Search Results

Search found 2724 results on 109 pages for 'absolute positioning'.

Page 98/109 | < Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >

  • usercontrol hosted in IE renders as a textbox

    - by coxymla
    On my ongoing saga to mirror the hosting of a legacy app on a clean box, I've hit my next snag. One page relies on a big .NET UserControl that on the new machine renders only as a big, greyed out textarea (greyed out vertical scrollbar on the right hand edge. Inspecting the source shows the expected object tag.) This is particularly tricky because nobody seems to know much about hosted UserControls and all the discussions data back to 2002-2004. The page is quite simple: <%@ Page language="c#" Codebehind="DataExport.aspx.cs" AutoEventWireup="false" Inherits="yyyyy.Web.DataExport" %> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN" > <html> <head> <title>DataExport</title> <link rel="Configuration" href="/xxxxx/yyyyy/DataExport.config"> </head> <body style="margin:0px;padding:0px;overflow:hidden"> <OBJECT id="DataExport" style="WIDTH: 100%; HEIGHT: 100%; position:absolute; left: 0px; top:0px" classid="yyyyy.Common.dll#yyyyy.Controls.DataExport" VIEWASTEXT> </OBJECT> </body> </html> The config file referenced: <?xml version="1.0" encoding="utf-8" ?> <configuration> <configSections> <sectionGroup name="yyyyy"> <section name="dataExport" type="yyyyy.Controls.DataExportSectionHandler,yyyyy.Common" /> </sectionGroup> </configSections> <yyyyy> <dataExport> <layoutFile>http://vm2/xxxxx/yyyyy/layout.xml</layoutFile> <webServiceUrl>http://vm2/xxxxx/yyyyy/services/yyyyy.asmx</webServiceUrl> </dataExport> </yyyyy> </configuration> What I've checked: Security permissions should be OK, the site is trusted and adding a URL exception to grant FullTrust doesn't change anything. Config file is acessible over the web, layout.xml is accessible, ASMX shows the expected command list Machine.config grants GET permission for the usercontrol.config file. What perhaps looks fishy to me: The DataExport UserControl references Aspose.Excel to generate the spreadsheets it exports. When I navigate to the page and get a blank textbox, then run gacutil /ldl, nothing is in the local download cache. On the working machine, running the same command after viewing the page shows a laundry list of DLLs including the control DLL and the Aspose DLL.

    Read the article

  • show-hide image onmouseover

    - by butters
    I have 3 images on top of each other. The first one is a normal .jpg image, the second a greyscale version and the 3rd is some kind of effect i add with a transparent .png Now what i want is that, if i move the mouse over those images, the greyscale image is hidden or replaced by another image and afterwards visible again. The problem here is that i am a js noob, so it's kind of hard for me to find a solution ^^ my code looks something like this: <html> <head> <style type="text/css"> <!-- ul li{ display: inline-table; } .frame{ position: relative; height: 110px; width: 110px; } .frame div{ position: absolute; top:0px; left:0px; } .effect{ background:url(images/effect.png) no-repeat; height:110px; width: 110px; } .image{ height:100px; width:100px; border: 1px solid red; margin:4px; } .greyscale{ height:100px; width:100px; border: 1px solid red; margin:4px; } --> </style> </head> <body> <ul> <li> <div class="frame"> <div class="image"><img src="images/pic1.jpg" height="100" width="100"></div> <div class="greyscale"><img src="images/grey1.jpg" height="100" width="100"></div> <div class="effect">qwert</div> </div> </li> <li> <div class="frame"> <div class="image"><img src="images/pic2.jpg" height="100" width="100"></div> <div class="greyscale"><img src="images/grey2.jpg" height="100" width="100"></div> <div class="effect">qewrt</div> </div> </li> </ul> </body> </html> </code></pre> would be super-awesome if someone can help me out :)

    Read the article

  • jquery xml slideshow using ajax

    - by Codemaster Snake
    Hi all, I am trying to create a JQuery based slider using ajax to load images url from a xml file and then creating a html li list dynamically. Till now I am able to append and create DOM structure using Jquery. But I am not able to access the dynamically created list. I have also tried custom events using bind but not able to successfully implement it. Following is my jquery plugin code: (function($){ $.fn.genie = function(options) { var genie_dom = "<div class='genie_wrapper'><ul class='genie'></ul></div>"; var o, base; var genie_styles = "<style>.genie_wrapper{overflow:hidden}.genie{position: relative;margin:0;padding:0}.genie li {position: absolute;margin:0;padding:0}</style>"; var defaults = { width : '960px', height : '300px', background_color : '#000000', xml : 'genie.xml', speed : 1000, pause: 1000 }; base = $(this); o = $.extend(defaults, options); return this.each(function() { create_elements(); }); function create_elements() { $(base).html(genie_dom); $('head').append(genie_styles); $('.genie_wrapper').css({'background-color' : o.background_color, width : o.width, height: '300px', overflow: ''}); $.ajax({ type: "GET", url: o.xml, dataType: "xml", success: function(xml) { var slides = $(xml).find('slide'); var count = 0; $(slides).each(function(){ $('.genie').append('<li class="slide" id="slide'+count+'"><img src="' + $(this).text() + '" /></li>'); $('.genie li:last').css({'z-index' : count}); count++; }); } }); } } })(jQuery); In my html file: There is only one empty div to which I am calling my plugin like $(document).ready(function() { $('.slideshow').genie(); }); I have also tried using following everywhere in JS: $(".slide").bind("start_animation", function(e){ $(this).fadeOut(1000); alert($(this).html()); }); $(".slide").trigger("start_animation"); I want to animate li list using animate function, Can anyone please tell me how to implement it... It would be of great help... Regards, Neeraj Kumar EDIT: Can Anyone help me out please????

