Search Results

Search found 44076 results on 1764 pages for 'large text'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 99/1764 | < Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >

  • Drawing text to <canvas> with @font-face does not work at the first time

    - by lemonedo
    Hi all, First try the test case please: http://lemon-factory.net/test/font-face-and-canvas.html I'm not good at English, so I made the test case to be self-explanatory. On the first click to the DRAW button, it will not draw text, or will draw with an incorrect typeface instead of the specified "PressStart", according to your browser. After then it works as expected. At the first time the text does not appear correctly in all browsers I've tested (Firefox, Google Chrome, Safari, Opera). Is it the standard behavior or something? Thank you. PS: Following is the code of the test case <!DOCTYPE html> <html> <head> <meta http-equiv=Content-Type content="text/html;charset=utf-8"> <title>@font-face and canvas</title> <style> @font-face { font-family: 'PressStart'; src: url('http://lemon-factory.net/css/fonts/prstart.ttf'); } canvas, pre { border: 1px solid #666; } pre { float: left; margin: .5em; padding: .5em; } </style> </head> <body> <div> <canvas id=canvas width=250 height=250> Your browser does not support the CANVAS element. Try the latest Firefox, Google Chrome, Safari or Opera. </canvas> <button>DRAW</button> </div> <pre id=style></pre> <pre id=script></pre> <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script> var canvas = document.getElementById('canvas') var ctx = canvas.getContext('2d') var x = 30 var y = 10 function draw() { ctx.font = '12px PressStart' ctx.fillStyle = '#000' ctx.fillText('Hello, world!', x, y += 20) ctx.fillRect(x - 20, y - 10, 10, 10) } $('button').click(draw) $('pre#style').text($('style').text()) $('pre#script').text($('script').text()) </script> </body> </html>

    Read the article

  • PHP: Ajax ignores line foldings in the text

    - by ilnur777
    I don't understand why my AJAX script ignores all line foldings. I first type text to the textarea and then put onclick to send button. Here is my AJAX realization: // creating ajax object // ==================== function createRequestObject(){ try { return new XMLHttpRequest() } catch(e) { try { return new ActiveXObject('Msxml2.XMLHTTP') } catch(e) { try { return new ActiveXObject('Microsoft.XMLHTTP') } catch(e) { return null; } } } } // message options (save, cancel) // ============================== function form1(text){ var http = createRequestObject(); if(http){ http.open("GET", "my_script.php?text=" + text); http.onreadystatechange = function (){ if(http.readyState == 4){ alert("Ok!"); } } http.send(null); } else { document.location = "my_script.php?text=" + text; } } html form <p align="justify" style="margin-right:10; margin-left:10;"> <table style="margin-right:10; margin-left:10;" align="center" border="0" cellpadding="0" cellspacing="0" width="680"> <TBODY> <form name="fgform"> <tr> <td width="680" height="100" colspan="2"><p><textarea id="edit_text1" name="edit_text" rows="3" style="width: 680; height: 100;"></textarea></p></td> </tr> <tr> <td width="340"><p><input type="button" id="saveB" value="Save Text" style="color:rgb(0,204,0); background-color:white; border-width:1; border-color:rgb(225,218,202); border-style:solid; width:100;" onclick="form1(document.getElementById('edit_text1').value);"></p></td> <td width="340"><p align="right">&nbsp;</p></td> </tr> </form> </TBODY> </table>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Jscrollpane causese text to disappear on internet explorer

    - by Crippletoe
    Hello all, in my current site, i am using the new Jscrollpane in order to generate a scrollbar for a menu (not my descision but the designer's descision so i dont wanna get into how 90's that all looks like..). my menu is based on a <UL> the <li> elements inside it have the attribute "text-align: right;". my problem that on IE alone the menu text doesnt show when i apply the ScrollPane to the menu. when i delete the ScrollPane function from my code- the menu re-appears. i checked the page with "microsoft Expression" DOM inspector in order to examine how IE sees my code and i can see the <li> elements there, only the text inside them is missing. when i disable the "text-align: right;" for the <li> in my CSS, the text shows again. i suspect this has something to do with the jScrollPane's containing which is relatively aligned but i cannot be sure.. can anyone suggest some fix for this problem? a link to a page where you can see the problem is here: http://kaplanoland.com/index.php?option=com_content&view=article&id=2&Itemid=12 the problematic menu is on the right side of the page. on every browser but IE you can see the text. only on IE not. my CSS code for that menu (not including the jScrollPane CSS) is here: div#menu2{ position: absolute; top: 123px; right: 36px; width: 330px; height: 150px; } div#menu2_scroll{ /*the actual scroller*/ height: 150px; } div#menu2 div#menu2_contain{ } div#menu2 li{ text-align: right; } div#menu2 li span{ line-height: 18px; } div#menu2 a:link, div#menu2 a:visited{ color: #808285 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 a:hover, div#menu2 li#current a{ color: #000000 ; font-family: Arial, Helvetica, sans-serif ; font-size: 12px ; } div#menu2 span.separator{ display: block; padding-top: 12px; padding-bottom: 40px; font-family: Arial, Helvetica, sans-serif; font-size: 12px; font-weight: bold; color: #000000; } div#menu2 span.separator span { padding-top: 12px; border-top-width: 1px; border-top-style: solid; border-top-color: #808285; } thank you all so much.

    Read the article

  • Mobile Safari text selection after input field focus

    - by Andy
    I have some legacy html that needs to work on old and new browsers (down to IE7) as well as the iPad. The iPad is the biggest issues because of how text selection is handled. On a page there is a textarea as well as some text instructions. The instructions are in a <div> and the user needs to be able to select the instructions. The problem is that once focus is placed in the textarea, the user cannot subsequently select the text instructions in the <div>. This is because the text cannot receive focus. According to the Safari Web Content Guide: Handling Events (especially, "Making Elements Clickable"), you can add a onclick event handler to the div you want to receive focus. This solution works (although it is not ideal) in iOS 6x but it does not work in iOS 5x. Does anyone have a suggestion that minimizes changes to our existing code and produces consistant user interaction. Here is sample code that shows the problem. <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <meta http-equiv="content-type" content="text/html; charset=UTF-8"> <script src="http://code.jquery.com/jquery-1.8.2.js"></script> <!-- Resources: Safari Web Content Guide: Handling Events (especially, "Making Elements Clickable") http://developer.apple.com/library/safari/#documentation/appleapplications/reference/safariwebcontent/HandlingEvents/HandlingEvents.html#//apple_ref/doc/uid/TP40006511-SW1 --> </head> <body> <div style="width:550"> <div onclick='function() { void(0); }'> <p>On the iPad, I want to be able to select this text after the textarea has had focus.</p> </div> <textarea rows="20" cols="80">After focus is in the textarea, can you select the text above?</textarea> </div> </body> </html>

    Read the article

  • Do you write common pre-conditions for a large number of unit test cases ?

    - by Vinoth Kumar
    I have heard/read writing common pre-conditions for a large number of test cases is a bad thing, since this dependency may cause large number of test cases to fail if something changes . What are your thoughts on it ? If this is so , then what exactly is the purpose of setUp() method in Junit that runs before each test case ? If the same code inside setUp() runs before each test case , why cant it run only once before running all the test cases together ?

    Read the article

  • Why do so few large websites run a Microsoft stack?

    - by realworldcoder
    Off the top of my head, I can think of a handful of large sites which utilize the Microsoft stack Microsoft.com Dell MySpace PlentyOfFish StackOverflow Hotmail, Bing, WindowsLive However, based on observation, nearly all of the top 500 sites seem to be running other platforms.What are the main reasons there's so little market penetration? Cost? Technology Limitations? Does Microsoft cater to corporate / intranet environments more then public websites? I'm not looking for market share, but rather large scale adoption of the MS stack.

    Read the article

  • Why can't the IT industry deliver large, faultless projects quickly as in other industries?

    - by MainMa
    After watching National Geographic's MegaStructures series, I was surprised how fast large projects are completed. Once the preliminary work (design, specifications, etc.) is done on paper, the realization itself of huge projects take just a few years or sometimes a few months. For example, Airbus A380 "formally launched on Dec. 19, 2000", and "in the Early March, 2005", the aircraft was already tested. The same goes for huge oil tankers, skyscrapers, etc. Comparing this to the delays in software industry, I can't help wondering why most IT projects are so slow, or more precisely, why they cannot be as fast and faultless, at the same scale, given enough people? Projects such as the Airbus A380 present both: Major unforeseen risks: while this is not the first aircraft built, it still pushes the limits if the technology and things which worked well for smaller airliners may not work for the larger one due to physical constraints; in the same way, new technologies are used which were not used yet, because for example they were not available in 1969 when Boeing 747 was done. Risks related to human resources and management in general: people quitting in the middle of the project, inability to reach a person because she's on vacation, ordinary human errors, etc. With those risks, people still achieve projects like those large airliners in a very short period of time, and despite the delivery delays, those projects are still hugely successful and of a high quality. When it comes to software development, the projects are hardly as large and complicated as an airliner (both technically and in terms of management), and have slightly less unforeseen risks from the real world. Still, most IT projects are slow and late, and adding more developers to the project is not a solution (going from a team of ten developer to two thousand will sometimes allow to deliver the project faster, sometimes not, and sometimes will only harm the project and increase the risk of not finishing it at all). Those which are still delivered may often contain a lot of bugs, requiring consecutive service packs and regular updates (imagine "installing updates" on every Airbus A380 twice per week to patch the bugs in the original product and prevent the aircraft from crashing). How can such differences be explained? Is it due exclusively to the fact that software development industry is too young to be able to manage thousands of people on a single project in order to deliver large scale, nearly faultless products very fast?

    Read the article

  • Use JQuery to target unwrapped text inside a div

    - by Chris
    I'm trying to find a way to wrap just the inner text of an element, I don't want to target any other inner dom elements. For example. <ul> <li class="this-one"> this is my item <ul> <li> this is a sub element </li> </ul> </li> </ul> I want to use jQuery to do this. <ul> <li class="this-one"> <div class="tree-item-text">this is my item</div> <ul> <li> <div class="tree-item-text">this is a sub element</div> </li> </ul> </li> </ul> A little background is I need to make an in-house tree structure ui element, So I'm using the UL structure to represent this. But I don't want developers to have to do any special formatting to use the widget. update: I just wanted to add the purpose of this is I want to add a click listener to be able to expand the elements under the li, However, since those elements are within the li the click listener will activate even when clicking on the children, So I want to attach it to the text instead, to do this the text needs to be targetable, which is why I want to wrap it in a div of it's own. So far I've come up with wrapping all the inner elements of the li in a div and then moving all inner dom elements back to the original parent. But this code is pretty heavy for something that might be much simpler and not require so much DOM manipulation. EDIT: Want to share the first pseudo alternative I came up with but I think it is very tasking for what I want to accomplish. var innerTextThing = $("ul.tree ul").parents("li").wrapInner("<div class='tree-node-text'>"); $(innerTextThing.find(".tree-node-text")).each(function(){ $(this).after($(this).children("ul")); }); Answered: I ended up doing the following, FYI i only have to worry about FF and IE compatibility so it's untested in other browsers. //this will wrap all li textNodes in a div so we can target them. $(that).find("li").contents() .filter(function () { return this.nodeType == 3; }).each(function () { if ( //these are for IE and FF compatibility (this.textContent != undefined && this.textContent.trim() != "") || (this.innerText != undefined && this.innerText.trim() != "") ) { $(this).wrap("<div class='tree-node-text'>"); } });

    Read the article

  • Cannot call SAPI from dll

    - by Quandary
    Question: The below code works fine as long as it is in an executable. It uses the msft (text-to-)speech API (SAPI). But as soon as I put it in a dll and load it with loadlibrary from an executable, it doesn't work. I've also tried to change CoInitialize(NULL); to CoInitializeEx(NULL,COINIT_MULTITHREADED); and I tried with all possible flags ( COINIT_APARTMENTTHREADED, COINIT_MULTITHREADED, COINIT_DISABLE_OLE1DDE, COINIT_SPEED_OVER_MEMORY) But it's always stuck at hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); I also tried those flags here: CLSCTX_INPROC_SERVER,CLSCTX_SERVER, CLSCTX_ALL, but nothing seems to help... There are no errors, it doesn't crash, it just sleeps forever at CoCreateInstance... This is the code as single exe (working) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { ISpVoice * pVoice = NULL; //CoInitializeEx(NULL,COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if( FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"),0); printf("Failed!\n"); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } else { //CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); //hr = CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { hr = pVoice->Speak(L"Test Test", 0, NULL); hr = pVoice->Speak(L"This sounds normal <pitch middle = '-10'/> but the pitch drops half way through", SPF_IS_XML, NULL ); pVoice->Release(); pVoice = NULL; } else { MessageBox(NULL, TEXT("Failed To Create a COM instance..."), TEXT("Error"),0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } } CoUninitialize(); return EXIT_SUCCESS; } This is the exe loading the dll (stays forever at printf("trying to create instance.\n"); ) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { // C:\Windows\System32\Speech\Common\sapi.dll //LoadLibraryA("sapi.dll"); LoadLibraryA("Sapidll2.dll"); return EXIT_SUCCESS; // Frankly, that would be nice... } And this is Sapidll2.dll // dllmain.cpp : Defines the entry point for the DLL application. #include "stdafx.h" #include <iostream> #include <cstdlib> #include <string> #include <windows.h> #include <sapi.h> int init_engine() { ISpVoice * pVoice = NULL; //HRESULT hr = CoInitializeEx(NULL, COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if(FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } else { printf("trying to create instance.\n"); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(__uuidof(ISpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); HRESULT hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { printf("Succeeded\n"); //hr = pVoice->Speak(L"The text to speech engine has been successfully initialized.", 0, NULL); } else { printf("failed\n"); MessageBox(NULL, TEXT("Failed To Create COM instance"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } } if(pVoice != NULL) { pVoice->Release(); pVoice = NULL; } CoUninitialize(); return true ; } BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: init_engine(); break; case DLL_THREAD_ATTACH: case DLL_THREAD_DETACH: case DLL_PROCESS_DETACH: break; } return TRUE; }

    Read the article

  • Style Switcher & Text Resizer Combined?

