Search Results

Search found 37051 results on 1483 pages for 'string matching'.

Page 1/1483 | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • What is the difference between String and string in C#

    - by SAMIR BHOGAYTA
    string : ------ The string type represents a sequence of zero or more Unicode characters. string is an alias for String in the .NET Framework. 'string' is the intrinsic C# datatype, and is an alias for the system provided type "System.String". The C# specification states that as a matter of style the keyword ('string') is preferred over the full system type name (System.String, or String). Although string is a reference type, the equality operators (== and !=) are defined to compare the values of string objects, not references. This makes testing for string equality more intuitive. For example: String : ------ A String object is called immutable (read-only) because its value cannot be modified once it has been created. Methods that appear to modify a String object actually return a new String object that contains the modification. If it is necessary to modify the actual contents of a string-like object Difference between string & String : ---------- ------- ------ - ------ the string is usually used for declaration while String is used for accessing static string methods we can use 'string' do declare fields, properties etc that use the predefined type 'string', since the C# specification tells me this is good style. we can use 'String' to use system-defined methods, such as String.Compare etc. They are originally defined on 'System.String', not 'string'. 'string' is just an alias in this case. we can also use 'String' or 'System.Int32' when communicating with other system, especially if they are CLR-compliant. I.e. - if I get data from elsewhere, I'd deserialize it into a System.Int32 rather than an 'int', if the origin by definition was something else than a C# system.

    Read the article

  • String.Empty in strings, need some explanation if possible :)

    - by Pabuc
    Hello all, 2 days ago, there was a question related to string.LastIndexOf(String.Empty) returning the last index of string. So I thought that; a string can always contain string.empty between characters like: "testing" == "t" + String.Empty + "e" + String.Empty +"sting" + String.Empty; After this, I wanted to test if String.IndexOf(String.Empty) was returning 0 because since String.Empty can be between any char in a string, that would be what I expect it to return and I wasn't wrong. string testString = "testing"; int index = testString.LastIndexOf(string.Empty); // index is 6 index = testString.IndexOf(string.Empty); // index is 0 It actually returned 0. I started to think that if I could split a string with String.Empty, I would get at least 2 string and those would be String.Empty and rest of the string since String.IndexOf(String.Empty) returned 0 and String.LastIndexOf(String.Empty) returned length of the string.. Here is what I coded: string emptyString = string.Empty; char[] emptyStringCharArr = emptyString.ToCharArray(); string myDummyString = "abcdefg"; string[] result = myDummyString.Split(emptyStringCharArr); The problem here is, I can't obviously convert String.Empty to char[] and result in an empty string[]. I would really love to see the result of this operation and the reason behind this. So my questions are: Is there any way to split a string with String.Empty? If it is not possible but in an absolute world which it would be possible, would it return an array full of chars like [0] = "t" [1] = "e" [2] = "s" and so on or would it just return the complete string? Which would make more sense and why? Thank you for your time.

    Read the article

  • How to get full query string parameters not UrlDecoded

    - by developerit
    Introduction While developing Developer IT’s website, we came across a problem when the user search keywords containing special character like the plus ‘+’ char. We found it while looking for C++ in our search engine. The request parameter output in ASP.NET was “c “. I found it strange that it removed the ‘++’ and replaced it with a space… Analysis After a bit of Googling and Reflection, it turns out that ASP.NET calls UrlDecode on each parameters retreived by the Request(“item”) method. The Request.Params property is affected by this two since it mashes all QueryString, Forms and other collections into a single one. Workaround Finally, I solve the puzzle usign the Request.RawUrl property and parsing it with the same RegEx I use in my url re-writter. The RawUrl not affected by anything. As its name say it, it’s raw. Published on http://www.developerit.com/

    Read the article

  • Formatting a date string when the string sits inside another string

    - by sf
    Hi, I'm trying to figure out a way to format a date string that sits inside string using javascript. The string can be: "hello there From 2010-03-04 00:00:00.0 to 2010-03-31 00:00:00.0" or "stuff like 2010-03-04 20:00:00.0 and 2010-03-31 00:00:02.0 blah blah" I'd like it to end up like: "stuff like 4 March 2010 and 31 March 2010 blah blah" Does anyone have any idea as to how this could be achieved?