    Read the article

  • Element to string in HTMLDocument

    - by kalpesh
    i have a Element object its a HTMLDocument object and i want to string value of this element. i want this result Christina Toth, Pharm. D. ======================= plz see below code. public static void main(String args[]) throws Exception { InputStream is = Nullsoft.getInputStream(); InputStreamReader isr = new InputStreamReader(is); BufferedReader br = new BufferedReader(isr); HTMLEditorKit htmlKit = new HTMLEditorKit(); HTMLDocument htmlDoc = (HTMLDocument) htmlKit.createDefaultDocument(); HTMLEditorKit.Parser parser = new ParserDelegator(); HTMLEditorKit.ParserCallback callback = htmlDoc.getReader(0); parser.parse(br, callback, true); // Parse ElementIterator iterator = new ElementIterator(htmlDoc); Element element; while ((element = iterator.next()) != null) { AttributeSet attributes = element.getAttributes(); Object name = attributes.getAttribute(StyleConstants.NameAttribute); if ((name instanceof HTML.Tag) && ((name == HTML.Tag.DIV) || (name == HTML.Tag.H2) || (name == HTML.Tag.H3))) { StringBuffer text = new StringBuffer(); int count = element.getElementCount(); for (int i = 0; i < count; i++) { Element child = element.getElement(i); AttributeSet childAttributes = child.getAttributes(); // if (childAttributes.getAttribute(StyleConstants.NameAttribute) == HTML.Tag.CONTENT) { int startOffset = child.getStartOffset(); int endOffset = child.getEndOffset(); int length = endOffset - startOffset; text.append(htmlDoc.getText(startOffset, length)); } } System.out.println(name + ": " + text.toString()); } } System.exit(0); } public static InputStream getInputStream() { String text = "<html>\n" + "<head>\n" + "<title>pg_0001</title>\n" + "\n" + "<style type=\"text/css\">\n" + ".ft3{font-style:normal;font-weight:bold;font-size:11px;font-family:Helvetica;color:#000000;}\n" + "</style>\n" + "</head>\n" + "<body vlink=\"#FFFFFF\" link=\"#FFFFFF\" bgcolor=\"#ffffff\">\n" + "\n" + "\n" + "<div style=\"position:absolute;top:597;left:252\"><nobr><span class=\"ft3\">Christina Toth, Pharm. D.</span></nobr></div>\n" + "\n" + "\n" + "</body>\n" + "</html>"; InputStream is = null; try { is = new ByteArrayInputStream(text.getBytes("UTF-8")); } catch (UnsupportedEncodingException e) { e.printStackTrace(); } return is; }

    Read the article

  • JSON or YAML encoding in GWT/Java on both client and server

    - by KennethJ
    I'm looking for a super simple JSON or YAML library (not particularly bothered which one) written in Java, and can be used in both GWT on the client, and in its original Java form on the server. What I'm trying to do is this: I have my models, which are shared between the client and the server, and these are the primary source of data interchange. I want to design the web service in between to be as simple as possible, and decided to take the RESTful approach. My problem is that I know our application will grow substantially in the future, and writing all the getters, setters, serialization, factories, etc. by hand fills me with absolute dread. So in order to avoid it, I decided to implement annotations to keep track of attributes on the models. The reason I can't just serialize everything directly, using GWT's own one, or one which works through reflection, is because we need a certain amount of logic going on in the serialization process. I.e. whether references to other models get serialized during the serialization of the original model, or whether an ID is just passed, and general simple things like that. I've then written an annotation processor to preprocess my shared models and generate an implementing class with all the getters, setters, serialization, lazy-loading, etc. To make a long story short, I need some type of simple YAML or JSON library, which allows me to encode and decode manually, so I can generate this code through my annotation processor. I have had a look around the interwebs, but every single one I ran into supported some reflection which, while all fine and dandy, make it pretty much useless for GWT. And in the case of GWT's own JSON library, it uses JSNI for speed purposes, making it useless server side. One solution I did think about involved writing writing two sets of serialization methods on the models, one for the client and one for the server, but I'd rather not do that. Also, I'm pretty new to GWT, and even though I have done a lot of Java, it was back in the 1.2 days, so it's a bit rusty. So if you think I'm going about this problem completely the wrong way, I'm open to suggestions.