    - by Stephen
    Hi there, I've came across various style switchers that allow you to change the stylesheet (i.e. Light, Dark, High Contrast), and carious text-resizers that allow you to resize the test (usually with Three A's, small, medium and large). However, I can't seem to find a single switcher/resizer that works well together by allowing permutations of the two. i.e. so the user can choose a dark background with small text, or a dark background with large text, etc. I can only seem to get this working where the user can choose one or the other styles (large text or High Contrast, not a combination of the two). Any ideas on anything that may be suitable for this at all? Thanks, Stephen

    Read the article

  • Is there a fast way to jump to element using XMLReader?

    - by Derk
    I am using XMLReader to read a large XML file with about 1 million elements on the level I am reading from. However, I've calculated it will take over 10 seconds when I jump to -for instance- element 500.000 using XMLReader::next ([ string $localname ] ) or XMLReader::read ( void ) This is not very usable. Is there a faster way to do this?

    Read the article

  • Extract strings in python

    - by shadyabhi
    Basically, I want to extract the strings "AAA", "BBB", "CCC", "DDD" from a text file.. ...... (other text goes here)..... <TD align="left" class=texttd><font class='textfont'>AAA</font></TD> ..... (useless text here)..... <TD align="left" class=texttd><font class='textfont'>BBB</font></TD> ....(more text)..... <TD align="left" class=texttd><font class='textfont'>CCC</font></TD> <TD align="left" class=texttd><font class='textfont'>DDD</font></TD> ......(more text)..... I want something like if I do:- data = foo("file.txt") i get:- data = ['AAA','BBB','CCC','DDD'] What is the best possible way? My file is not big..

    Read the article

  • Where can I find a list of reserved words for Oracle fulltext search?

    - by Tyronomo
    I've a client testing the full text (example below) search on a new Oracle UCM site. The random text string they chose to test was 'test only'. Which failed; from my testing it seems 'only' is a reserved word, as it is never returned from a full text search (it is returned from metadata searches). I've spent the morning searching oracle.com and found this which seems pretty comprehensive, yet does not have 'only'. So my question is thus, is 'only' a reserved word. Where can I find a complete list of reserved words for Oracle full text search (10g)? Full text search string example; (<ftx>test only</ftx>)

    Read the article

  • VB.NET - Convert Unicode in one TB to Shift-JIS in another TB

    - by Yiu Korochko
    Trying to develop a text editor, I've got two textboxes, and a button below each one. When the button below textbox1 is pressed, it is supposed to convert the Unicode text (intended to be Japanese) to Shift-JIS. The reason why I am doing this is because the software VOCALOID2 only allows ANSI and Shift-JIS encoding text to be pasted into the lyrics system. Users of the application normally have their keyboard set to change to Japanese already, but it types in Unicode. How can I convert Unicode text to Shift-JIS when SJIS isn't available in the System.Text.Encoding types?

    Read the article

  • hide part of the content of an element

    - by user1843471
    Sorry, this may be kind of weird problem: I have an existing HTML code, which I can not directly edit or delete parts of it. The problem is: Inside a div-element in this code, there is some text which I want to hide. There are also another element inside of this div, which I don't want to hide. It looks something like this: <div> ....Text I want to hide.... <table> ... Text I don't want to hide...</table> </div> My question: Is it possible to hide the "....Text I want to hide...." while not hiding the "... Text I don't want to hide..."? (for example using javascript?)

    Read the article

  • Parsing Huge XML Files in PHP

    - by Ian
    I'm trying to parse the dmoz content/structures xml files into mysql, but all existing scripts to do this are very old and don't work well. How can I go about opening a large (+1GB) xml file in php for parsing?

    Read the article

  • Twitter Bootstrap styling conflicts with plug-ins like jqGrid and other third part libraries