    Read the article

  • vb.net string concatenation string + function output + string = string + function output and no more

    - by Barfieldmv
    The following output produces a string with no closing xml tag. m_rFlight.Layout = m_rFlight.Layout + "<G3Grid:Spots>" + Me.gvwSpots.LayoutToString() + "</G3Grid:Spots>" This following code works correctly m_rFlight.Layout = m_rFlight.Layout + "<G3Grid:Spots>" + Me.gvwSpots.LayoutToString() m_rFlight.Layout = m_rFlight.Layout + "</G3Grid:Spots>" 'add closing tag What's going on here, what's the reason the first example isnt working and the second is? The gvwSpots.LayoutToString() function returns a string.

    Read the article

  • Remove accents from String .NET

    - by developerit
    Private Const ACCENT As String = “ÀÁÂÃÄÅàáâãäåÒÓÔÕÖØòóôõöøÈÉÊËèéêëÌÍÎÏìíîïÙÚÛÜùúûüÿÑñÇç” Private Const SANSACCENT As String = “AAAAAAaaaaaaOOOOOOooooooEEEEeeeeIIIIiiiiUUUUuuuuyNnCc” Public Shared Function FormatForUrl(ByVal uriBase As String) As String If String.IsNullOrEmpty(uriBase) Then Return uriBase End If ‘// Declaration de variables Dim chaine As String = uriBase.Trim.Replace(” “, “-”) chaine = chaine.Replace(” “c, “-”c) chaine = chaine.Replace(“–”, “-”) chaine = chaine.Replace(“‘”c, String.Empty) chaine = chaine.Replace(“?”c, String.Empty) chaine = chaine.Replace(“#”c, String.Empty) chaine = chaine.Replace(“:”c, String.Empty) chaine = chaine.Replace(“;”c, String.Empty) ‘// Conversion des chaines en tableaux de caractŠres Dim tableauSansAccent As Char() = SANSACCENT.ToCharArray Dim tableauAccent As Char() = ACCENT.ToCharArray ‘// Pour chaque accent For i As Integer = 0 To ACCENT.Length – 1 ‘ // Remplacement de l’accent par son ‚quivalent sans accent dans la chaŒne de caractŠres chaine = chaine.Replace(tableauAccent(i).ToString(), tableauSansAccent(i).ToString()) Next ‘// Retour du resultat Return chaine End Function

    Read the article

  • What causes exception in string.concat

    - by Budda
    Here are few classes: public class MyItem : ParamOut { public string Code { get { return _quoteCode; } } public InnerItem[] Skus { get { return _skus; } } public PriceSummary Price { get { return _price; } } public override string ToString() { return string.Concat("Code=", Code, "; SKUs=[", Skus != null ? "{" + string.Join("},{", Array.ConvertAll(Skus, item => item.ToString())) + "}" : "", "]" , "; Price={", Price.ToString(), "}", base.ToString() ); } ... } public abstract class ParamOut { public override string ToString() { return null; } public string ErrorMessage { get; set; } } Here is calling functionality: { MyItem item = new MyItem{ ErrorMessage = "Bla-bla-bla" }; string text = item.ToString(); } I am getting NullReference exception inside of 'ToString()' method (each property of item variable is null). Question: Q1. what overload of string.Concat will be called in this case? I have 9 parameters, so I guess one of the following: public static string Concat(params Object[] args) or public static string Concat(params string[] values) But which of them? Q2. Why exception is generated? Shouldn't 'null' be converted into something like 'null' or "" (empty string)? Thanks a lot!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Using String+string+string vs using string.replace

    - by Madi D.
    A colleague told me that using the following method: string url = "SomeURL"; string ext = "SomeExt"; string sub = "SomeSub"; string subSub = "moreSub"; string Url = @"http://www." + Url +@"/"+ ext +@"/"+ sub + subSub; is not efficenet (takes more resources) and it is preferred to use the following method: string Url = @"http://www.#URL.#EXT/#sub/#subSub"; string url = "SomeURL"; string ext = "SomeExt"; string sub = "SomeSub"; string subSub = "moreSub"; Url.Replace("#URL",url) Url.Replace("#EXT",ext); Url.Replace("#sub",sub); Url.Replace("#subSub",subSub); Is that true? and what is the explanation behind it?