    Read the article

  • how to get mxml file in ActionScript class

    - by nemade-vipin
    hello friend I want to refer my mxml file into Actionscript class.My code is :- Mxml file is :- var User:Authentication; User = new Authentication(); User.authentication(); } ]] <mx:Panel width="100%" height="100%" layout="absolute"> <mx:TabNavigator width="100%" height="100%" id="viewstack2"> <mx:Form label="Login Form" id="loginform"> <mx:FormItem label="Mobile no:" creationPolicy="all"> <mx:TextInput id="mobileno"/> </mx:FormItem> <mx:FormItem label="Password:" creationPolicy="all"> <mx:TextInput displayAsPassword="true" id="password" /> </mx:FormItem> <mx:FormItem> <mx:Button label="Login" click="authentication()"/> </mx:FormItem> </mx:Form> <mx:Form label="Child List"> <mx:Label width="100%" color="blue" text="Select Child."/> </mx:Form> </mx:TabNavigator> </mx:Panel> Action script class is package SBTSBusineesObject { import generated.webservices.*; import mx.collections.ArrayCollection; import mx.controls.Alert; import mx.rpc.events.FaultEvent; public class Authentication { [Bindable] private var childName:ArrayCollection; [Bindable] private var childId:ArrayCollection; private var photoFeed:ArrayCollection; private var arrayOfchild:Array; private var newEntry:GetSBTSMobileAuthentication; public var user:SBTSWebService; public var mxmlobj:SBTS =null; public function authentication():void { user = new SBTSWebService(); mxmlobj = new SBTS(); if(user!=null) { user.addSBTSWebServiceFaultEventListener(handleFaults); user.addgetSBTSMobileAuthenticationEventListener(authenticationResult); newEntry = new GetSBTSMobileAuthentication(); if(newEntry!=null) { if(mxmlobj != null) { newEntry.mobile = mxmlobj.mobileno.text ; newEntry.password=mxmlobj.password.text; } user.getSBTSMobileAuthentication(newEntry); } } } public function handleFaults(event:FaultEvent):void { Alert.show("A fault occured contacting the server. Fault message is: " + event.fault.faultString); } public function authenticationResult(event:GetSBTSMobileAuthenticationResultEvent):void { if(event.result != null && event.result._return>0) { if(event.result._return > 0) { var UserId:int = event.result._return; if(mxmlobj != null) { mxmlobj.loginform.enabled = false; mxmlobj.viewstack2.selectedIndex=1; } } else { Alert.show("Authentication fail"); } } } } }

    Read the article

  • addchild not displaying content

    - by Rajeev
    In the following code i dont have any error but why is that the addchild(video); i.e, the the video captured by webcam is not displayed <?xml version="1.0" encoding="utf-8"?> <mx:Application xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute"> <mx:Script> <![CDATA[ import org.com.figurew; import mx.controls.Button; import mx.controls.Alert; import flash.display.InteractiveObject; import flash.display.Sprite; import flash.media.*; import flash.net.*; public function addBody():void { var ret:Number = figurew.getInstance().getparam(); if( ret == 1) { Alert.show("Camera detected"); } if(ret == 0) { Alert.show("No camera detected"); } var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(30, 40); video.attachCamera(cam); addChild(video); } else { trace("No Camera Detected"); } } ]]> </mx:Script> <mx:Button label="Test camera" click="addBody();" x="99" y="116"/> </mx:Application > figurew.as package org.com { import flash.display.InteractiveObject; import flash.display.Sprite; import flash.media.*; import flash.net.*; public class figurew extends Sprite { public function figurew() { //getparam(); var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(300, 450); video.attachCamera(cam); addChild(video); } else { trace("No Camera Detected"); } } public function getparam():Number { var cam:Camera = Camera.getCamera(); if(cam != null) { cam.setMode(640, 480, 30); var video:Video = new Video(300, 450); video.attachCamera(cam); addChild(video); return 1; } else { return 0; trace("No Camera Detected"); } } private static var _instance:figurew = null; public static function getInstance():cldAS { if(_instance == null) { trace("No instance found"); _instance = new cldAS(); } return _instance; } } }