    - by Renso
    Issues:The concern is that the Twitter Bootstrap framework is that some of their css selectors are simply too generic and have incompatibility issues and conflicts with most third party plug-ins and css libraries, like jQuery-UI and jqGrid.My most pressing concern is only with the generic selector for the styling of "INPUT" controls.Some concerns:So basically anyone using BS (Bootstrap) will have to override styling 100% of the time on all input controls on all their web pages for all the plug-ins they use that render their own styling for input controls. This seems to chisel away any reason for using Bootstrap. Overriding Bootstrap css in this case seems illogical at best as it implies the BS styling is not correct or as granular as it is supposed to be. It also suggests you realize there is an issue here. Any person who has written a fair amount of css will realize that it is a mammoth task to to take an existing app, converting it to BS and then having to find all non-BS input controls and styling them all. The worst part is that there is no generic styling for this as each input control has a different source/context, some are regular tags and some belong to plug-ins, each with their own flavor of styling. For new web apps the challenge is not that different, each time you add a new plug-in you will have to test all facets of it, and I mean all of it, pop-ups, etc, that contain any kind of input control to make sure it is styled correctly. I am having a hard time seeing the benefits of BS in this context. So until the BS team addresses the issue, or not, you may be wondering what is the easiest solution.Help the community to drive this issue home by creating a new issue on github, see my entry here: https://github.com/twitter/bootstrap/issues/4008. As you can see I got some good and some negative feedback, but we all agree it is an issue. I do believe my solution below should be reverse compatible if the proper class declarations were followed as recommended by Bootstrap.The solution:Add a higher-level qualifier to the input selector, which may not break anything.  Add "control-group" and "controls" classes as higher-level selectors, as they have to be declared inside those classes anyway as far as I understand the design approach of BS. So in my example below can modify the css without possible breaking anything, see the css at the bottom. I tested this briefly and seems to render just as expected. May not be complete as I only spent a few minutes on the css. Your feedback will be greatly appreciated. <div class="control-group">    <label title="" for="Contact_FirstName" class="control-label">First Name</label>    <div class="controls">        <input type="text" value="" name="Contact.FirstName" id="Contact_FirstName" data-val-required="The Reader Contact&amp;#39;s First Name is required" data-val-length-min="2" data-val-length-max="250" data-val-length="The maximum length allowed for the Reader Contact&amp;#39;s First Name is 250 characters and must be two or more characters long" data-val="true" class="input-medium">        <span data-valmsg-replace="true" data-valmsg-for="Contact.FirstName" class="field-validation-valid"></span>    </div></div>Here are the SCSS (SASS) updates. In stead of just including the updates I decided to include the entire bootstrap SCSS file so you can just copy-and-paste it in stead of trying to figure out what selectors have changed./*! * Bootstrap v2.0.4 * Enhacement by Renso Hollhumer * Copyright 2012 Twitter, Inc * Licensed under the Apache License v2.0 * http://www.apache.org/licenses/LICENSE-2.0 * * Designed and built with all the love in the world @twitter by @mdo and @fat. * Enhancement by Renso Hollhumer: To isolate styling of INPUT tags to the Bootstrap context only */.clearfix {  *zoom: 1;}.clearfix:before,.clearfix:after {  display: table;  content: "";}.clearfix:after {  clear: both;}.hide-text {  font: 0/0 a;  color: transparent;  text-shadow: none;  background-color: transparent;  border: 0;}.input-block-level {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;}article,aside,details,figcaption,figure,footer,header,hgroup,nav,section {  display: block;}audio,canvas,video {  display: inline-block;  *display: inline;  *zoom: 1;}audio:not([controls]) {  display: none;}html {  font-size: 100%;  -webkit-text-size-adjust: 100%;  -ms-text-size-adjust: 100%;}a:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}a:hover,a:active {  outline: 0;}sub,sup {  position: relative;  font-size: 75%;  line-height: 0;  vertical-align: baseline;}sup {  top: -0.5em;}sub {  bottom: -0.25em;}img {  max-width: 100%;  vertical-align: middle;  border: 0;  -ms-interpolation-mode: bicubic;}#map_canvas img {  max-width: none;}button,input,select,textarea {  margin: 0;  font-size: 100%;  vertical-align: middle;}button,input {  *overflow: visible;  line-height: normal;}button::-moz-focus-inner,input::-moz-focus-inner {  padding: 0;  border: 0;}button,input[type="button"],input[type="reset"],input[type="submit"] {  cursor: pointer;  -webkit-appearance: button;}input[type="search"] {  -webkit-box-sizing: content-box;  -moz-box-sizing: content-box;  box-sizing: content-box;  -webkit-appearance: textfield;}input[type="search"]::-webkit-search-decoration,input[type="search"]::-webkit-search-cancel-button {  -webkit-appearance: none;}textarea {  overflow: auto;  vertical-align: top;}body {  margin: 0;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  line-height: 18px;  color: #333333;  background-color: #ffffff;}a {  color: #0088cc;  text-decoration: none;}a:hover {  color: #005580;  text-decoration: underline;}.row {  margin-left: -20px;  *zoom: 1;}.row:before,.row:after {  display: table;  content: "";}.row:after {  clear: both;}[class*="span"] {  float: left;  margin-left: 20px;}.container,.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.span12 {  width: 940px;}.span11 {  width: 860px;}.span10 {  width: 780px;}.span9 {  width: 700px;}.span8 {  width: 620px;}.span7 {  width: 540px;}.span6 {  width: 460px;}.span5 {  width: 380px;}.span4 {  width: 300px;}.span3 {  width: 220px;}.span2 {  width: 140px;}.span1 {  width: 60px;}.offset12 {  margin-left: 980px;}.offset11 {  margin-left: 900px;}.offset10 {  margin-left: 820px;}.offset9 {  margin-left: 740px;}.offset8 {  margin-left: 660px;}.offset7 {  margin-left: 580px;}.offset6 {  margin-left: 500px;}.offset5 {  margin-left: 420px;}.offset4 {  margin-left: 340px;}.offset3 {  margin-left: 260px;}.offset2 {  margin-left: 180px;}.offset1 {  margin-left: 100px;}.row-fluid {  width: 100%;  *zoom: 1;}.row-fluid:before,.row-fluid:after {  display: table;  content: "";}.row-fluid:after {  clear: both;}.row-fluid [class*="span"] {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  float: left;  margin-left: 2.127659574%;  *margin-left: 2.0744680846382977%;}.row-fluid [class*="span"]:first-child {  margin-left: 0;}.row-fluid .span12 {  width: 99.99999998999999%;  *width: 99.94680850063828%;}.row-fluid .span11 {  width: 91.489361693%;  *width: 91.4361702036383%;}.row-fluid .span10 {  width: 82.97872339599999%;  *width: 82.92553190663828%;}.row-fluid .span9 {  width: 74.468085099%;  *width: 74.4148936096383%;}.row-fluid .span8 {  width: 65.95744680199999%;  *width: 65.90425531263828%;}.row-fluid .span7 {  width: 57.446808505%;  *width: 57.3936170156383%;}.row-fluid .span6 {  width: 48.93617020799999%;  *width: 48.88297871863829%;}.row-fluid .span5 {  width: 40.425531911%;  *width: 40.3723404216383%;}.row-fluid .span4 {  width: 31.914893614%;  *width: 31.8617021246383%;}.row-fluid .span3 {  width: 23.404255317%;  *width: 23.3510638276383%;}.row-fluid .span2 {  width: 14.89361702%;  *width: 14.8404255306383%;}.row-fluid .span1 {  width: 6.382978723%;  *width: 6.329787233638298%;}.container {  margin-right: auto;  margin-left: auto;  *zoom: 1;}.container:before,.container:after {  display: table;  content: "";}.container:after {  clear: both;}.container-fluid {  padding-right: 20px;  padding-left: 20px;  *zoom: 1;}.container-fluid:before,.container-fluid:after {  display: table;  content: "";}.container-fluid:after {  clear: both;}p {  margin: 0 0 9px;}p small {  font-size: 11px;  color: #999999;}.lead {  margin-bottom: 18px;  font-size: 20px;  font-weight: 200;  line-height: 27px;}h1,h2,h3,h4,h5,h6 {  margin: 0;  font-family: inherit;  font-weight: bold;  color: inherit;  text-rendering: optimizelegibility;}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small {  font-weight: normal;  color: #999999;}h1 {  font-size: 30px;  line-height: 36px;}h1 small {  font-size: 18px;}h2 {  font-size: 24px;  line-height: 36px;}h2 small {  font-size: 18px;}h3 {  font-size: 18px;  line-height: 27px;}h3 small {  font-size: 14px;}h4,h5,h6 {  line-height: 18px;}h4 {  font-size: 14px;}h4 small {  font-size: 12px;}h5 {  font-size: 12px;}h6 {  font-size: 11px;  color: #999999;  text-transform: uppercase;}.page-header {  padding-bottom: 17px;  margin: 18px 0;  border-bottom: 1px solid #eeeeee;}.page-header h1 {  line-height: 1;}ul,ol {  padding: 0;  margin: 0 0 9px 25px;}ul ul,ul ol,ol ol,ol ul {  margin-bottom: 0;}ul {  list-style: disc;}ol {  list-style: decimal;}li {  line-height: 18px;}ul.unstyled,ol.unstyled {  margin-left: 0;  list-style: none;}dl {  margin-bottom: 18px;}dt,dd {  line-height: 18px;}dt {  font-weight: bold;  line-height: 17px;}dd {  margin-left: 9px;}.dl-horizontal dt {  float: left;  width: 120px;  clear: left;  text-align: right;  overflow: hidden;  text-overflow: ellipsis;  white-space: nowrap;}.dl-horizontal dd {  margin-left: 130px;}hr {  margin: 18px 0;  border: 0;  border-top: 1px solid #eeeeee;  border-bottom: 1px solid #ffffff;}strong {  font-weight: bold;}em {  font-style: italic;}.muted {  color: #999999;}abbr[title] {  cursor: help;  border-bottom: 1px dotted #999999;}abbr.initialism {  font-size: 90%;  text-transform: uppercase;}blockquote {  padding: 0 0 0 15px;  margin: 0 0 18px;  border-left: 5px solid #eeeeee;}blockquote p {  margin-bottom: 0;  font-size: 16px;  font-weight: 300;  line-height: 22.5px;}blockquote small {  display: block;  line-height: 18px;  color: #999999;}blockquote small:before {  content: '\2014 \00A0';}blockquote.pull-right {  float: right;  padding-right: 15px;  padding-left: 0;  border-right: 5px solid #eeeeee;  border-left: 0;}blockquote.pull-right p,blockquote.pull-right small {  text-align: right;}q:before,q:after,blockquote:before,blockquote:after {  content: "";}address {  display: block;  margin-bottom: 18px;  font-style: normal;  line-height: 18px;}small {  font-size: 100%;}cite {  font-style: normal;}code,pre {  padding: 0 3px 2px;  font-family: Menlo, Monaco, Consolas, "Courier New", monospace;  font-size: 12px;  color: #333333;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}code {  padding: 2px 4px;  color: #d14;  background-color: #f7f7f9;  border: 1px solid #e1e1e8;}pre {  display: block;  padding: 8.5px;  margin: 0 0 9px;  font-size: 12.025px;  line-height: 18px;  word-break: break-all;  word-wrap: break-word;  white-space: pre;  white-space: pre-wrap;  background-color: #f5f5f5;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.15);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}pre.prettyprint {  margin-bottom: 18px;}pre code {  padding: 0;  color: inherit;  background-color: transparent;  border: 0;}.pre-scrollable {  max-height: 340px;  overflow-y: scroll;}.label,.badge {  font-size: 10.998px;  font-weight: bold;  line-height: 14px;  color: #ffffff;  vertical-align: baseline;  white-space: nowrap;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #999999;}.label {  padding: 1px 4px 2px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.badge {  padding: 1px 9px 2px;  -webkit-border-radius: 9px;  -moz-border-radius: 9px;  border-radius: 9px;}a.label:hover,a.badge:hover {  color: #ffffff;  text-decoration: none;  cursor: pointer;}.label-important,.badge-important {  background-color: #b94a48;}.label-important[href],.badge-important[href] {  background-color: #953b39;}.label-warning,.badge-warning {  background-color: #f89406;}.label-warning[href],.badge-warning[href] {  background-color: #c67605;}.label-success,.badge-success {  background-color: #468847;}.label-success[href],.badge-success[href] {  background-color: #356635;}.label-info,.badge-info {  background-color: #3a87ad;}.label-info[href],.badge-info[href] {  background-color: #2d6987;}.label-inverse,.badge-inverse {  background-color: #333333;}.label-inverse[href],.badge-inverse[href] {  background-color: #1a1a1a;}table {  max-width: 100%;  background-color: transparent;  border-collapse: collapse;  border-spacing: 0;}.table {  width: 100%;  margin-bottom: 18px;}.table th,.table td {  padding: 8px;  line-height: 18px;  text-align: left;  vertical-align: top;  border-top: 1px solid #dddddd;}.table th {  font-weight: bold;}.table thead th {  vertical-align: bottom;}.table caption + thead tr:first-child th,.table caption + thead tr:first-child td,.table colgroup + thead tr:first-child th,.table colgroup + thead tr:first-child td,.table thead:first-child tr:first-child th,.table thead:first-child tr:first-child td {  border-top: 0;}.table tbody + tbody {  border-top: 2px solid #dddddd;}.table-condensed th,.table-condensed td {  padding: 4px 5px;}.table-bordered {  border: 1px solid #dddddd;  border-collapse: separate;  *border-collapse: collapsed;  border-left: 0;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.table-bordered th,.table-bordered td {  border-left: 1px solid #dddddd;}.table-bordered caption + thead tr:first-child th,.table-bordered caption + tbody tr:first-child th,.table-bordered caption + tbody tr:first-child td,.table-bordered colgroup + thead tr:first-child th,.table-bordered colgroup + tbody tr:first-child th,.table-bordered colgroup + tbody tr:first-child td,.table-bordered thead:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child td {  border-top: 0;}.table-bordered thead:first-child tr:first-child th:first-child,.table-bordered tbody:first-child tr:first-child td:first-child {  -webkit-border-top-left-radius: 4px;  border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;}.table-bordered thead:first-child tr:first-child th:last-child,.table-bordered tbody:first-child tr:first-child td:last-child {  -webkit-border-top-right-radius: 4px;  border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;}.table-bordered thead:last-child tr:last-child th:first-child,.table-bordered tbody:last-child tr:last-child td:first-child {  -webkit-border-radius: 0 0 0 4px;  -moz-border-radius: 0 0 0 4px;  border-radius: 0 0 0 4px;  -webkit-border-bottom-left-radius: 4px;  border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;}.table-bordered thead:last-child tr:last-child th:last-child,.table-bordered tbody:last-child tr:last-child td:last-child {  -webkit-border-bottom-right-radius: 4px;  border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;}.table-striped tbody tr:nth-child(odd) td,.table-striped tbody tr:nth-child(odd) th {  background-color: #f9f9f9;}.table tbody tr:hover td,.table tbody tr:hover th {  background-color: #f5f5f5;}table .span1 {  float: none;  width: 44px;  margin-left: 0;}table .span2 {  float: none;  width: 124px;  margin-left: 0;}table .span3 {  float: none;  width: 204px;  margin-left: 0;}table .span4 {  float: none;  width: 284px;  margin-left: 0;}table .span5 {  float: none;  width: 364px;  margin-left: 0;}table .span6 {  float: none;  width: 444px;  margin-left: 0;}table .span7 {  float: none;  width: 524px;  margin-left: 0;}table .span8 {  float: none;  width: 604px;  margin-left: 0;}table .span9 {  float: none;  width: 684px;  margin-left: 0;}table .span10 {  float: none;  width: 764px;  margin-left: 0;}table .span11 {  float: none;  width: 844px;  margin-left: 0;}table .span12 {  float: none;  width: 924px;  margin-left: 0;}table .span13 {  float: none;  width: 1004px;  margin-left: 0;}table .span14 {  float: none;  width: 1084px;  margin-left: 0;}table .span15 {  float: none;  width: 1164px;  margin-left: 0;}table .span16 {  float: none;  width: 1244px;  margin-left: 0;}table .span17 {  float: none;  width: 1324px;  margin-left: 0;}table .span18 {  float: none;  width: 1404px;  margin-left: 0;}table .span19 {  float: none;  width: 1484px;  margin-left: 0;}table .span20 {  float: none;  width: 1564px;  margin-left: 0;}table .span21 {  float: none;  width: 1644px;  