    Read the article

  • String concatenation: Final string value does not equal to the latest value

    - by Pan Pizza
    I have a simple question about string concatenation. Following is the code. I want to ask why s6 = "abcde" and not "akcde"? I have change the s2 value to "k". Public Class Form1 Public s1 As String = "a" Public s2 As String = "b" Public s3 As String = "c" Public s4 As String = "d" Public s5 As String = "e" Public s6 As String = "" Public s7 As String = "k" Private Sub Button2_Click(sender As System.Object, e As System.EventArgs) Handles Button2.Click s6 = s1 & s2 & s3 & s4 & s5 s2 = s7 MessageBox.Show(s6) 's6 = abcde End Sub End Class

    Read the article

  • A couple of pattern matching issues with pattern matching in Lua

    - by Josh
    I'm fairly new to lua programming, but I'm also a quick study. I've been working on a weather forecaster for a program that I use, and it's working well, for the most part. Here is what I have so far. (Pay no attention to the zs.stuff. That is program specific and has no bearing on the lua coding.) if not http then http = require("socket.http") end local locale = string.gsub(zs.params(1),"%s+","%%20") local page = http.request("http://www.wunderground.com/cgi-bin/findweather/getForecast?query=" .. locale .. "&wuSelect=WEATHER") local location = string.match(page,'title="([%w%s,]+) RSS"') --print("Gathering weather information for " .. location .. ".") --local windspeed = string.match(page,'<span class="nobr"><span class="b">([%d.]+)</span>&nbsp;mph</span>') --print(windspeed) local condition = string.match(page, '<td class="vaM taC"><img src="http://icons-ecast.wxug.com/i/c/a/[%w_]+.gif" width="42" height="42" alt="[%w%s]+" class="condIcon" />') --local image = string.match(page, '<img src="http://icons-ecast.wxug.com/i/c/a/(.+).gif" width="42" height="42" alt="[%w%s]+" class="condIcon" />') local temperature = string.match(page,'pwsvariable="tempf" english="&deg;F" metric="&deg;C" value="([%d.]+)">') local humidity = string.match(page,'pwsvariable="humidity" english="" metric="" value="(%d+)"') zs.say(location) --zs.say("image ./Images/" .. image .. ".gif") zs.say("<color limegreen>Condition:</color> <color white>" .. condition .. "</color>") zs.say("<color limegreen>Temperature: </color><color white>" .. temperature .. "F</color>") zs.say("<color limegreen>Humidity: </color><color white>" .. humidity .. "%</color>") My main issue is this: I changed the 'condition' and added the 'image' variables to what they are now. Even though the line it's supposed to be matching comes directly from the webpage, it fails to match at all. So I'm wondering what it is I'm missing that's preventing this code from working. If I take out the <td class="vaM taC">< img src="http://icons-ecast.wxug.com/i/c/a/[%w_]+.gif" it'll match condition flawlessly. (For whatever reason, I can't get the above line to display correctly, but there is no space between the `< and img) Can anyone point out what is wrong with it? Aside from the pattern matching, I assure you the line is verbatim from the webpage. Another question I had is the ability to match across line breaks. Is there any possible way to do this? The reason why I ask is because on that same page, a few of the things I need to match are broken up on separate lines, and since the actual pattern I'm wanting to match shows up in other places on the page, I need to be able to match across line breaks to get the exact pattern. I appreciate any help in this matter!