    Read the article

  • JSF 2.0: Preserving component state across multiple views

    - by tlind
    The web application I am developing using MyFaces 2.0.3 / PrimeFaces 2.2RC2 is divided into a content and a navigation area. In the navigation area, which is included into multiple pages using templating (i.e. <ui:define>), there are some widgets (e.g. a navigation tree, collapsible panels etc.) of which I want to preserve the component state across views. For example, let's say I am on the home page. When I navigate to a product details page by clicking on a product in the navigation tree, my Java code triggers a redirect using navigationHandler.handleNavigation(context, null, "/detailspage.jsf?faces-redirect=true") Another way of getting to that details page would be by directly clicking on a product teaser that is shown on the home page. The corresponding <h:link> would lead us to the details page. In both cases, the expansion state of my navigation tree (a PrimeFaces tree component) and my collapsible panels is lost. I understand this is because the redirect / h:link results in the creation of a new view. What is the best way of dealing with this? I am already using MyFaces Orchestra in my project along with its conversation scope, but I am not sure if this is of any help here (since I'd have to bind the expansion/collapsed state of the widgets to a backing bean... but as far as I know, this is not possible). Is there a way of telling JSF which component states to propagate to the next view, assuming that the same component exists in that view? I guess I could need a pointer into the right direction here. Thanks! Update 1: I just tried binding the panels and the tree to a session-scoped bean, but this seems to have no effect. Also, I guess I would have to bind all child components (if any) manually, so this doesn't seem like the way to go. Update 2: Binding UI components to non-request scoped beans is not a good idea (see link I posted in a comment below). If there is no easier approach, I might have to proceed as follows: When a panel is collapsed or the tree is expanded, save the current state in a session-scoped backing bean (!= the UI component itself) The components' states are stored in a map. The map key is the component's (hopefully) unique, relative ID. I cannot use the whole absolute component path here, since the IDs of the parent naming containers might change if the view changes, assuming these IDs are generated programmatically. As soon as a new view gets constructed, retrieve the components' states from the map and apply them to the components. For example, in case of the panels, I can set the collapsed attribute to a value retrieved from my session-scoped backing bean.

    Read the article

  • CSS overflow character not pushing down <div>

    - by Uncle Toby
    I have a <div> called bigbox which contain a <div>called wrapper . The wrapper contain 2 <div> called textbox and checkbox. If the characters inside textbox overflow , it doesn't push the other wrapper below . How can I make the below wrapper go down ? here is the jsfiddle : http://jsfiddle.net/WA63P/ <html> <head> <title>Page</title> <script type="text/javascript" src="jquery-1.9.1.min.js"></script> <style type="text/css"> .bigbox { background-color: #F5E49C; color: #000; padding: 0 5px; width:280px; height:500px; position: absolute; text-align: center;content: "";display: block;clear: both; } .box { background-color: #272822; color: #9C5A3C; height:100px; width:260px; margin-bottom: 10px; position: relative; top:10px; } .textbox { background-color: #FFFFFF; color: #272822; height:100px; width:160px;float:left;text-align: left } .checkbox { background-color: #FFFFFF; height:50px; width:50px; float:right; d } </style> <div class="bigbox"> <div class="box"> <div class="textbox">background background background background background background background background background background background background background background background background background background background background background background </div> <div class="checkbox"> </div> </div> <div class="box"> <div class="textbox"> </div> <div class="checkbox"> </div> </div> </body> </html>

    Read the article

  • Ie7 float problems and hiperlinks not clickable

    - by Uffo
    Markup <ul class="navigation clearfix"> <li class="navigation-top"></li> <div class="first-holder" style="height:153px;"> <dl class="hold-items clearfix"> <dd class="clearfix with"><a href="http://site.com" title="Protokoll">Protokoll</a></dd> <dd class="with-hover"><a href="http://site.com" title="Mein/e Unternehmen">Mein/e Unternehmen</a></dd> <dd class="with"><a class="face-me" href="http://site.com" title="Erweiterte Suche">Erweiterte Suche</a></dd> <dd class="with"><a href="http://site.com" title="Abmelden">Abmelden</a></dd> </dl> </div><!--[end] /.first-holder--> <li class="navigation-bottom"></li> </ul><!--[end] /.navigation--> Css: .first-holder{height:304px;position:relative;width:178px;overflow:hidden;margin-bottom:0px;padding-bottom: 0px;} .hold-items{top:0px;position:absolute;} .navigation dd.with{line-height:38px;background:url('/images/sprite.png') no-repeat -334px -46px;width:162px;height:38px;padding-bottom:0px;overflow: hidden;} .navigation dd.with a{position:relative;outline:0;display:block;font-weight:bold;color:#3f78c0;padding-left:10px;line-height:38px;} .with-hover{background:url('/images/sprite.png') no-repeat -505px -47px;width:178px;height:38px;line-height:38px;overflow:none;} .with-hover a{position:relative;display:block;font-weight:bold;color:#fff;padding-left:10px} .navigation-top{background:url('/images/sprite.png') no-repeat -694px -46px;width:160px;height:36px;} .navigation-top a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-top a span{display:block;background:url('/images/sprite.png') no-repeat -212px -65px;width:8px;height:6px;} .navigation-bottom{background:url('/images/sprite.png') no-repeat -784px -402px;width:160px;height:37px;} .navigation-bottom a{display:block;outline:0;height:20px;padding-top:18px;padding-left:138px;} .navigation-bottom a span{display:block;background:url('/images/sprite.png') no-repeat -212px -74px;width:8px;height:6px;} Also the links, are not clickable, if I click on a link in IE7 it doesn't do the action..it doesn't redirect me to the location. This is how it looks in IE7: http://screencast.com/t/MGY4NjljZjc This is how it look in IE8,Firefox,Chrome and so on http://screencast.com/t/MzhhMDQ1M What I'm doing wrong PS: .navigation-top a span and .navigation-bottom a span I'm using some where else, but that it's ok it works fine.