margin-left: 0;}table .span22 {  float: none;  width: 1724px;  margin-left: 0;}table .span23 {  float: none;  width: 1804px;  margin-left: 0;}table .span24 {  float: none;  width: 1884px;  margin-left: 0;}form {  margin: 0 0 18px;}fieldset {  padding: 0;  margin: 0;  border: 0;}legend {  display: block;  width: 100%;  padding: 0;  margin-bottom: 27px;  font-size: 19.5px;  line-height: 36px;  color: #333333;  border: 0;  border-bottom: 1px solid #e5e5e5;}legend small {  font-size: 13.5px;  color: #999999;}.control-group .controls {    label,    input,    button,    select,    textarea {      font-size: 13px;      font-weight: normal;      line-height: 18px;    }}.control-group .controls {    input,    button,    select,    textarea {      font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;    }}label {  display: block;  margin-bottom: 5px;}.control-group .controls {    select,    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      display: inline-block;      height: 18px;      padding: 4px;      margin-bottom: 9px;      font-size: 13px;      line-height: 18px;      color: #555555;    }}.control-group .controls {    input,    textarea {      width: 210px;    }}.control-group .controls {    textarea {      height: auto;    }}.control-group .controls {    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      background-color: #ffffff;      border: 1px solid #cccccc;      -webkit-border-radius: 3px;      -moz-border-radius: 3px;      border-radius: 3px;      -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -webkit-transition: border linear 0.2s, box-shadow linear 0.2s;      -moz-transition: border linear 0.2s, box-shadow linear 0.2s;      -ms-transition: border linear 0.2s, box-shadow linear 0.2s;      -o-transition: border linear 0.2s, box-shadow linear 0.2s;      transition: border linear 0.2s, box-shadow linear 0.2s;    }}.control-group .controls {    textarea:focus,    input[type="text"]:focus,    input[type="password"]:focus,    input[type="datetime"]:focus,    input[type="datetime-local"]:focus,    input[type="date"]:focus,    input[type="month"]:focus,    input[type="time"]:focus,    input[type="week"]:focus,    input[type="number"]:focus,    input[type="email"]:focus,    input[type="url"]:focus,    input[type="search"]:focus,    input[type="tel"]:focus,    input[type="color"]:focus,    .uneditable-input:focus {      border-color: rgba(82, 168, 236, 0.8);      outline: 0;      outline: thin dotted \9;      /* IE6-9 */      -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      -moz-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);    }}.control-group .controls {    input[type="radio"],    input[type="checkbox"] {      margin: 3px 0;      *margin-top: 0;      /* IE7 */      line-height: normal;      cursor: pointer;    }}.control-group .controls {    input[type="submit"],    input[type="reset"],    input[type="button"],    input[type="radio"],    input[type="checkbox"] {      width: auto;    }}.uneditable-textarea {  width: auto;  height: auto;}.control-group .controls {    select,    input[type="file"] {      height: 28px;      /* In IE7, the height of the select element cannot be changed by height, only font-size */      *margin-top: 4px;      /* For IE7, add top margin to align select with labels */      line-height: 28px;    }}.control-group .controls {    select {      width: 220px;      border: 1px solid #bbb;    }}.control-group .controls {    select[multiple],    select[size] {      height: auto;    }}.control-group .controls {    select:focus,    input[type="file"]:focus,    input[type="radio"]:focus,    input[type="checkbox"]:focus {      outline: thin dotted #333;      outline: 5px auto -webkit-focus-ring-color;      outline-offset: -2px;    }}.radio,.checkbox {  min-height: 18px;  padding-left: 18px;}.radio input[type="radio"],.checkbox input[type="checkbox"] {  float: left;  margin-left: -18px;}.controls > .radio:first-child,.controls > .checkbox:first-child {  padding-top: 5px;}.radio.inline,.checkbox.inline {  display: inline-block;  padding-top: 5px;  margin-bottom: 0;  vertical-align: middle;}.radio.inline + .radio.inline,.checkbox.inline + .checkbox.inline {  margin-left: 10px;}.control-group .controls {    .input-mini {      width: 60px;    }}.control-group .controls {    .input-small {      width: 90px;    }}.control-group .controls {    .input-medium {      width: 150px;    }}.control-group .controls {    .input-large {      width: 210px;    }}.input-xlarge {    .input-xlarge {      width: 270px;    }}.input-xxlarge {    .input-xxlarge {      width: 530px;    }}.control-group .controls {    input[class*="span"],    select[class*="span"],    textarea[class*="span"],    .uneditable-input[class*="span"],    .row-fluid input[class*="span"],    .row-fluid select[class*="span"],    .row-fluid textarea[class*="span"],    .row-fluid .uneditable-input[class*="span"] {      float: none;      margin-left: 0;    }}.input-append input[class*="span"],.input-append .uneditable-input[class*="span"],.input-prepend input[class*="span"],.input-prepend .uneditable-input[class*="span"],.row-fluid .input-prepend [class*="span"],.row-fluid .input-append [class*="span"] {  display: inline-block;}.control-group .controls {    input,    textarea,    .uneditable-input {      margin-left: 0;    }}input.span12, textarea.span12, .uneditable-input.span12 {  width: 930px;}input.span11, textarea.span11, .uneditable-input.span11 {  width: 850px;}input.span10, textarea.span10, .uneditable-input.span10 {  width: 770px;}input.span9, textarea.span9, .uneditable-input.span9 {  width: 690px;}input.span8, textarea.span8, .uneditable-input.span8 {  width: 610px;}input.span7, textarea.span7, .uneditable-input.span7 {  width: 530px;}input.span6, textarea.span6, .uneditable-input.span6 {  width: 450px;}input.span5, textarea.span5, .uneditable-input.span5 {  width: 370px;}input.span4, textarea.span4, .uneditable-input.span4 {  width: 290px;}input.span3, textarea.span3, .uneditable-input.span3 {  width: 210px;}input.span2, textarea.span2, .uneditable-input.span2 {  width: 130px;}input.span1, textarea.span1, .uneditable-input.span1 {  width: 50px;}input[disabled],select[disabled],textarea[disabled],input[readonly],select[readonly],textarea[readonly] {  cursor: not-allowed;  background-color: #eeeeee;  border-color: #ddd;}input[type="radio"][disabled],input[type="checkbox"][disabled],input[type="radio"][readonly],input[type="checkbox"][readonly] {  background-color: transparent;}.control-group.warning > label,.control-group.warning .help-block,.control-group.warning .help-inline {  color: #c09853;}.control-group.warning .checkbox,.control-group.warning .radio,.control-group.warning input,.control-group.warning select,.control-group.warning textarea {  color: #c09853;  border-color: #c09853;}.control-group.warning .checkbox:focus,.control-group.warning .radio:focus,.control-group.warning input:focus,.control-group.warning select:focus,.control-group.warning textarea:focus {  border-color: #a47e3c;  -webkit-box-shadow: 0 0 6px #dbc59e;  -moz-box-shadow: 0 0 6px #dbc59e;  box-shadow: 0 0 6px #dbc59e;}.control-group.warning .input-prepend .add-on,.control-group.warning .input-append .add-on {  color: #c09853;  background-color: #fcf8e3;  border-color: #c09853;}.control-group.error > label,.control-group.error .help-block,.control-group.error .help-inline {  color: #b94a48;}.control-group.error .checkbox,.control-group.error .radio,.control-group.error input,.control-group.error select,.control-group.error textarea {  color: #b94a48;  border-color: #b94a48;}.control-group.error .checkbox:focus,.control-group.error .radio:focus,.control-group.error input:focus,.control-group.error select:focus,.control-group.error textarea:focus {  border-color: #953b39;  -webkit-box-shadow: 0 0 6px #d59392;  -moz-box-shadow: 0 0 6px #d59392;  box-shadow: 0 0 6px #d59392;}.control-group.error .input-prepend .add-on,.control-group.error .input-append .add-on {  color: #b94a48;  background-color: #f2dede;  border-color: #b94a48;}.control-group.success > label,.control-group.success .help-block,.control-group.success .help-inline {  color: #468847;}.control-group.success .checkbox,.control-group.success .radio,.control-group.success input,.control-group.success select,.control-group.success textarea {  color: #468847;  border-color: #468847;}.control-group.success .checkbox:focus,.control-group.success .radio:focus,.control-group.success input:focus,.control-group.success select:focus,.control-group.success textarea:focus {  border-color: #356635;  -webkit-box-shadow: 0 0 6px #7aba7b;  -moz-box-shadow: 0 0 6px #7aba7b;  box-shadow: 0 0 6px #7aba7b;}.control-group.success .input-prepend .add-on,.control-group.success .input-append .add-on {  color: #468847;  background-color: #dff0d8;  border-color: #468847;}input:focus:required:invalid,textarea:focus:required:invalid,select:focus:required:invalid {  color: #b94a48;  border-color: #ee5f5b;}input:focus:required:invalid:focus,textarea:focus:required:invalid:focus,select:focus:required:invalid:focus {  border-color: #e9322d;  -webkit-box-shadow: 0 0 6px #f8b9b7;  -moz-box-shadow: 0 0 6px #f8b9b7;  box-shadow: 0 0 6px #f8b9b7;}.form-actions {  padding: 17px 20px 18px;  margin-top: 18px;  margin-bottom: 18px;  background-color: #f5f5f5;  border-top: 1px solid #e5e5e5;  *zoom: 1;}.form-actions:before,.form-actions:after {  display: table;  content: "";}.form-actions:after {  clear: both;}.uneditable-input {  overflow: hidden;  white-space: nowrap;  cursor: not-allowed;  background-color: #ffffff;  border-color: #eee;  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);}:-moz-placeholder {  color: #999999;}:-ms-input-placeholder {  color: #999999;}::-webkit-input-placeholder {  color: #999999;}.help-block,.help-inline {  color: #555555;}.help-block {  display: block;  margin-bottom: 9px;}.help-inline {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  vertical-align: middle;  padding-left: 5px;}.input-prepend,.input-append {  margin-bottom: 5px;}.input-prepend input,.input-append input,.input-prepend select,.input-append select,.input-prepend .uneditable-input,.input-append .uneditable-input {  position: relative;  margin-bottom: 0;  *margin-left: 0;  vertical-align: middle;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend input:focus,.input-append input:focus,.input-prepend select:focus,.input-append select:focus,.input-prepend .uneditable-input:focus,.input-append .uneditable-input:focus {  z-index: 2;}.input-prepend .uneditable-input,.input-append .uneditable-input {  border-left-color: #ccc;}.input-prepend .add-on,.input-append .add-on {  display: inline-block;  width: auto;  height: 18px;  min-width: 16px;  padding: 4px 5px;  font-weight: normal;  line-height: 18px;  text-align: center;  text-shadow: 0 1px 0 #ffffff;  vertical-align: middle;  background-color: #eeeeee;  border: 1px solid #ccc;}.input-prepend .add-on,.input-append .add-on,.input-prepend .btn,.input-append .btn {  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend .active,.input-append .active {  background-color: #a9dba9;  border-color: #46a546;}.input-prepend .add-on,.input-prepend .btn {  margin-right: -1px;}.input-prepend .add-on:first-child,.input-prepend .btn:first-child {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append input,.input-append select,.input-append .uneditable-input {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append .uneditable-input {  border-right-color: #ccc;  border-left-color: #eee;}.input-append .add-on:last-child,.input-append .btn:last-child {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend.input-append input,.input-prepend.input-append select,.input-prepend.input-append .uneditable-input {  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend.input-append .add-on:first-child,.input-prepend.input-append .btn:first-child {  margin-right: -1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-prepend.input-append .add-on:last-child,.input-prepend.input-append .btn:last-child {  margin-left: -1px;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.search-query {  padding-right: 14px;  padding-right: 4px \9;  padding-left: 14px;  padding-left: 4px \9;  /* IE7-8 doesn't have border-radius, so don't indent the padding */  margin-bottom: 0;  -webkit-border-radius: 14px;  -moz-border-radius: 14px;  border-radius: 14px;}.form-search input,.form-inline input,.form-horizontal input,.form-search textarea,.form-inline textarea,.form-horizontal textarea,.form-search select,.form-inline select,.form-horizontal select,.form-search .help-inline,.form-inline .help-inline,.form-horizontal .help-inline,.form-search .uneditable-input,.form-inline .uneditable-input,.form-horizontal .uneditable-input,.form-search .input-prepend,.form-inline .input-prepend,.form-horizontal .input-prepend,.form-search .input-append,.form-inline .input-append,.form-horizontal .input-append {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-bottom: 0;}.form-search .hide,.form-inline .hide,.form-horizontal .hide {  display: none;}.form-search label,.form-inline label {  display: inline-block;}.form-search .input-append,.form-inline .input-append,.form-search .input-prepend,.form-inline .input-prepend {  margin-bottom: 0;}.form-search .radio,.form-search .checkbox,.form-inline .radio,.form-inline .checkbox {  padding-left: 0;  margin-bottom: 0;  vertical-align: middle;}.form-search .radio input[type="radio"],.form-search .checkbox input[type="checkbox"],.form-inline .radio input[type="radio"],.form-inline .checkbox input[type="checkbox"] {  float: left;  margin-right: 3px;  margin-left: 0;}.control-group {  margin-bottom: 9px;}legend + .control-group {  margin-top: 18px;  -webkit-margin-top-collapse: separate;}.form-horizontal .control-group {  margin-bottom: 18px;  *zoom: 1;}.form-horizontal .control-group:before,.form-horizontal .control-group:after {  display: table;  content: "";}.form-horizontal .control-group:after {  clear: both;}.form-horizontal .control-label {  float: left;  width: 140px;  padding-top: 5px;  text-align: right;}.form-horizontal .controls {  *display: inline-block;  *padding-left: 20px;  margin-left: 160px;  *margin-left: 0;}.form-horizontal .controls:first-child {  *padding-left: 160px;}.form-horizontal .help-block {  margin-top: 9px;  margin-bottom: 0;}.form-horizontal .form-actions {  padding-left: 160px;}.btn {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  padding: 4px 10px 4px;  margin-bottom: 0;  font-size: 13px;  line-height: 18px;  *line-height: 20px;  color: #333333;  text-align: center;  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);  vertical-align: middle;  cursor: pointer;  background-color: #f5f5f5;  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);  background-image: linear-gradient(top, #ffffff, #e6e6e6);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);  border-color: #e6e6e6 #e6e6e6 #bfbfbf;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #e6e6e6;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  border: 1px solid #cccccc;  *border: 0;  border-bottom-color: #b3b3b3;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  *margin-left: .3em;  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);}.btn:hover,.btn:active,.btn.active,.btn.disabled,.btn[disabled] {  background-color: #e6e6e6;  *background-color: #d9d9d9;}.btn:active,.btn.active {  background-color: #cccccc \9;}.btn:first-child {  *margin-left: 0;}.btn:hover {  color: #333333;  text-decoration: none;  background-color: #e6e6e6;  *background-color: #d9d9d9;  /* Buttons in IE7 don't get borders, so darken on hover */  background-position: 0 -15px;  -webkit-transition: background-position 0.1s linear;  -moz-transition: background-position 0.1s linear;  -ms-transition: background-position 0.1s linear;  -o-transition: background-position 0.1s linear;  transition: background-position 0.1s linear;}.btn:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}.btn.active,.btn:active {  background-color: #e6e6e6;  background-color: #d9d9d9 \9;  background-image: none;  outline: 0;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn.disabled,.btn[disabled] {  cursor: default;  background-color: #e6e6e6;  background-image: none;  opacity: 0.65;  filter: alpha(opacity=65);  -webkit-box-shadow: none;  -moz-box-shadow: none;  box-shadow: none;}.btn-large {  padding: 9px 14px;  font-size: 