    Read the article

  • Read array dump output and generates the correspondent XML file

    - by Christian
    Hi, The text below is the dump of a multidimensional array, dumped by the var_dump() PHP function. I need a Java function that reads a file with a content like this (attached) and returns it in XML. For a reference, in site http://pear.php.net/package/Var_Dump/ you can find the code (in PHP) that generates dumps in XML, so all neeeded logic is there (I think). I will be waiting for your feedback. Regards, Christian array(1) { ["Processo"]= array(60) { ["Sistema"]= string(6) "E-PROC" ["UF"]= string(2) "RS" ["DataConsulta"]= string(19) "11/05/2010 17:59:17" ["Processo"]= string(20) "50000135320104047100" ["NumRegistJudici"]= string(20) "50000135320104047100" ["IdProcesso"]= string(30) "711262958983115560390000000001" ["SeqProcesso"]= string(1) "1" ["Autuado"]= string(19) "08/01/2010 12:04:47" ["StatusProcesso"]= string(1) "M" ["ComSituacaoProcesso"]= string(2) "00" ["Situacao"]= string(9) "MOVIMENTO" ["IdClasseJudicial"]= string(10) "0000000112" ["DesClasse"]= string(18) "INQUÉRITO POLICIAL" ["CodClasse"]= string(6) "000120" ["SigClasse"]= string(3) "INQ" ["DesTipoInquerito"]= string(0) "" ["CodCompetencia"]= string(2) "21" ["IdLocalidadeJudicial"]= string(4) "7150" ["ClasseSigAutor"]= string(5) "AUTOR" ["ClasseDesAutor"]= string(5) "AUTOR" ["ClasseSigReu"]= string(7) "INDICDO" ["ClasseDesReu"]= string(9) "INDICIADO" ["ClasseCodReu"]= string(2) "64" ["TipoAcao"]= string(8) "Criminal" ["TipoProcessoJudicial"]= string(1) "2" ["CodAssuntoPrincipal"]= string(6) "051801" ["CodLocalidadeJudicial"]= string(2) "00" ["IdAssuntoPrincipal"]= string(4) "1504" ["IdLocalizadorOrgaoPrincipal"]= string(30) "711264420823128430420000000001" ["ChaveConsulta"]= string(12) "513009403710" ["NumAdministrativo"]= NULL ["Magistrado"]= string(28) "RICARDO HUMBERTO SILVA BORNE" ["IdOrgaoJuizo"]= string(9) "710000085" ["IdOrgaoJuizoOriginario"]= string(9) "710000085" ["DesOrgaoJuizo"]= string(45) "JUÍZO FED. DA 02A VF CRIMINAL DE PORTO ALEGRE" ["SigOrgaoJuizo"]= string(10) "RSPOACR02F" ["CodOrgaoJuizo"]= string(9) "RS0000085" ["IdOrgaoSecretaria"]= string(9) "710000084" ["DesOrgaoSecretaria"]= string(31) "02a VF CRIMINAL DE PORTO ALEGRE" ["SigOrgaoSecretaria"]= string(9) "RSPOACR02" ["CodOrgaoSecretaria"]= string(9) "RS0000084" ["IdSigilo"]= string(1) "0" ["IdUsuario"]= string(30) "711262951173995330420000000001" ["DesSigilo"]= string(10) "Sem Sigilo" ["Localizador"]= string(25) "EM TRÂMITE ENTRE PF E MPF" ["TotalCda"]= int(0) ["DesIpl"]= string(8) "012/2010" ["Assunto"]= array(1) { [0]= array(4) { ["IdAssuntoJudicial"]= string(4) "1504" ["SeqAssunto"]= string(1) "1" ["CodAssunto"]= string(6) "051801" ["DesAssunto"]= string(84) "Moeda Falsa / Assimilados (arts. 289 e parágrafos e 290), Crimes contra a Fé Pública" } } ["ParteAutor"]= array(1) { [0]= array(12) { ["IdPessoa"]= string(30) "771230778800100040000000000508" ["TipoPessoa"]= string(3) "ENT" ["Nome"]= string(15) "POLÍCIA FEDERAL" ["Identificacao"]= string(14) "79621439000191" ["SinPartePrincipal"]= string(1) "S" ["IdProcessoParte"]= string(30) "711262958983115560390000000002" ["IdProcessoParteAtributo"]= NULL ["IdRepresentacao"]= NULL ["TipoRepresentacao"]= NULL ["AtributosProcessoParte"]= NULL ["Relacao"]= NULL ["Procurador"]= array(6) { [0]= array(4) { ["Nome"]= string(25) "SOLON RAMOS CARDOSO FILHO" ["Sigla"]= string(13) "cor-sr-dpf-rs" ["IdUsuarioProcurador"]= string(30) "711262893271855450420000000001" ["TipoUsuario"]= string(3) "CPF" } [1]= array(4) { ["Nome"]= string(18) "LUCIANA IOP CECHIN" ["Sigla"]= string(11) "luciana.lic" ["IdUsuarioProcurador"]= string(30) "711262946806708880420000000001" ["TipoUsuario"]= string(3) "CPF" } [2]= array(4) { ["Nome"]= string(31) "ALEXANDRE