    Read the article

  • How do I use data from the main window in a sub-window?

    - by eagle
    I've just started working on a photo viewer type desktop AIR app with Flex. From the main window I can launch sub-windows, but in these sub-windows I can't seem to access the data I collected in the main window. How can I access this data? Or, how can I send this data to the sub-window on creation? It doesn't need to be dynamically linked. myMain.mxml <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/mx" width="260" height="200" title="myMain"> <fx:Declarations> </fx:Declarations> <fx:Script> <![CDATA[ public function openWin():void { new myWindow().open(); } public var myData:Array = new Array('The Eiffel Tower','Paris','John Doe'); ]]> </fx:Script> <s:Button x="10" y="10" width="240" label="open a sub-window" click="openWin();"/> </s:WindowedApplication> myWindow.mxml <?xml version="1.0" encoding="utf-8"?> <mx:Window name="myWindow" title="myWindow" xmlns:mx="http://www.adobe.com/2006/mxml" layout="absolute" width="640" height="360"> <mx:Script> <![CDATA[ ]]> </mx:Script> <mx:Label id="comment" x="10" y="10" text=""/> <mx:Label id="location" x="10" y="30" text=""/> <mx:Label id="author" x="10" y="50" text=""/> </mx:Window> I realize this might be a very easy question but I have searched the web, read and watched tutorials on random AIR subjects for a few days and couldn't find it. The risk of looking like a fool is worth it now, I want to get on with my first app!

    Read the article

  • chrome renders js different depending on the extension of the file to render [testcase included]

    - by pakore
    I was trying to implement an image panner I found here Chrome renders the same document differently depending on the extension of the file requested. I have created a test case, where it works when the file it's not named as test.xhtml You can download the test case from here Does anybody know why or how to solve it? I want my files to be .xhtml In IE and FF it works fine. Code: test.html / test.xhtml (change the name to see that works with one but not with the other). <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"/> <style type="text/css"> /*Default CSS for pan containers*/ .pancontainer { position: relative; /*keep this intact*/ overflow: hidden; /*keep this intact*/ width: 300px; height: 300px; border: 1px solid black; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript" src="http://www.dynamicdrive.com/dynamicindex4/imagepanner.js"></script> </head> <body> <div class="pancontainer" data-orient="center" data-canzoom="yes" style="width: 350px; height: 200px; float: left; position: relative; overflow-x: hidden; overflow-y: hidden; cursor: move; "><img src="./test_files/image.jpg" style="position: absolute; width: 700px; height: 525px; left: -175px; top: -163px; display: block;" /> </div> </body> </html>

    Read the article

  • CSS Z-Index with Gradient Background

    - by Jona
    I'm making a small webpage where the I would like the top banner with some text to remain on top, as such: HTML: <div id = "topBanner"> <h1>Some Text</h1> </div> CSS: #topBanner{ position:fixed; background-color: #CCCCCC; width: 100%; height:200px; top:0; left:0; z-index:900; background: -moz-linear-gradient(top, rgba(204,204,204,0.65) 0%, rgba(204,204,204,0.44) 32%, rgba(204,204,204,0.12) 82%, rgba(204,204,204,0) 100%); /* FF3.6+ */ background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgba(204,204,204,0.65)), color-stop(32%,rgba(204,204,204,0.44)), color-stop(82%,rgba(204,204,204,0.12)), color-stop(100%,rgba(204,204,204,0))); /* Chrome,Safari4+ */ background: -webkit-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Chrome10+,Safari5.1+ */ background: -o-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* Opera 11.10+ */ background: -ms-linear-gradient(top, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* IE10+ */ background: linear-gradient(to bottom, rgba(204,204,204,0.65) 0%,rgba(204,204,204,0.44) 32%,rgba(204,204,204,0.12) 82%,rgba(204,204,204,0) 100%); /* W3C */ filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#a6cccccc', endColorstr='#00cccccc',GradientType=0 ); /* IE6-9 */ } /*WebPage Header*/ h1{ font-size:3em; color:blue; text-shadow:#CCCCCC 2px 2px 2px, #000 0 -1px 2px; position: absolute; width: 570px; left:50%; right:50%; line-height:20px; margin-left: -285px; z-index:999; } The z-index works fine, except that because I'm using a gradient any time I scroll down the elements behind the banner are still visible, albeit somewhat transparent. Is there any way to make them total invisible? i.e., what I'm trying to do is make it as though the banner is a solid color, even though it's a gradient. Thanks in advance for any help!