15px;  line-height: normal;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.btn-large [class^="icon-"] {  margin-top: 1px;}.btn-small {  padding: 5px 9px;  font-size: 11px;  line-height: 16px;}.btn-small [class^="icon-"] {  margin-top: -1px;}.btn-mini {  padding: 2px 6px;  font-size: 11px;  line-height: 14px;}.btn-primary,.btn-primary:hover,.btn-warning,.btn-warning:hover,.btn-danger,.btn-danger:hover,.btn-success,.btn-success:hover,.btn-info,.btn-info:hover,.btn-inverse,.btn-inverse:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.btn-primary.active,.btn-warning.active,.btn-danger.active,.btn-success.active,.btn-info.active,.btn-inverse.active {  color: rgba(255, 255, 255, 0.75);}.btn {  border-color: #ccc;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);}.btn-primary {  background-color: #0074cc;  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);  background-image: -o-linear-gradient(top, #0088cc, #0055cc);  background-image: linear-gradient(top, #0088cc, #0055cc);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);  border-color: #0055cc #0055cc #003580;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #0055cc;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-primary:hover,.btn-primary:active,.btn-primary.active,.btn-primary.disabled,.btn-primary[disabled] {  background-color: #0055cc;  *background-color: #004ab3;}.btn-primary:active,.btn-primary.active {  background-color: #004099 \9;}.btn-warning {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);  border-color: #f89406 #f89406 #ad6704;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #f89406;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-warning:hover,.btn-warning:active,.btn-warning.active,.btn-warning.disabled,.btn-warning[disabled] {  background-color: #f89406;  *background-color: #df8505;}.btn-warning:active,.btn-warning.active {  background-color: #c67605 \9;}.btn-danger {  background-color: #da4f49;  background-image: -moz-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -ms-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#bd362f));  background-image: -webkit-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -o-linear-gradient(top, #ee5f5b, #bd362f);  background-image: linear-gradient(top, #ee5f5b, #bd362f);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#bd362f', GradientType=0);  border-color: #bd362f #bd362f #802420;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #bd362f;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-danger:hover,.btn-danger:active,.btn-danger.active,.btn-danger.disabled,.btn-danger[disabled] {  background-color: #bd362f;  *background-color: #a9302a;}.btn-danger:active,.btn-danger.active {  background-color: #942a25 \9;}.btn-success {  background-color: #5bb75b;  background-image: -moz-linear-gradient(top, #62c462, #51a351);  background-image: -ms-linear-gradient(top, #62c462, #51a351);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));  background-image: -webkit-linear-gradient(top, #62c462, #51a351);  background-image: -o-linear-gradient(top, #62c462, #51a351);  background-image: linear-gradient(top, #62c462, #51a351);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);  border-color: #51a351 #51a351 #387038;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #51a351;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-success:hover,.btn-success:active,.btn-success.active,.btn-success.disabled,.btn-success[disabled] {  background-color: #51a351;  *background-color: #499249;}.btn-success:active,.btn-success.active {  background-color: #408140 \9;}.btn-info {  background-color: #49afcd;  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);  background-image: linear-gradient(top, #5bc0de, #2f96b4);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);  border-color: #2f96b4 #2f96b4 #1f6377;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #2f96b4;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-info:hover,.btn-info:active,.btn-info.active,.btn-info.disabled,.btn-info[disabled] {  background-color: #2f96b4;  *background-color: #2a85a0;}.btn-info:active,.btn-info.active {  background-color: #24748c \9;}.btn-inverse {  background-color: #414141;  background-image: -moz-linear-gradient(top, #555555, #222222);  background-image: -ms-linear-gradient(top, #555555, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#555555), to(#222222));  background-image: -webkit-linear-gradient(top, #555555, #222222);  background-image: -o-linear-gradient(top, #555555, #222222);  background-image: linear-gradient(top, #555555, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#555555', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-inverse:hover,.btn-inverse:active,.btn-inverse.active,.btn-inverse.disabled,.btn-inverse[disabled] {  background-color: #222222;  *background-color: #151515;}.btn-inverse:active,.btn-inverse.active {  background-color: #080808 \9;}button.btn,input[type="submit"].btn {  *padding-top: 2px;  *padding-bottom: 2px;}button.btn::-moz-focus-inner,input[type="submit"].btn::-moz-focus-inner {  padding: 0;  border: 0;}button.btn.btn-large,input[type="submit"].btn.btn-large {  *padding-top: 7px;  *padding-bottom: 7px;}button.btn.btn-small,input[type="submit"].btn.btn-small {  *padding-top: 3px;  *padding-bottom: 3px;}button.btn.btn-mini,input[type="submit"].btn.btn-mini {  *padding-top: 1px;  *padding-bottom: 1px;}.btn-group {  position: relative;  *zoom: 1;  *margin-left: .3em;}.btn-group:before,.btn-group:after {  display: table;  content: "";}.btn-group:after {  clear: both;}.btn-group:first-child {  *margin-left: 0;}.btn-group + .btn-group {  margin-left: 5px;}.btn-toolbar {  margin-top: 9px;  margin-bottom: 9px;}.btn-toolbar .btn-group {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;}.btn-group > .btn {  position: relative;  float: left;  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.btn-group > .btn:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;  border-top-left-radius: 4px;  -webkit-border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;  border-bottom-left-radius: 4px;}.btn-group > .btn:last-child,.btn-group > .dropdown-toggle {  -webkit-border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;  border-top-right-radius: 4px;  -webkit-border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;  border-bottom-right-radius: 4px;}.btn-group > .btn.large:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 6px;  -moz-border-radius-topleft: 6px;  border-top-left-radius: 6px;  -webkit-border-bottom-left-radius: 6px;  -moz-border-radius-bottomleft: 6px;  border-bottom-left-radius: 6px;}.btn-group > .btn.large:last-child,.btn-group > .large.dropdown-toggle {  -webkit-border-top-right-radius: 6px;  -moz-border-radius-topright: 6px;  border-top-right-radius: 6px;  -webkit-border-bottom-right-radius: 6px;  -moz-border-radius-bottomright: 6px;  border-bottom-right-radius: 6px;}.btn-group > .btn:hover,.btn-group > .btn:focus,.btn-group > .btn:active,.btn-group > .btn.active {  z-index: 2;}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle {  outline: 0;}.btn-group > .dropdown-toggle {  padding-left: 8px;  padding-right: 8px;  -webkit-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-mini.dropdown-toggle {  padding-left: 5px;  padding-right: 5px;}.btn-group > .btn-small.dropdown-toggle {  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-large.dropdown-toggle {  padding-left: 12px;  padding-right: 12px;}.btn-group.open .dropdown-toggle {  background-image: none;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn-group.open .btn.dropdown-toggle {  background-color: #e6e6e6;}.btn-group.open .btn-primary.dropdown-toggle {  background-color: #0055cc;}.btn-group.open .btn-warning.dropdown-toggle {  background-color: #f89406;}.btn-group.open .btn-danger.dropdown-toggle {  background-color: #bd362f;}.btn-group.open .btn-success.dropdown-toggle {  background-color: #51a351;}.btn-group.open .btn-info.dropdown-toggle {  background-color: #2f96b4;}.btn-group.open .btn-inverse.dropdown-toggle {  background-color: #222222;}.btn .caret {  margin-top: 7px;  margin-left: 0;}.btn:hover .caret,.open.btn-group .caret {  opacity: 1;  filter: alpha(opacity=100);}.btn-mini .caret {  margin-top: 5px;}.btn-small .caret {  margin-top: 6px;}.btn-large .caret {  margin-top: 6px;  border-left-width: 5px;  border-right-width: 5px;  border-top-width: 5px;}.dropup .btn-large .caret {  border-bottom: 5px solid #000000;  border-top: 0;}.btn-primary .caret,.btn-warning .caret,.btn-danger .caret,.btn-info .caret,.btn-success .caret,.btn-inverse .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 0.75;  filter: alpha(opacity=75);}.nav {  margin-left: 0;  margin-bottom: 18px;  list-style: none;}.nav > li > a {  display: block;}.nav > li > a:hover {  text-decoration: none;  background-color: #eeeeee;}.nav > .pull-right {  float: right;}.nav .nav-header {  display: block;  padding: 3px 15px;  font-size: 11px;  font-weight: bold;  line-height: 18px;  color: #999999;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  text-transform: uppercase;}.nav li + .nav-header {  margin-top: 9px;}.nav-list {  padding-left: 15px;  padding-right: 15px;  margin-bottom: 0;}.nav-list > li > a,.nav-list .nav-header {  margin-left: -15px;  margin-right: -15px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);}.nav-list > li > a {  padding: 3px 15px;}.nav-list > .active > a,.nav-list > .active > a:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.2);  background-color: #0088cc;}.nav-list [class^="icon-"] {  margin-right: 2px;}.nav-list .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.nav-tabs,.nav-pills {  *zoom: 1;}.nav-tabs:before,.nav-pills:before,.nav-tabs:after,.nav-pills:after {  display: table;  content: "";}.nav-tabs:after,.nav-pills:after {  clear: both;}.nav-tabs > li,.nav-pills > li {  float: left;}.nav-tabs > li > a,.nav-pills > li > a {  padding-right: 12px;  padding-left: 12px;  margin-right: 2px;  line-height: 14px;}.nav-tabs {  border-bottom: 1px solid #ddd;}.nav-tabs > li {  margin-bottom: -1px;}.nav-tabs > li > a {  padding-top: 8px;  padding-bottom: 8px;  line-height: 18px;  border: 1px solid transparent;  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #dddddd;}.nav-tabs > .active > a,.nav-tabs > .active > a:hover {  color: #555555;  background-color: #ffffff;  border: 1px solid #ddd;  border-bottom-color: transparent;  cursor: default;}.nav-pills > li > a {  padding-top: 8px;  padding-bottom: 8px;  margin-top: 2px;  margin-bottom: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.nav-pills > .active > a,.nav-pills > .active > a:hover {  color: #ffffff;  background-color: #0088cc;}.nav-stacked > li {  float: none;}.nav-stacked > li > a {  margin-right: 0;}.nav-tabs.nav-stacked {  border-bottom: 0;}.nav-tabs.nav-stacked > li > a {  border: 1px solid #ddd;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.nav-tabs.nav-stacked > li:first-child > a {  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs.nav-stacked > li:last-child > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.nav-tabs.nav-stacked > li > a:hover {  border-color: #ddd;  z-index: 2;}.nav-pills.nav-stacked > li > a {  margin-bottom: 3px;}.nav-pills.nav-stacked > li:last-child > a {  margin-bottom: 1px;}.nav-tabs .dropdown-menu {  -webkit-border-radius: 0 0 5px 5px;  -moz-border-radius: 0 0 5px 5px;  border-radius: 0 0 5px 5px;}.nav-pills .dropdown-menu {  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.nav-tabs .dropdown-toggle .caret,.nav-pills .dropdown-toggle .caret {  border-top-color: #0088cc;  border-bottom-color: #0088cc;  margin-top: 6px;}.nav-tabs .dropdown-toggle:hover .caret,.nav-pills .dropdown-toggle:hover .caret {  border-top-color: #005580;  border-bottom-color: #005580;}.nav-tabs .active .dropdown-toggle .caret,.nav-pills .active .dropdown-toggle .caret {  border-top-color: #333333;  border-bottom-color: #333333;}.nav > .dropdown.active > a:hover {  color: #000000;  cursor: pointer;}.nav-tabs .open .dropdown-toggle,.nav-pills .open .dropdown-toggle,.nav > li.dropdown.open.active > a:hover {  color: #ffffff;  background-color: #999999;  border-color: #999999;}.nav li.dropdown.open .caret,.nav li.dropdown.open.active .caret,.nav li.dropdown.open a:hover .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 1;  filter: alpha(opacity=100);}.tabs-stacked .open > a:hover {  border-color: #999999;}.tabbable {  *zoom: 1;}.tabbable:before,.tabbable:after {  display: table;  content: "";}.tabbable:after {  clear: both;}.tab-content {  overflow: auto;}.tabs-below > .nav-tabs,.tabs-right > .nav-tabs,.tabs-left > .nav-tabs {  border-bottom: 0;}.tab-content > .tab-pane,.pill-content > .pill-pane {  display: none;}.tab-content > .active,.pill-content > .active {  display: block;}.tabs-below > .nav-tabs {  border-top: 1px solid #ddd;}.tabs-below > .nav-tabs > li {  margin-top: -1px;  margin-bottom: 0;}.tabs-below > .nav-tabs > li > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.tabs-below > .nav-tabs > li > a:hover {  border-bottom-color: transparent;  border-top-color: #ddd;}.tabs-below > .nav-tabs > .active > a,.tabs-below > .nav-tabs > .active > a:hover {  border-color: transparent #ddd #ddd #ddd;}.tabs-left > .nav-tabs > li,.tabs-right > .nav-tabs > li {  float: none;}.tabs-left > .nav-tabs > li > a,.tabs-right > .nav-tabs > li > a {  min-width: 74px;  margin-right: 0;  margin-bottom: 3px;}.tabs-left > .nav-tabs {  float: left;  margin-right: 19px;  border-right: 1px solid #ddd;}.tabs-left > .nav-tabs > li > a {  margin-right: -1px;  -webkit-border-radius: 4px 0 0 4px;  -moz-border-radius: 4px 0 0 4px;  border-radius: 4px 0 0 4px;}.tabs-left > .nav-tabs > li > a:hover {  border-color: #eeeeee #dddddd #eeeeee #eeeeee;}.tabs-left > .nav-tabs .active > a,.tabs-left > .nav-tabs .active > a:hover {  border-color: #ddd transparent #ddd #ddd;  *border-right-color: #ffffff;}.tabs-right > .nav-tabs {  float: right;  margin-left: 19px;  border-left: 1px solid #ddd;}.tabs-right > .nav-tabs > li > a {  margin-left: -1px;  -webkit-border-radius: 0 4px 4px 0;  -moz-border-radius: 0 4px 4px 0;  border-radius: 0 4px 4px 0;}.tabs-right > .nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #eeeeee #dddddd;}.tabs-right > .nav-tabs .active > a,.tabs-right > .nav-tabs .active > a:hover {  border-color: #ddd #ddd #ddd transparent;  *border-left-color: #ffffff;}.navbar {  *position: relative;  *z-index: 2;  overflow: visible;  margin-bottom: 18px;}.navbar-inner {  min-height: 40px;  padding-left: 20px;  padding-right: 20px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  -moz-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);}.navbar .container {  width: auto;}.nav-collapse.collapse {  height: auto;}.navbar {  color: #999999;}.navbar .brand:hover {  text-decoration: none;}.navbar .brand {  float: left;  display: block;  padding: 8px 20px 12px;  margin-left: -20px;  font-size: 20px;  font-weight: 200;  line-height: 1;  color: #999999;}.navbar .navbar-text {  margin-bottom: 0;  line-height: 40px;}.navbar .navbar-link {  color: #999999;}.navbar .navbar-link:hover {  color: #ffffff;}.navbar .btn,.navbar .btn-group {  margin-top: 5px;}.navbar .btn-group .btn {  margin: 0;}.navbar-form {  margin-bottom: 0;  *zoom: 1;}.navbar-form:before,.navbar-form:after {  display: table;  content: "";}.navbar-form:after {  clear: both;}.navbar-form input,.navbar-form select,.navbar-form .radio,.navbar-form .checkbox {  margin-top: 5px;}.navbar-form input,.navbar-form select {  display: inline-block;  margin-bottom: 0;}.navbar-form input[type="image"],.navbar-form input[type="checkbox"],.navbar-form input[type="radio"] {  margin-top: 3px;}.navbar-form .input-append,.navbar-form .input-prepend {  margin-top: 6px;  white-space: nowrap;}.navbar-form .input-append input,.navbar-form .input-prepend input {  margin-top: 0;}.navbar-search {  position: relative;  float: left;  margin-top: 6px;  margin-bottom: 0;}.navbar-search .search-query {  padding: 4px 9px;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  font-weight: normal;  line-height: 1;  color: #ffffff;  background-color: #626262;  border: 1px solid #151515;  -webkit-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -moz-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -webkit-transition: none;  -moz-transition: none;  -ms-transition: none;  -o-transition: none;  transition: none;}.navbar-search .search-query:-moz-placeholder {  color: #cccccc;}.navbar-search .search-query:-ms-input-placeholder {  color: #cccccc;}.navbar-search .search-query::-webkit-input-placeholder {  color: #cccccc;}.navbar-search .search-query:focus,.navbar-search .search-query.focused {  padding: 5px 10px;  color: #333333;  text-shadow: 0 1px 0 #ffffff;  background-color: #ffffff;  border: 0;  -webkit-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  -moz-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  outline: 0;}.navbar-fixed-top,.navbar-fixed-bottom {  position: fixed;  right: 0;  left: 0;  z-index: 1030;  margin-bottom: 0;}.navbar-fixed-top .navbar-inner,.navbar-fixed-bottom .navbar-inner {  padding-left: 0;  padding-right: 0;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.navbar-fixed-top {  top: 0;}.navbar-fixed-bottom {  bottom: 0;}.navbar .nav {  position: relative;  left: 0;  display: block;  float: left;  margin: 0 10px 0 0;}.navbar .nav.pull-right {  float: right;}.navbar .nav > li {  display: block;  float: left;}.navbar .nav > li > a {  float: none;  padding: 9px 10px 11px;  line-height: 19px;  color: #999999;  text-decoration: none;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.navbar .btn {  display: inline-block;  padding: 4px 10px 4px;  margin: 5px 5px 6px;  line-height: 18px;}.navbar .btn-group {  margin: 0;  padding: 5px 5px 6px;}.navbar .nav > li > a:hover {  background-color: transparent;  color: #ffffff;  text-decoration: none;}.navbar .nav .active > a,.navbar .nav .