DA SILVEIRA ISBARROLA" ["Sigla"]= string(15) "drcor-sr-dpf-rs" ["IdUsuarioProcurador"]= string(30) "711262949451860560420000000001" ["TipoUsuario"]= string(3) "CPF" } [3]= array(4) { ["Nome"]= string(24) "JUCÉLIA TERESINHA PISONI" ["Sigla"]= string(11) "jucelia.jtp" ["IdUsuarioProcurador"]= string(30) "711262950492275450420000000001" ["TipoUsuario"]= string(3) "CPF" } [4]= array(4) { ["Nome"]= string(32) "MARCOS ANTONIO SIQUEIRA PICININI" ["Sigla"]= string(13) "picinini.masp" ["IdUsuarioProcurador"]= string(30) "711262951173995330420000000001" ["TipoUsuario"]= string(3) "APF" } [5]= array(4) { ["Nome"]= string(20) "PRISCILLA BURLACENKO" ["Sigla"]= string(12) "priscilla.pb" ["IdUsuarioProcurador"]= string(30) "711262955631630740420000000001" ["TipoUsuario"]= string(3) "DPF" } } } } ["ParteReu"]= array(1) { [0]= array(11) { ["IdPessoa"]= string(30) "711262958983115560390000000001" ["TipoPessoa"]= string(2) "PF" ["Nome"]= string(8) "A APURAR" ["Identificacao"]= NULL ["SinPartePrincipal"]= string(1) "S" ["IdProcessoParte"]= string(30) "711262958983115560390000000001" ["IdProcessoParteAtributo"]= NULL ["IdRepresentacao"]= NULL ["TipoRepresentacao"]= NULL ["AtributosProcessoParte"]= NULL ["Relacao"]= NULL } } ["OutraParte"]= array(1) { [0]= array(10) { ["Nome"]= string(26) "MINISTÉRIO PÚBLICO FEDERAL" ["CodTipoParte"]= string(3) "114" ["DesTipoParte"]= string(3) "MPF" ["SinPolo"]= string(1) "N" ["Identificacao"]= string(13) "3636198000192" ["SinPartePrincipal"]= string(1) "N" ["IdProcessoParte"]= string(30) "711262958983115560390000000003" ["IdPessoa"]= string(30) "771230778800100040000000000217" ["TipoPessoa"]= string(3) "ENT" ["Procurador"]= array(1) { [0]= array(4) { ["Nome"]= string(25) "MARIA VALESCA DE MESQUITA" ["IdUsuarioProcurador"]= string(30) "711265220162198740420000000001" ["TipoUsuario"]= string(1) "P" ["Sigla"]= string(5) "pr528" } } } } ["DadoComplementar"]= array(6) { [0]= array(5) { ["DesDadoComplem"]= string(21) "Antecipação de Tutela" ["ValorDadoComplem"]= string(13) "Não Requerida" ["IdDadoComplementar"]= string(1) "1" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000003" ["IdDadoComplementarValor"]= string(1) "4" } [1]= array(5) { ["DesDadoComplem"]= string(16) "Justiça Gratuita" ["ValorDadoComplem"]= string(13) "Não Requerida" ["IdDadoComplementar"]= string(1) "4" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000001" ["IdDadoComplementarValor"]= string(1) "3" } [2]= array(5) { ["DesDadoComplem"]= string(15) "Petição Urgente" ["ValorDadoComplem"]= string(3) "Não" ["IdDadoComplementar"]= string(1) "5" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000004" ["IdDadoComplementarValor"]= string(1) "2" } [3]= array(5) { ["DesDadoComplem"]= string(22) "Prioridade Atendimento" ["ValorDadoComplem"]= string(3) "Não" ["IdDadoComplementar"]= string(1) "2" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000006" ["IdDadoComplementarValor"]= string(1) "2" } [4]= array(5) { ["DesDadoComplem"]= string(9) "Réu Preso" ["ValorDadoComplem"]= string(3) "Não" ["IdDadoComplementar"]= string(1) "6" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000002" ["IdDadoComplementarValor"]= string(1) "2" } [5]= array(5) { ["DesDadoComplem"]= string(24) "Vista Ministério Público" ["ValorDadoComplem"]= string(3) "Sim" ["IdDadoComplementar"]= string(1) "3" ["NumIdProcessoDadoComplem"]= string(30) "711262958983115560390000000005" ["IdDadoComplementarValor"]= string(1) "1" } } ["SemPrazoAbrir"]= bool(true) ["Evento"]= array(8) { [0]= array(18) { ["IdProcessoEvento"]= string(30) "711269271039215440420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(3) "166" ["SeqEvento"]= string(1) "8" ["DataHora"]= string(19) "22/03/2010 