a list-of-things, where the order of the things is irrelevant? In this case removal can be accomplished in a few simple steps: Swap element to be removed with the last element in the array Reduce size field by 1. (No need to re-allocate the array, as the deleted item is now beyond the size field and thus not "in" the list any more. The next add() will just overwrite it.) (optional) Delete last element to free up its memory. (Not needed in garbage-collected languages.) This is clearly now a constant-time operation, since only performs a single swap regardless of size. The downside is of course that it changes the order of the data, but if you don't care about the order, that's not a problem. Could this still be called a Vector? Or is it something different? It has some things in common with "Set" classes in that the order is irrelevant, but unlike a Set it can store duplicate values. (Also most Set classes I know of are backed by a tree or hash map rather than an array.) It also bears some similarity to Heap classes, although without the log(N) percolate steps since we don't care about the order.

    Read the article

  • Z-order with Alpha blending in a 3D world

    - by user41765
    I'm working on a game in a 3D world with 2D sprites only (like Don't Starve game). (OpenGL ES2 with C++) Currently, I'm ordering elements back to front before drawing them without batch (so 1 element = 1 drawcall). I would like to implement batching in my framework to decrease draw calls. Here is what I've got for the moment: Order all elements of my scene back to front. Send order list of elements to the Renderer. Renderer look in his batch manager if a batch exist for the given element with his Material. Batch didn't exist: create a new one. Batch exist for element with this Material: Add sprite to the batch. Compute big mesh with all sprite for each batch (1 material type = 1 batch). When all batches are ok, the batch manager compute draw commands for the renderer. Renderer process draw commands (bind shader, bind textures, bind buffers, draw element) Image with my problem here: Explication here But I've got some problems because objects can be behind another objects inside another batch. How can I do something like that? Thanks!

    Read the article

  • Why, in WPF, do we set an object to Stretch via its Alignment properties instead of Width/Height?

    - by Jonathan Hobbs
    In WPF's XAML, we can tell an element to fill its container like this: <Button HorizontalAlignment="Stretch" VerticalAlignment="Stretch" /> Why is it that when we set an element to Stretch, we do it via the HorizontalAlignment and VerticalAlignment properties? Why did the WPF design team decide to take this approach over having Width="Stretch" and Height="Stretch"? I presume it was a calculated decision, and I'm curious about the reasoning. CSS, among other technologies, follows the convention that stretching is done via the width and height properties, and that alignment affects positioning exclusively. This seems intuitive enough: stretching the element is manipulating its width and height, after all! Using the corresponding alignment property to stretch an element seems counter-intuitive and unusual in comparison. This makes me think they didn't just pick this option for no reason: they made a calculated decision and had reasons behind it. Width and Height use the double data type, which would ordinarily mean assigning it a string would be silly. However, WPF's Window objects can take Width="Auto", which gets treated as double.NaN. Couldn't Width="Stretch" be stored as double.PositiveInfinity or some other value?

    Read the article

  • Stylecop 4.7.37.0 has been released

    - by TATWORTH
    Stylecop  4.7.37.0 has been released at http://stylecop.codeplex.com/releases/view/79972The release notes follow:Add docs for new SA1650 spelling rule.Fix for 7395. Dont remove parenthesis around await expressions.Insert a returns element into docs within a see element.Update our tools folder StyleCop dll'sfix for 7392. Insert generic type docs for return types correctly.Fix for 7393. Allow documentation elements with attributes to end the string and still be valid.Make sure the MSBuild Task logs the warning id and type of exception. Unless the description field holds all this info VS cannot show the text in the Error List.Load custom dictionaries for multiple cultures. For a culture like en-GB; we load CustomDictionary.xml, then look for CustomDictionary.en-GB.xml and then CustomDictionary.en.xmlUpdate standard shipping dictionaries.Element documentation spelling fixes.Reduce the standard dictionaryUpdate our own devbuild StyleCop checks.Don't check spelling of xml documentation attributes are anything inside  <c> or <code> elements.Update StylingStyling update.Add timestamps for all the dependant files into the StyleCopResults.cache. Add a FileSystemWatcher to all custom dictionary files.Write out the full violation into the StyleCopResults.cache.Change a rules description text.Styling fixes.Styling fixes.NEW RULE: Check Spelling Of Element Documetation. Fix over 2000 spelling errors in our source code. Update the VS addin to show the rule violation in more detail. Add spelling checker to the deployment.Set our own Culture to en-USDocumentation spelling fixes.First draft of the documentation spelling checker.Fix for 7325. Don't throw 1126 in goto statements.Fix for 7090. Add TargetsDir to registry during install.Fix for 7060. Sort usings after moving them inside namespace.Fix FxCop issues.Fix for 7389. Detect CpuCount on Unix/MACFix for 6788. Allow opening curly brackets for scope. Added new tests.Updating constants.Fix for 7167. Show version number of StyleCop in VS Help window.Only output StyleCop excluded files if there are any.