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #222222;}.navbar .divider-vertical {  height: 40px;  width: 1px;  margin: 0 9px;  overflow: hidden;  background-color: #222222;  border-right: 1px solid #333333;}.navbar .nav.pull-right {  margin-left: 10px;  margin-right: 0;}.navbar .btn-navbar {  display: none;  float: right;  padding: 7px 10px;  margin-left: 5px;  margin-right: 5px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);}.navbar .btn-navbar:hover,.navbar .btn-navbar:active,.navbar .btn-navbar.active,.navbar .btn-navbar.disabled,.navbar .btn-navbar[disabled] {  background-color: #222222;  *background-color: #151515;}.navbar .btn-navbar:active,.navbar .btn-navbar.active {  background-color: #080808 \9;}.navbar .btn-navbar .icon-bar {  display: block;  width: 18px;  height: 2px;  background-color: #f5f5f5;  -webkit-border-radius: 1px;  -moz-border-radius: 1px;  border-radius: 1px;  -webkit-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  -moz-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);}.btn-navbar .icon-bar + .icon-bar {  margin-top: 3px;}.navbar .dropdown-menu:before {  content: '';  display: inline-block;  border-left: 7px solid transparent;  border-right: 7px solid transparent;  border-bottom: 7px solid #ccc;  border-bottom-color: rgba(0, 0, 0, 0.2);  position: absolute;  top: -7px;  left: 9px;}.navbar .dropdown-menu:after {  content: '';  display: inline-block;  border-left: 6px solid transparent;  border-right: 6px solid transparent;  border-bottom: 6px solid #ffffff;  position: absolute;  top: -6px;  left: 10px;}.navbar-fixed-bottom .dropdown-menu:before {  border-top: 7px solid #ccc;  border-top-color: rgba(0, 0, 0, 0.2);  border-bottom: 0;  bottom: -7px;  top: auto;}.navbar-fixed-bottom .dropdown-menu:after {  border-top: 6px solid #ffffff;  border-bottom: 0;  bottom: -6px;  top: auto;}.navbar .nav li.dropdown .dropdown-toggle .caret,.navbar .nav li.dropdown.open .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;}.navbar .nav li.dropdown.active .caret {  opacity: 1;  filter: alpha(opacity=100);}.navbar .nav li.dropdown.open > .dropdown-toggle,.navbar .nav li.dropdown.active > .dropdown-toggle,.navbar .nav li.dropdown.open.active > .dropdown-toggle {  background-color: transparent;}.navbar .nav li.dropdown.active > .dropdown-toggle:hover {  color: #ffffff;}.navbar .pull-right .dropdown-menu,.navbar .dropdown-menu.pull-right {  left: auto;  right: 0;}.navbar .pull-right .dropdown-menu:before,.navbar .dropdown-menu.pull-right:before {  left: auto;  right: 12px;}.navbar .pull-right .dropdown-menu:after,.navbar .dropdown-menu.pull-right:after {  left: auto;  right: 13px;}.breadcrumb {  padding: 7px 14px;  margin: 0 0 18px;  list-style: none;  background-color: #fbfbfb;  background-image: -moz-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -ms-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#f5f5f5));  background-image: -webkit-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -o-linear-gradient(top, #ffffff, #f5f5f5);  background-image: linear-gradient(top, #ffffff, #f5f5f5);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#f5f5f5', GradientType=0);  border: 1px solid #ddd;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;}.breadcrumb li {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  text-shadow: 0 1px 0 #ffffff;}.breadcrumb .divider {  padding: 0 5px;  color: #999999;}.breadcrumb .active a {  color: #333333;}.pagination {  height: 36px;  margin: 18px 0;}.pagination ul {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-left: 0;  margin-bottom: 0;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  -moz-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);}.pagination li {  display: inline;}.pagination a {  float: left;  padding: 0 14px;  line-height: 34px;  text-decoration: none;  border: 1px solid #ddd;  border-left-width: 0;}.pagination a:hover,.pagination .active a {  background-color: #f5f5f5;}.pagination .active a {  color: #999999;  cursor: default;}.pagination .disabled span,.pagination .disabled a,.pagination .disabled a:hover {  color: #999999;  background-color: transparent;  cursor: default;}.pagination li:first-child a {  border-left-width: 1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.pagination li:last-child a {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.pagination-centered {  text-align: center;}.pagination-right {  text-align: right;}.pager {  margin-left: 0;  margin-bottom: 18px;  list-style: none;  text-align: center;  *zoom: 1;}.pager:before,.pager:after {  display: table;  content: "";}.pager:after {  clear: both;}.pager li {  display: inline;}.pager a {  display: inline-block;  padding: 5px 14px;  background-color: #fff;  border: 1px solid #ddd;  -webkit-border-radius: 15px;  -moz-border-radius: 15px;  border-radius: 15px;}.pager a:hover {  text-decoration: none;  background-color: #f5f5f5;}.pager .next a {  float: right;}.pager .previous a {  float: left;}.pager .disabled a,.pager .disabled a:hover {  color: #999999;  background-color: #fff;  cursor: default;}.thumbnails {  margin-left: -20px;  list-style: none;  *zoom: 1;}.thumbnails:before,.thumbnails:after {  display: table;  content: "";}.thumbnails:after {  clear: both;}.row-fluid .thumbnails {  margin-left: 0;}.thumbnails > li {  float: left;  margin-bottom: 18px;  margin-left: 20px;}.thumbnail {  display: block;  padding: 4px;  line-height: 1;  border: 1px solid #ddd;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  -moz-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);}a.thumbnail:hover {  border-color: #0088cc;  -webkit-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  -moz-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);}.thumbnail > img {  display: block;  max-width: 100%;  margin-left: auto;  margin-right: auto;}.thumbnail .caption {  padding: 9px;}.alert {  padding: 8px 35px 8px 14px;  margin-bottom: 18px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  background-color: #fcf8e3;  border: 1px solid #fbeed5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  color: #c09853;}.alert-heading {  color: inherit;}.alert .close {  position: relative;  top: -2px;  right: -21px;  line-height: 18px;}.alert-success {  background-color: #dff0d8;  border-color: #d6e9c6;  color: #468847;}.alert-danger,.alert-error {  background-color: #f2dede;  border-color: #eed3d7;  color: #b94a48;}.alert-info {  background-color: #d9edf7;  border-color: #bce8f1;  color: #3a87ad;}.alert-block {  padding-top: 14px;  padding-bottom: 14px;}.alert-block > p,.alert-block > ul {  margin-bottom: 0;}.alert-block p + p {  margin-top: 5px;}@-webkit-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-moz-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-ms-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-o-keyframes progress-bar-stripes {  from {    background-position: 0 0;  }  to {    background-position: 40px 0;  }}@keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}.progress {  overflow: hidden;  height: 18px;  margin-bottom: 18px;  background-color: #f7f7f7;  background-image: -moz-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -ms-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#f5f5f5), to(#f9f9f9));  background-image: -webkit-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -o-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: linear-gradient(top, #f5f5f5, #f9f9f9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#f5f5f5', endColorstr='#f9f9f9', GradientType=0);  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.progress .bar {  width: 0%;  height: 18px;  color: #ffffff;  font-size: 12px;  text-align: center;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #0e90d2;  background-image: -moz-linear-gradient(top, #149bdf, #0480be);  background-image: -ms-linear-gradient(top, #149bdf, #0480be);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#149bdf), to(#0480be));  background-image: -webkit-linear-gradient(top, #149bdf, #0480be);  background-image: -o-linear-gradient(top, #149bdf, #0480be);  background-image: linear-gradient(top, #149bdf, #0480be);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#149bdf', endColorstr='#0480be', GradientType=0);  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -moz-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  -webkit-transition: width 0.6s ease;  -moz-transition: width 0.6s ease;  -ms-transition: width 0.6s ease;  -o-transition: width 0.6s ease;  transition: width 0.6s ease;}.progress-striped .bar {  background-color: #149bdf;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  -webkit-background-size: 40px 40px;  -moz-background-size: 40px 40px;  -o-background-size: 40px 40px;  background-size: 40px 40px;}.progress.active .bar {  -webkit-animation: progress-bar-stripes 2s linear infinite;  -moz-animation: progress-bar-stripes 2s linear infinite;  -ms-animation: progress-bar-stripes 2s linear infinite;  -o-animation: progress-bar-stripes 2s linear infinite;  animation: progress-bar-stripes 2s linear infinite;}.progress-danger .bar {  background-color: #dd514c;  background-image: -moz-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -ms-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#c43c35));  background-image: -webkit-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -o-linear-gradient(top, #ee5f5b, #c43c35);  background-image: linear-gradient(top, #ee5f5b, #c43c35);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#c43c35', GradientType=0);}.progress-danger.progress-striped .bar {  background-color: #ee5f5b;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-success .bar {  background-color: #5eb95e;  background-image: -moz-linear-gradient(top, #62c462, #57a957);  background-image: -ms-linear-gradient(top, #62c462, #57a957);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#57a957));  background-image: -webkit-linear-gradient(top, #62c462, #57a957);  background-image: -o-linear-gradient(top, #62c462, #57a957);  background-image: linear-gradient(top, #62c462, #57a957);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#57a957', GradientType=0);}.progress-success.progress-striped .bar {  background-color: #62c462;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-info .bar {  background-color: #4bb1cf;  background-image: -moz-linear-gradient(top, #5bc0de, #339bb9);  background-image: -ms-linear-gradient(top, #5bc0de, #339bb9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#339bb9));  background-image: -webkit-linear-gradient(top, #5bc0de, #339bb9);  background-image: -o-linear-gradient(top, #5bc0de, #339bb9);  background-image: linear-gradient(top, #5bc0de, #339bb9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#339bb9', GradientType=0);}.progress-info.progress-striped .bar {  background-color: #5bc0de;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-warning .bar {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);}.progress-warning.progress-striped .bar {  background-color: #fbb450;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.hero-unit {  padding: 60px;  margin-bottom: 30px;  background-color: #eeeeee;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.hero-unit h1 {  margin-bottom: 0;  font-size: 60px;  line-height: 1;  color: inherit;  letter-spacing: -1px;}.hero-unit p {  font-size: 18px;  font-weight: 200;  line-height: 27px;  color: inherit;}.tooltip {  position: absolute;  z-index: 1020;  display: block;  visibility: visible;  padding: 5px;  font-size: 11px;  opacity: 0;  filter: alpha(opacity=0);}.tooltip.in {  opacity: 0.8;  filter: alpha(opacity=80);}.tooltip.top {  margin-top: -2px;}.tooltip.right {  margin-left: 2px;}.tooltip.bottom {  margin-top: 2px;}.tooltip.left {  margin-left: -2px;}.tooltip.top .tooltip-arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.tooltip.left .tooltip-arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.tooltip.bottom .tooltip-arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.tooltip.right .tooltip-arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.tooltip-inner {  max-width: 200px;  padding: 3px 8px;  color: #ffffff;  text-align: center;  text-decoration: none;  background-color: #000000;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.tooltip-arrow {  position: absolute;  width: 0;  height: 0;}.popover {  position: absolute;  top: 0;  left: 0;  z-index: 1010;  display: none;  padding: 5px;}.popover.top {  margin-top: -5px;}.popover.right {  margin-left: 5px;}.popover.bottom {  margin-top: 5px;}.popover.left {  margin-left: -5px;}.popover.top .arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.popover.right .arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.popover.bottom .arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.popover.left .arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.popover .arrow {  position: absolute;  width: 0;  height: 0;}.popover-inner {  padding: 3px;  width: 280px;  overflow: hidden;  background: #000000;  background: rgba(0, 0, 0, 0.8);  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);}.popover-title {  padding: 9px 15px;  line-height: 1;  background-color: #f5f5f5;  border-bottom: 1px solid #eee;  -webkit-border-radius: 3px 3px 0 0;  -moz-border-radius: 3px 3px 0 0;  border-radius: 3px 3px 0 0;}.popover-content {  padding: 14px;  background-color: #ffffff;  -webkit-border-radius: 0 0 3px 3px;  -moz-border-radius: 0 0 3px 3px;  border-radius: 0 0 3px 3px;  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.popover-content p,.popover-content ul,.popover-content ol {  margin-bottom: 0;}.modal-open .dropdown-menu {  z-index: 2050;}.modal-open .dropdown.open {  *z-index: 2050;}.modal-open .popover {  z-index: 2060;}.modal-open .tooltip {  z-index: 2070;}.modal-backdrop {  position: fixed;  top: 0;  right: 0;  bottom: 0;  left: 0;  z-index: 1040;  background-color: #000000;}.modal-backdrop.fade {  opacity: 0;}.modal-backdrop,.modal-backdrop.fade.in {  opacity: 0.8;  filter: alpha(opacity=80);}.modal {  position: fixed;  top: 50%;  left: 50%;  z-index: 1050;  overflow: auto;  width: 560px;  margin: -250px 0 0 -280px;  background-color: #ffffff;  border: 1px solid #999;  border: 1px solid rgba(0, 0, 0, 0.3);  *border: 1px solid #999;  /* IE6-7 */  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.modal.fade {  -webkit-transition: opacity .3s linear, top .3s ease-out;  -moz-transition: opacity .3s linear, top .3s ease-out;  -ms-transition: opacity .3s linear, top .3s ease-out;  -o-transition: opacity .3s linear, top .3s ease-out;  transition: opacity .3s linear, top .3s ease-out;  top: -25%;}.modal.fade.in {  top: 50%;}.modal-header {  padding: 9px 15px;  border-bottom: 1px solid #eee;}.modal-header .close {  margin-top: 2px;}.modal-body {  overflow-y: auto;  max-height: 400px;  padding: 15px;}.modal-form {  margin-bottom: 0;}.modal-footer {  padding: 14px 15px 15px;  margin-bottom: 0;  text-align: right;  background-color: #f5f5f5;  border-top: 1px solid #ddd;  -webkit-border-radius: 0 0 6px 6px;  -moz-border-radius: 0 0 6px 6px;  border-radius: 0 0 6px 6px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;  *zoom: 1;}.modal-footer:before,.modal-footer:after {  display: table;  content: "";}.modal-footer:after {  clear: both;}.modal-footer .btn + .btn {  margin-left: 5px;  margin-bottom: 0;}.modal-footer .btn-group .btn + .btn {  margin-left: -1px;}.dropup,.dropdown {  position: relative;}.dropdown-toggle {  *margin-bottom: -3px;}.dropdown-toggle:active,.open .dropdown-toggle {  outline: 0;}.caret {  display: inline-block;  width: 0;  height: 0;  vertical-align: top;  border-top: 4px solid #000000;  border-right: 4px solid transparent;  border-left: 4px solid transparent;  content: "";  opacity: 0.3;  filter: alpha(opacity=30);}.dropdown .caret {  margin-top: 8px;  margin-left: 2px;}.dropdown:hover .caret,.open .caret {  opacity: 1;  filter: alpha(opacity=100);}.dropdown-menu {  position: absolute;  top: 100%;  left: 0;  z-index: 1000;  display: none;  float: left;  min-width: 160px;  padding: 4px 0;  margin: 1px 0 0;  list-style: none;  background-color: #ffffff;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.2);  *border-right-width: 2px;  *border-bottom-width: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -moz-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -webkit-background-clip: padding-box;  -moz-background-clip: padding;  background-clip: padding-box;}.dropdown-menu.pull-right {  right: 0;  left: auto;}.dropdown-menu .