    Read the article

  • How to replicate this button in CSS

    - by jasondavis
    I am trying to create a CSS theme switcher button like below. The top image shows what I have so far and the bottom image shows what I am trying to create. I am not the best at this stuff I am more of a back-end coder. I could really use some help. I have a live demo of the code here http://dabblet.com/gist/2230656 Just looking at what I have and the goal image, some differences. I need to add a gradient The border is not right on mine Radius is a little off Possibly some other stuff? Also here is the code...it can be changed anyway to improve this, the naming and stuff could be improved I am sure but I can use any help I can get. HTML <div class="switch-wrapper"> <div class="switcher left selected"> <span id="left">....</span> </div> <div class="switcher right"> <span id="right">....</span> </div> </div> CSS /* begin button styles */ .switch-wrapper{ width:400px; margin:220px; } .switcher { background:#507190; display: inline-block; max-width: 100%; box-shadow: 1px 1px 1px rgba(0,0,0,.3); position:relative; } #left, #right{ width:17px; height:11px; overflow:hidden; position:absolute; top:50%; left:50%; margin-top:-5px; margin-left:-8px; font: 0/0 a; } #left{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: 0px px; } #right{ background-image: url(http://www.codedevelopr.com/assets/images/switcher.png); background-position: -0px -19px; } .left, .right{ width: 30px; height: 25px; border: 1px solid #3C5D7E; } .left{ border-radius: 6px 0px 0px 6px; } .right{ border-radius: 0 6px 6px 0; margin: 0 0 0 -6px } .switcher:hover, .selected { background: #27394b; box-shadow: -1px 1px 0px rgba(255,255,255,.4), inset 0 4px 5px rgba(0,0,0,.6), inset 0 1px 2px rgba(0,0,0,.6); }

    Read the article

  • Keep div:hover open when changing nested select box

    - by JMC Creative
    This is an IE-only problem. .toolTip becomes visible when it's parent element is :hovered over. Inside of .toolTip is a select box. When the user opens the select box to make a selection, the parent element is being "un-hovered", if you will. To put it another way, when I try to select something from the dropdown, the whole thing hides itself again. I'm sure it has something to do with the way IE interprets the stylesheet, but I don't know what or where. Here is some relevant code (edited for clarity): #toolBar .toolTip { position: absolute; display:none; background: #fff; line-height: 1em; font-size: .8em; min-width: 300px; bottom: 47px; left: -5px; padding: 0 ; } #toolBar div:hover .toolTip { display:block; } and <div id="toolBar"> <div class="socialIcon"> <a href=""><img src="/im/social/nytimes.png" alt="NY Times Bestsellers" /></a> <span class="toolTip"> <h1>NY Times Bestsellers Lists</h1> <div id="nyTimesBestsellers"> <?php include('/ny-times-bestseller-feed.php') ?> </div> <p><img src="/im/social/nytimes.png" alt="NY Times Bestseller Lists" /> Change List <select id="nyTimesChangeCurrentList" name="nyTimesChangeCurrentList"> <option value="hardcover-fiction">Hardcover Fiction</option> <option value="hardcover-nonfiction">Hardcover Nonfiction</option> <option value="hardcover-advice">Hardcover Advice</option> </select> </p> </span> </div> </div>

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • Jquery hover with animation

    - by Brian
    anyone know how to stop a .hover happening again before the mouseout animation has finished? I have the following code which has 4 anchors. Once hovered over the anchor the related anchor slides in using animation. My problem is you hover out and in quickly, before the square has been set back to 0px it increases the slide distance. <body class="home"> <div id="container"> <a class="page-link homet" id="anim-1"></a> <a class="page-link about" id="anim-2"></a> <a class="page-link portfolio" id="anim-3"></a> <a class="page-link contacts" id="anim-4"></a> <div id="header"> <div id="logo"> </div> <ul id="navigation"> <li><a id="1"></a></li> <li><a id="2"></a></li> <li><a id="3"></a></li> <li><a id="4"></a></li> </ul> </div> <div id="main"> <div id="left-content"> </div> <div id="main-content"> </div> </div> </div> </body> </html> Jquery var cc = { displayAnim : function () { actionLink = $("#container #header #navigation li a"); movePosition = "0"; $("#container a.page-link").css({ position:"absolute", right: 0}); $(actionLink).hoverIntent( function() { circleToReveal = $(this).attr('id'); switch (circleToReveal) { case "1" : movePostion = "386" break; case "2" : moveposition = "514" break; case "3" : movePosition = "643" break; case "4" : movePosition = "400" break; default : movePosition = "772" }; /* console.log(movePosition); */ $("#container #anim-" +circleToReveal+ "").stop().animate({"right": "+="+ movePosition +"px"}, "slow"); }, function() { $("#container #anim-" +circleToReveal+ "").stop().animate({"right": "-="+ movePosition +"px"}, "slow"); } ); } }; $(window).load (function () { $("body").addClass('js'); $("a.pagelink").hide(); cc.displayAnim(); });