12:19:16" ["SinExibeDesEvento"]= string(1) "S" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= string(7) "90 DIAS" ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(37) "PETIÇÃO PROTOCOLADA JUNTADA - 90 DIAS" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(7) "ap18785" ["idUsuario"]= string(30) "711263330517182580420000000001" ["DesPeticao"]= string(25) "DILAÇÃO DE PRAZO DEFERIDA" ["DescricaoCompleta"]= string(75) "PETIÇÃO PROTOCOLADA JUNTADA - 90 DIAS - DILAÇÃO DE PRAZO DEFERIDA - 90 DIAS" } [1]= array(18) { ["IdProcessoEvento"]= string(30) "711269032501923580420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(3) "166" ["SeqEvento"]= string(1) "7" ["DataHora"]= string(19) "19/03/2010 18:04:59" ["SinExibeDesEvento"]= string(1) "S" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= string(7) "90 DIAS" ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(37) "PETIÇÃO PROTOCOLADA JUNTADA - 90 DIAS" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(5) "pr700" ["idUsuario"]= string(30) "711262976146980920420000000002" ["DesPeticao"]= string(25) "DILAÇÃO DE PRAZO DEFERIDA" ["DescricaoCompleta"]= string(75) "PETIÇÃO PROTOCOLADA JUNTADA - 90 DIAS - DILAÇÃO DE PRAZO DEFERIDA - 90 DIAS" } [2]= array(19) { ["IdProcessoEvento"]= string(30) "711268077089625240420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(3) "165" ["SeqEvento"]= string(1) "6" ["DataHora"]= string(19) "08/03/2010 16:55:48" ["SinExibeDesEvento"]= string(1) "N" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(13) "picinini.masp" ["idUsuario"]= string(30) "711262951173995330420000000001" ["Documento"]= array(2) { [0]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711268077089625240420000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(4) "CERT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [1]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711268077089625240420000000002" ["SeqDocumento"]= string(1) "2" ["SigTipoDocumento"]= string(4) "DESP" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(26) "PEDIDO DE DILAÇÃO DE PRAZO" ["DescricaoCompleta"]= string(26) "PEDIDO DE DILAÇÃO DE PRAZO" } [3]= array(19) { ["IdProcessoEvento"]= string(30) "711267732906972600420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(2) "52" ["SeqEvento"]= string(1) "5" ["DataHora"]= string(19) "04/03/2010 17:20:29" ["SinExibeDesEvento"]= string(1) "N" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(5) "pr700" ["idUsuario"]= string(30) "711262976146980920420000000002" ["Documento"]= array(1) { [0]= array(6) { ["IdUsuario"]= string(30) "711262976146980920420000000002" ["IdDocumento"]= string(30) "711267732906972600420000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(3) "PET" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(7) "PETIÇÃO" ["DescricaoCompleta"]= string(7) "PETIÇÃO" } [4]= array(19) { ["IdProcessoEvento"]= string(30) "711265889365256290420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(3) "165" ["SeqEvento"]= string(1) "4" ["DataHora"]= string(19) "11/02/2010 09:59:04" ["SinExibeDesEvento"]= string(1) "N" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(13) "picinini.masp" ["idUsuario"]= string(30) "711262951173995330420000000001" ["Documento"]= array(2) { [0]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711265222866995860420000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(4) "PORT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [1]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711265222866995860420000000002" ["SeqDocumento"]= string(1) "2" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(26) "PEDIDO DE DILAÇÃO DE PRAZO" ["DescricaoCompleta"]= string(26) "PEDIDO DE