    Read the article

  • WCF - Automatically create ServiceHost for multiple services

    - by Rajesh Pillai
    WCF - Automatically create ServiceHost for multiple services Welcome back readers!  This blog post is about a small tip that may make working with WCF servicehost a bit easier, if you have lots of services and you need to quickly host them for testing. Recently I was encountered a situation where we were faced to create multiple service host quickly for testing.  Here is the code snippet which is pretty self explanatory.  You can put this code in your service host which in this case is  a console application. class Program   {       static void Main(string[] args)       { // Stores all hosts           List<ServiceHost> hosts = new List<ServiceHost>();           try           { // Get the services element from the serviceModel element in the config file               var section = ConfigurationManager.GetSection("system.serviceModel/services") as ServicesSection;               if (section != null)               {                   foreach (ServiceElement element in section.Services)                   { // NOTE : If the assembly is in another namespace, provide a fully qualified name here in the form // <typename, namespace> // For e.g. Business.Services.CustomerService, Business.Services                       var serviceType = Type.GetType(element.Name); // Get the typeName                        var host = new ServiceHost(serviceType);                       hosts.Add(host); // Add to the host collection                       host.Open(); // Open the host                   }               }               Console.ReadLine();           }           catch (Exception e)           {               Console.WriteLine(e.Message);               Console.ReadLine();           }           finally           {               foreach (ServiceHost host in hosts)               {                   if (host.State == CommunicationState.Opened)                   {                       host.Close();                   }                   else                   {                       host.Abort();                   }               }           }       }   } I hope you find this useful.  You can make this as a windows service if required.

    Read the article

  • OpenGL Application displays only 1 frame

    - by Avi
    EDIT: I have verified that the problem is not the VBO class or the vertex array class, but rather something else. I have a problem where my vertex buffer class works the first time its called, but displays nothing any other time its called. I don't know why this is, and it's also the same in my vertex array class. I'm calling the functions in this order to set up the buffers: enable client states bind buffers set buffer / array data unbind buffers disable client states Then in the draw function, that's called every frame: enable client states bind buffers set pointers unbind buffers bind index buffer draw elements unbind index buffer disable client states Is there something wrong with the order in which I'm calling the functions, or is it a more specific code error? EDIT: here's some of the code Code for setting pointers: //element is the vertex attribute being drawn (e.g. normals, colors, etc.) static void makeElementPointer(VertexBufferElements::VBOElement element, Shader *shade, void *elementLocation) { //elementLocation is BUFFER_OFFSET(n) if a buffer is bound switch (element) { .... glVertexPointer(3, GL_FLOAT, 0, elementLocation); //changes based on element .... //but I'm only dealing with } //vertices for now } And that's basically all the code that isn't just a straight OpenGL function call.

    Read the article

  • Making WatiN Wait for JQuery document.Ready() Functions to Complete

    - by Steve Wilkes
    WatiN's DomContainer.WaitForComplete() method pauses test execution until the DOM has finished loading, but if your page has functions registered with JQuery's ready() function, you'll probably want to wait for those to finish executing before testing it. Here's a WatiN extension method which pauses test execution until that happens. JQuery (as far as I can see) doesn't provide an event or other way of being notified of when it's finished running your ready() functions, so you have to get around it another way. Luckily, because ready() executes the functions it's given in the order they're registered, you can simply register another one to add a 'marker' div to the page, and tell WatiN to wait for that div to exist. Here's the code; I added the extension method to Browser rather than DomContainer (Browser derives from DomContainer) because it's the sort of thing you only execute once for each of the pages your test loads, so Browser seemed like a good place to put it. public static void WaitForJQueryDocumentReadyFunctionsToComplete(this Browser browser) { // Don't try this is JQuery isn't defined on the page: if (bool.Parse(browser.Eval("typeof $ == 'function'"))) { const string jqueryCompleteId = "jquery-document-ready-functions-complete"; // Register a ready() function which adds a marker div to the body: browser.Eval( @"$(document).ready(function() { " + "$('body').append('<div id=""" + jqueryCompleteId + @""" />'); " + "});"); // Wait for the marker div to exist or make the test fail: browser.Div(Find.ById(jqueryCompleteId)) .WaitUntilExistsOrFail(10, "JQuery document ready functions did not complete."); } } The code uses the Eval() method to send JavaScript to the browser to be executed; first to check that JQuery actually exists on the page, then to add the new ready() method. WaitUntilExistsOrFail() is another WatiN extension method I've written (I've ended up writing really quite a lot of them) which waits for the element on which it is invoked to exist, and uses Assert.Fail() to fail the test with the given message if it doesn't exist within the specified number of seconds. Here it is: public static void WaitUntilExistsOrFail(this Element element, int timeoutInSeconds, string failureMessage) { try { element.WaitUntilExists(timeoutInSeconds); } catch (WatinTimeoutException) { Assert.Fail(failureMessage); } }

    Read the article

< Previous Page | 93 94 95 96 97 98 99 100 101 102 103 104  | Next Page >