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.dropdown-menu a {  display: block;  padding: 3px 15px;  clear: both;  font-weight: normal;  line-height: 18px;  color: #333333;  white-space: nowrap;}.dropdown-menu li > a:hover,.dropdown-menu .active > a,.dropdown-menu .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #0088cc;}.open {  *z-index: 1000;}.open  > .dropdown-menu {  display: block;}.pull-right > .dropdown-menu {  right: 0;  left: auto;}.dropup .caret,.navbar-fixed-bottom .dropdown .caret {  border-top: 0;  border-bottom: 4px solid #000000;  content: "\2191";}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu {  top: auto;  bottom: 100%;  margin-bottom: 1px;}.typeahead {  margin-top: 2px;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion {  margin-bottom: 18px;}.accordion-group {  margin-bottom: 2px;  border: 1px solid #e5e5e5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion-heading {  border-bottom: 0;}.accordion-heading .accordion-toggle {  display: block;  padding: 8px 15px;}.accordion-toggle {  cursor: pointer;}.accordion-inner {  padding: 9px 15px;  border-top: 1px solid #e5e5e5;}.carousel {  position: relative;  margin-bottom: 18px;  line-height: 1;}.carousel-inner {  overflow: hidden;  width: 100%;  position: relative;}.carousel .item {  display: none;  position: relative;  -webkit-transition: 0.6s ease-in-out left;  -moz-transition: 0.6s ease-in-out left;  -ms-transition: 0.6s ease-in-out left;  -o-transition: 0.6s ease-in-out left;  transition: 0.6s ease-in-out left;}.carousel .item > img {  display: block;  line-height: 1;}.carousel .active,.carousel .next,.carousel .prev {  display: block;}.carousel .active {  left: 0;}.carousel .next,.carousel .prev {  position: absolute;  top: 0;  width: 100%;}.carousel .next {  left: 100%;}.carousel .prev {  left: -100%;}.carousel .next.left,.carousel .prev.right {  left: 0;}.carousel .active.left {  left: -100%;}.carousel .active.right {  left: 100%;}.carousel-control {  position: absolute;  top: 40%;  left: 15px;  width: 40px;  height: 40px;  margin-top: -20px;  font-size: 60px;  font-weight: 100;  line-height: 30px;  color: #ffffff;  text-align: center;  background: #222222;  border: 3px solid #ffffff;  -webkit-border-radius: 23px;  -moz-border-radius: 23px;  border-radius: 23px;  opacity: 0.5;  filter: alpha(opacity=50);}.carousel-control.right {  left: auto;  right: 15px;}.carousel-control:hover {  color: #ffffff;  text-decoration: none;  opacity: 0.9;  filter: alpha(opacity=90);}.carousel-caption {  position: absolute;  left: 0;  right: 0;  bottom: 0;  padding: 10px 15px 5px;  background: #333333;  background: rgba(0, 0, 0, 0.75);}.carousel-caption h4,.carousel-caption p {  color: #ffffff;}.well {  min-height: 20px;  padding: 19px;  margin-bottom: 20px;  background-color: #f5f5f5;  border: 1px solid #eee;  border: 1px solid rgba(0, 0, 0, 0.05);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);}.well blockquote {  border-color: #ddd;  border-color: rgba(0, 0, 0, 0.15);}.well-large {  padding: 24px;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.well-small {  padding: 9px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.close {  float: right;  font-size: 20px;  font-weight: bold;  line-height: 18px;  color: #000000;  text-shadow: 0 1px 0 #ffffff;  opacity: 0.2;  filter: alpha(opacity=20);}.close:hover {  color: #000000;  text-decoration: none;  cursor: pointer;  opacity: 0.4;  filter: alpha(opacity=40);}button.close {  padding: 0;  cursor: pointer;  background: transparent;  border: 0;  -webkit-appearance: none;}.pull-right {  float: right;}.pull-left {  float: left;}.hide {  display: none;}.show {  display: block;}.invisible {  visibility: hidden;}.fade {  opacity: 0;  -webkit-transition: opacity 0.15s linear;  -moz-transition: opacity 0.15s linear;  -ms-transition: opacity 0.15s linear;  -o-transition: opacity 0.15s linear;  transition: opacity 0.15s linear;}.fade.in {  opacity: 1;}.collapse {  position: relative;  height: 0;  overflow: hidden;  -webkit-transition: height 0.35s ease;  -moz-transition: height 0.35s ease;  -ms-transition: height 0.35s ease;  -o-transition: height 0.35s ease;  transition: height 0.35s ease;}.collapse.in {  height: auto;}.hidden {  display: none;  visibility: hidden;}.visible-phone {  display: none !important;}.visible-tablet {  display: none !important;}.hidden-desktop {  display: none !important;}@media (max-width: 767px) {  .visible-phone {    display: inherit !important;  }  .hidden-phone {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important;  }}@media (min-width: 768px) and (max-width: 979px) {  .visible-tablet {    display: inherit !important;  }  .hidden-tablet {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important ;  }}@media (max-width: 480px) {  .nav-collapse {    -webkit-transform: translate3d(0, 0, 0);  }  .page-header h1 small {    display: block;    line-height: 18px;  }  input[type="checkbox"],  input[type="radio"] {    border: 1px solid #ccc;  }  .form-horizontal .control-group > label {    float: none;    width: auto;    padding-top: 0;    text-align: left;  }  .form-horizontal .controls {    margin-left: 0;  }  .form-horizontal .control-list {    padding-top: 0;  }  .form-horizontal .form-actions {    padding-left: 10px;    padding-right: 10px;  }  .modal {    position: absolute;    top: 10px;    left: 10px;    right: 10px;    width: auto;    margin: 0;  }  .modal.fade.in {    top: auto;  }  .modal-header .close {    padding: 10px;    margin: -10px;  }  .carousel-caption {    position: static;  }}@media (max-width: 767px) {  body {    padding-left: 20px;    padding-right: 20px;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    margin-left: -20px;    margin-right: -20px;  }  .container-fluid {    padding: 0;  }  .dl-horizontal dt {    float: none;    clear: none;    width: auto;    text-align: left;  }  .dl-horizontal dd {    margin-left: 0;  }  .container {    width: auto;  }  .row-fluid {    width: 100%;  }  .row,  .thumbnails {    margin-left: 0;  }  [class*="span"],  .row-fluid [class*="span"] {    float: none;    display: block;    width: auto;    margin-left: 0;  }  .input-large,  .input-xlarge,  .input-xxlarge,  input[class*="span"],  select[class*="span"],  textarea[class*="span"],  .uneditable-input {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;  }  .input-prepend input,  .input-append input,  .input-prepend input[class*="span"],  .input-append input[class*="span"] {    display: inline-block;    width: auto;  }}@media (min-width: 768px) and (max-width: 979px) {  .row {    margin-left: -20px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 20px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 724px;  }  .span12 {    width: 724px;  }  .span11 {    width: 662px;  }  .span10 {    width: 600px;  }  .span9 {    width: 538px;  }  .span8 {    width: 476px;  }  .span7 {    width: 414px;  }  .span6 {    width: 352px;  }  .span5 {    width: 290px;  }  .span4 {    width: 228px;  }  .span3 {    width: 166px;  }  .span2 {    width: 104px;  }  .span1 {    width: 42px;  }  .offset12 {    margin-left: 764px;  }  .offset11 {    margin-left: 702px;  }  .offset10 {    margin-left: 640px;  }  .offset9 {    margin-left: 578px;  }  .offset8 {    margin-left: 516px;  }  .offset7 {    margin-left: 454px;  }  .offset6 {    margin-left: 392px;  }  .offset5 {    margin-left: 330px;  }  .offset4 {    margin-left: 268px;  }  .offset3 {    margin-left: 206px;  }  .offset2 {    margin-left: 144px;  }  .offset1 {    margin-left: 82px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.762430939%;    *margin-left: 2.709239449638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 99.999999993%;    *width: 99.9468085036383%;  }  .row-fluid .span11 {    width: 91.436464082%;    *width: 91.38327259263829%;  }  .row-fluid .span10 {    width: 82.87292817100001%;    *width: 82.8197366816383%;  }  .row-fluid .span9 {    width: 74.30939226%;    *width: 74.25620077063829%;  }  .row-fluid .span8 {    width: 65.74585634900001%;    *width: 65.6926648596383%;  }  .row-fluid .span7 {    width: 57.182320438000005%;    *width: 57.129128948638304%;  }  .row-fluid .span6 {    width: 48.618784527%;    *width: 48.5655930376383%;  }  .row-fluid .span5 {    width: 40.055248616%;    *width: 40.0020571266383%;  }  .row-fluid .span4 {    width: 31.491712705%;    *width: 31.4385212156383%;  }  .row-fluid .span3 {    width: 22.928176794%;    *width: 22.874985304638297%;  }  .row-fluid .span2 {    width: 14.364640883%;    *width: 14.311449393638298%;  }  .row-fluid .span1 {    width: 5.801104972%;    *width: 5.747913482638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 714px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 652px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 590px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 528px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 466px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 404px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 342px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 280px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 218px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 156px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 94px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 32px;  }}@media (min-width: 1200px) {  .row {    margin-left: -30px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 30px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 1170px;  }  .span12 {    width: 1170px;  }  .span11 {    width: 1070px;  }  .span10 {    width: 970px;  }  .span9 {    width: 870px;  }  .span8 {    width: 770px;  }  .span7 {    width: 670px;  }  .span6 {    width: 570px;  }  .span5 {    width: 470px;  }  .span4 {    width: 370px;  }  .span3 {    width: 270px;  }  .span2 {    width: 170px;  }  .span1 {    width: 70px;  }  .offset12 {    margin-left: 1230px;  }  .offset11 {    margin-left: 1130px;  }  .offset10 {    margin-left: 1030px;  }  .offset9 {    margin-left: 930px;  }  .offset8 {    margin-left: 830px;  }  .offset7 {    margin-left: 730px;  }  .offset6 {    margin-left: 630px;  }  .offset5 {    margin-left: 530px;  }  .offset4 {    margin-left: 430px;  }  .offset3 {    margin-left: 330px;  }  .offset2 {    margin-left: 230px;  }  .offset1 {    margin-left: 130px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.564102564%;    *margin-left: 2.510911074638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 100%;    *width: 99.94680851063829%;  }  .row-fluid .span11 {    width: 91.45299145300001%;    *width: 91.3997999636383%;  }  .row-fluid .span10 {    width: 82.905982906%;    *width: 82.8527914166383%;  }  .row-fluid .span9 {    width: 74.358974359%;    *width: 74.30578286963829%;  }  .row-fluid .span8 {    width: 65.81196581200001%;    *width: 65.7587743226383%;  }  .row-fluid .span7 {    width: 57.264957265%;    *width: 57.2117657756383%;  }  .row-fluid .span6 {    width: 48.717948718%;    *width: 48.6647572286383%;  }  .row-fluid .span5 {    width: 40.170940171000005%;    *width: 40.117748681638304%;  }  .row-fluid .span4 {    width: 31.623931624%;    *width: 31.5707401346383%;  }  .row-fluid .span3 {    width: 23.076923077%;    *width: 23.0237315876383%;  }  .row-fluid .span2 {    width: 14.529914530000001%;    *width: 14.4767230406383%;  }  .row-fluid .span1 {    width: 5.982905983%;    *width: 5.929714493638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 1160px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 1060px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 960px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 860px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 760px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 660px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 560px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 460px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 360px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 260px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 160px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 60px;  }  .thumbnails {    margin-left: -30px;  }  .thumbnails > li {    margin-left: 30px;  }  .row-fluid .thumbnails {    margin-left: 0;  }}@media (max-width: 979px) {  body {    padding-top: 0;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    position: static;  }  .navbar-fixed-top {    margin-bottom: 18px;  }  .navbar-fixed-bottom {    margin-top: 18px;  }  .navbar-fixed-top .navbar-inner,  .navbar-fixed-bottom .navbar-inner {    padding: 5px;  }  .navbar .container {    width: auto;    padding: 0;  }  .navbar .brand {    padding-left: 10px;    padding-right: 10px;    margin: 0 0 0 -5px;  }  .nav-collapse {    clear: both;  }  .nav-collapse .nav {    float: none;    margin: 0 0 9px;  }  .nav-collapse .nav > li {    float: none;  }  .nav-collapse .nav > li > a {    margin-bottom: 2px;  }  .nav-collapse .nav > .divider-vertical {    display: none;  }  .nav-collapse .nav .nav-header {    color: #999999;    text-shadow: none;  }  .nav-collapse .nav > li > a,  .nav-collapse .dropdown-menu a {    padding: 6px 15px;    font-weight: bold;    color: #999999;    -webkit-border-radius: 3px;    -moz-border-radius: 3px;    border-radius: 3px;  }  .nav-collapse .btn {    padding: 4px 10px 4px;    font-weight: normal;    -webkit-border-radius: 4px;    -moz-border-radius: 4px;    border-radius: 4px;  }  .nav-collapse .dropdown-menu li + li a {    margin-bottom: 2px;  }  .nav-collapse .nav > li > a:hover,  .nav-collapse .dropdown-menu a:hover {    background-color: #222222;  }  .nav-collapse.in .btn-group {    margin-top: 5px;    padding: 0;  }  .nav-collapse .dropdown-menu {    position: static;    top: auto;    left: auto;    float: none;    display: block;    max-width: none;    margin: 0 15px;    padding: 0;    background-color: transparent;    border: none;    -webkit-border-radius: 0;    -moz-border-radius: 0;    border-radius: 0;    -webkit-box-shadow: none;    -moz-box-shadow: none;    box-shadow: none;  }  .nav-collapse .dropdown-menu:before,  .nav-collapse .dropdown-menu:after {    display: none;  }  .nav-collapse .dropdown-menu .divider {    display: none;  }  .nav-collapse .navbar-form,  .nav-collapse .navbar-search {    float: none;    padding: 9px 15px;    margin: 9px 0;    border-top: 1px solid #222222;    border-bottom: 1px solid #222222;    -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);  }  .navbar .nav-collapse .nav.pull-right {    float: none;    margin-left: 0;  }  .nav-collapse,  .nav-collapse.collapse {    overflow: hidden;    height: 0;  }  .navbar .btn-navbar {    display: block;  }  .navbar-static .navbar-inner {    padding-left: 10px;    padding-right: 10px;  }}@media (min-width: 980px) {  .nav-collapse.collapse {    height: auto !important;    overflow: visible !important;  }}