    Read the article

  • Hierarchy inheritance

    - by reito
    I had faced the problem. In my C++ hierarchy tree I have two branches for entities of difference nature, but same behavior - same interface. I created such hierarchy trees (first in image below). And now I want to work with Item or Base classes independetly of their nature (first or second). Then I create one abstract branch for this use. My mind build (second in image below). But it not working. Working scheme seems (third in image below). It's bad logic, I think... Do anybody have some ideas about such hierarchy inheritance? How make it more logical? More simple for understanding? Image Sorry for my english - russian internet didn't help:) Update: You ask me to be more explicit, and I will be. In my project (plugins for Adobe Framemaker) I need to work with dialogs and GUI controls. In some places I working with WinAPI controls, and some other places with FDK (internal Framemaker) controls, but I want to work throw same interface. I can't use one base class and inherite others from it, because all needed controls - is a hierarchy tree (not one class). So I have one hierarchy tree for WinAPI controls, one for FDK and one abstract tree to use anyone control. For example, there is an Edit control (WinEdit and FdkEdit realization), a Button control (WinButton and FdkButton realization) and base entity - Control (WinControl and FdkControl realization). For now I can link my classes in realization trees (Win and Fdk) with inheritence between each of them (WinControl is base class for WinButton and WinEdit; FdkControl is base class for FdkButton and FdkEdit). And I can link to abstract classes (Control is base class for WinControl and FdkControl; Edit is base class for WinEdit and FdkEdit; Button is base class for WinButton and FdkButton). But I can't link my abstract tree - compiler swears. In fact I have two hierarchy trees, that I want to inherite from another one. Update: I have done this quest! :) I used the virtual inheritence and get such scheme (http://img12.imageshack.us/img12/7782/99614779.png). Abstract tree has only absolute abstract methods. All inheritence in abstract tree are virtual. Link from realization tree to abstract are virtual. On image shown only one realization tree for simplicity. Thanks for help!

    Read the article

  • opacity in ie using absolutely positioned divs not working

    - by camomileCase
    I've been banging my head against the wall for a few hours how trying to sort this out. I'm trying to position one div on top of another for the purpose of fading one in on top of the other. The divs will have an image and some other html in them. I cannot get opacity to work in ie8. I've simplified my html as much as possible: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <style> * { margin: 0; padding: 0; } .carousel-container { position: relative; } .carousel-overlay { position: absolute; } #carousel-container-a { opacity: 1; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=100)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=100); } #carousel-container-b { opacity: 0; -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=0)"; filter: progid:DXImageTransform.Microsoft.Alpha(Opacity=0); } h1 { font-size: 100px; } </style> </head> <body> <div id="carousel-container-a" class="carousel-container"> <div class="carousel-overlay" style="left: 10px; top: 10px;"> <h1 style="color: black;">Showcase</h1> </div> <!-- other elements removed for simplicity --> </div> <div id="carousel-container-b" class="carousel-container"> <div class="carousel-overlay" style="left: 20px; top: 20px;"> <h1 style="color: red;">Welcome</h1> </div> <!-- other elements removed for simplicity --> </div> </body> </html> Why doesn't the opacity work? How can I make it work?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Jscrollpane causese text to disappear on internet explorer

    - by Crippletoe
    Hello all, in my current site, i am using the new Jscrollpane in order to generate a scrollbar for a menu (not my descision but the designer's descision so i dont wanna get into how 90's that all looks like..). my menu is based on a <UL> the <li> elements inside it have the attribute "text-align: right;". my problem that on IE alone the menu text doesnt show when i apply the ScrollPane to the menu. when i delete the ScrollPane function from my code- the menu re-appears. i checked the page with "microsoft Expression" DOM inspector in order to examine how IE sees my code and i can see the <li> elements there, only the text inside them is missing. when i disable the "text-align: right;" for the <li> in my CSS, the text shows again. i suspect this has something to do with the jScrollPane's containing which is relatively aligned but i cannot be sure.. can anyone suggest some fix for this problem? a link to a page where you can see the problem is here: http://kaplanoland.com/index.php?option=com_content&view=article&id=2&Itemid=12 the problematic menu is on the right side of the page. on every browser but IE you can see the text. only on IE not. my CSS code for that menu (not including the jScrollPane CSS) is here: div#menu2{ position: absolute; top: 123px; right: 36px; width: 330px; height: 150px; } div#menu2_scroll{ /*the actual scroller*/ height: 150px; } div#menu2 div#menu2_contain{ } div#menu2 li{ text-align: right; } div#menu2 li span{ line-height: 18px; } div#menu2 a:link, div#menu2 a:visited{ color: #808285 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 a:hover, div#menu2 li#current a{ color: #000000 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 span.separator{ display: block; padding-top: 12px; padding-bottom: 40px; font-family: Arial, Helvetica, sans-serif; font-size: 12px; font-weight: bold; color: #000000; } div#menu2 span.separator span { padding-top: 12px; border-top-width: 1px; border-top-style: solid; border-top-color: #808285; } thank you all so much.