    Read the article

  • Jquery Accordion : set action to a specific element inside header

    - by J.Tay
    by default, if we have something like this as a Header in jQuery Accordion : <h3> <div class="1">TEXT</div> <div class="2">ICON</div> <div class="3">BUTTON</div> </h3> by clicking anywhere on this , accordion works and toggle the next element and ... the question is , how can we set an option and select a specific element ( like: 'div' with class '1' ) to click on it to and toggle the accordion. i mean i don't want the whole Header remain click able. i just want to click on a icon or div o something inside the header and toggle open/close the accordion. thank you Update 1 : HTML : <div id="testAcc"> <h3> <div class="one">Text</div> <div class="two">Icon</div> <div class="three">Button</div> </h3> <div class="accBody"> text text text text text text text text text text </div> <h3> <div class="one">Text</div> <div class="two">Icon</div> <div class="three">Button</div> </h3> <div class="accBody"> text text text text text text text text text text </div> </div> JS : $('#testAcc').accordion({ autoHeight: false, header: 'h3', collapsible: 'ture', }); this codes working fine. but i want to use something like ( header: 'h3.one' ) means i want to set a specific class and element inside the header , then if user click ONLY on that element, the accordion will open or close ...

    Read the article

  • Filter rule for SMS / text messages in exchange active sync (SMS sync)

    - by kynan
    Exchange server 2010 introduces SMS Sync (via exchange active sync), which works fine with my android device and the Samsung email app. However, all text messages are synced to my exchange inbox, which is a pain. I'd like to have them filtered to a specific folder. So far, I haven't figured out a useful filter rule for achieving that, since there seems to be no header indicating it's a text message. Has anyone managed to do that? Note that I'm not using Outlook as an email client, so I'm specifically looking for a server-side rule.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 95 96 97 98 99 100 101 102 103 104 105 106  | Next Page >