    Read the article

  • Feedback on Optimizing C# NET Code Block

    - by Brett Powell
    I just spent quite a few hours reading up on TCP servers and my desired protocol I was trying to implement, and finally got everything working great. I noticed the code looks like absolute bollocks (is the the correct usage? Im not a brit) and would like some feedback on optimizing it, mostly for reuse and readability. The packet formats are always int, int, int, string, string. try { BinaryReader reader = new BinaryReader(clientStream); int packetsize = reader.ReadInt32(); int requestid = reader.ReadInt32(); int serverdata = reader.ReadInt32(); Console.WriteLine("Packet Size: {0} RequestID: {1} ServerData: {2}", packetsize, requestid, serverdata); List<byte> str = new List<byte>(); byte nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // Password Sent to be Authenticated string string1 = Encoding.UTF8.GetString(str.ToArray()); str.Clear(); nextByte = reader.ReadByte(); while (nextByte != 0) { str.Add(nextByte); nextByte = reader.ReadByte(); } // NULL string string string2 = Encoding.UTF8.GetString(str.ToArray()); Console.WriteLine("String1: {0} String2: {1}", string1, string2); // Reply to Authentication Request MemoryStream stream = new MemoryStream(); BinaryWriter writer = new BinaryWriter(stream); writer.Write((int)(1)); // Packet Size writer.Write((int)(requestid)); // Mirror RequestID if Authenticated, -1 if Failed byte[] buffer = stream.ToArray(); clientStream.Write(buffer, 0, buffer.Length); clientStream.Flush(); } I am going to be dealing with other packet types as well that are formatted the same (int/int/int/str/str), but different values. I could probably create a packet class, but this is a bit outside my scope of knowledge for how to apply it to this scenario. If it makes any difference, this is the Protocol I am implementing. http://developer.valvesoftware.com/wiki/Source_RCON_Protocol

    Read the article

  • Define Javascript slider hit/rollover area

    - by Rob
    Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

    Read the article

  • javascript div movement not working

    - by William
    For some reason I can't move this div at all. Can anyone help me out with why this won't work? <!DOCTYPE html> <html lang="en"> <head> <title>Move Div Test</title> <meta charset="utf-8" /> <link href="/bms/style.css" rel="stylesheet" /> <style> body { text-align: center; background-color: #ffffff;} #box { position: absolute; left: 610px; top: 80px; height: 50px; width: 50px; background-color: #ff0000;} </style> <script type="text/javascript"> document.onkeydown=function(event){keyDown(event)}; document.onkeyup=function(event){keyUp(event)}; var box = document.getElementById('box'); var speed = 5; var keys = new Array(256); var i = 0; for (i = 0;i <= 256; i++){ keys[i] = false; } function keyDown(event){ if(!event){ //for IE event = window.event; } keys[event.keyCode] = true; } function keyUp(event){ if(!event){ //for IE event = window.event; } keys[event.keyCode] = false; } function update(){ if(keys[37]) box.style.left = parseInt(box.style.left) - speed + "px"; if(keys[39]) box.style.left = parseInt(box.style.left) + speed + "px"; if(keys[38]) box.style.top = parseInt(box.style.top) - speed + "px"; if(keys[40]) box.style.top = parseInt(box.style.top) + speed + "px"; } setInterval('update();', 1000/60); </script> </head> <body> <div id="box">blah</div> </body> </html>

    Read the article

  • Setting background-image with javascript

    - by Mattoe3k
    In chrome, safari, and opera setting the background image to an absolute reference such as: "/images/image.png" changes it to "http://sitepath/images/image.png". It does not do this in firefox. Is there any way to avoid this behavior, or is it written into the browser's javascript engine? Using jquery to set the background-image also does this problem. The problem is that I am posting the HTML to a php script that needs the urls in this specific format. I know that setting the image path relative fixes this, but I can't do that. The only other alternative would be to use a regexp. to convert the urls. Thanks. Test this in firefox, and chrome / webkit browser: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Untitled Document</title> </head> <body> <div style="height:400px;width:400px;background-image:url(/images/images/logo.gif);"> </div> <br /> <br /> <div id="test" style="height:400px;width:400px;"> </div> <script type="text/javascript" src="/javascripts/jquery.js"></script> <script type="text/javascript"> $(document).ready(function(){ $("#test").css('background-image',"url(/images/images/logo.gif)"); alert(document.getElementById('test').style.backgroundImage); }); </script> </body> </html>

    Read the article

< Previous Page | 94 95 96 97 98 99 100 101 102 103 104 105  | Next Page >