DILAÇÃO DE PRAZO" } [5]= array(19) { ["IdProcessoEvento"]= string(30) "711263991150788270420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(2) "52" ["SeqEvento"]= string(1) "3" ["DataHora"]= string(19) "20/01/2010 10:50:05" ["SinExibeDesEvento"]= string(1) "N" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(13) "picinini.masp" ["idUsuario"]= string(30) "711262951173995330420000000001" ["Documento"]= array(4) { [0]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263991150788270420000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(4) "DECL" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [1]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263991150788270420000000002" ["SeqDocumento"]= string(1) "2" ["SigTipoDocumento"]= string(4) "DECL" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [2]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263991150788270420000000003" ["SeqDocumento"]= string(1) "3" ["SigTipoDocumento"]= string(4) "DECL" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [3]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263991150788270420000000004" ["SeqDocumento"]= string(1) "4" ["SigTipoDocumento"]= string(4) "DECL" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(7) "PETIÇÃO" ["DescricaoCompleta"]= string(7) "PETIÇÃO" } [6]= array(19) { ["IdProcessoEvento"]= string(30) "711263955058688620420000000001" ["IdEvento"]= string(3) "228" ["IdTipoPeticaoJudicial"]= string(2) "52" ["SeqEvento"]= string(1) "2" ["DataHora"]= string(19) "20/01/2010 00:40:39" ["SinExibeDesEvento"]= string(1) "N" ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "4" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["CodEvento"]= string(10) "0000000852" ["DesEvento"]= string(27) "PETIÇÃO PROTOCOLADA JUNTADA" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(13) "picinini.masp" ["idUsuario"]= string(30) "711262951173995330420000000001" ["Documento"]= array(6) { [0]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [1]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000002" ["SeqDocumento"]= string(1) "2" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [2]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000003" ["SeqDocumento"]= string(1) "3" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [3]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000004" ["SeqDocumento"]= string(1) "4" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [4]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000005" ["SeqDocumento"]= string(1) "5" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [5]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711263229632249660420000000006" ["SeqDocumento"]= string(1) "6" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(7) "PETIÇÃO" ["DescricaoCompleta"]= string(7) "PETIÇÃO" } [7]= array(19) { ["IdProcessoEvento"]= string(30) "711262958983115560390000000001" ["IdEvento"]= string(3) "430" ["IdTipoPeticaoJudicial"]= NULL ["SeqEvento"]= string(1) "1" ["DataHora"]= string(19) "08/01/2010 12:04:47" ["SinExibeDesEvento"]= NULL ["SinUsuarioInterno"]= string(1) "N" ["IdGrupoEvento"]= string(1) "0" ["SinVisualizaDocumentoExterno"]= string(1) "N" ["Complemento"]= NULL ["DesEventoSemComplemento"]= string(56) "Distribuição/Atribuição Ordinária por sorteio eletrônico" ["CodEvento"]= string(6) "030101" ["DesEvento"]= string(56) "Distribuição/Atribuição Ordinária por sorteio eletrônico" ["DesAlternativaEvento"]= NULL ["Usuario"]= string(13) "picinini.masp" ["idUsuario"]= string(30) "711262951173995330420000000001" ["Documento"]= array(4) { [0]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711262956008922510390000000001" ["SeqDocumento"]= string(1) "1" ["SigTipoDocumento"]= string(4) "PORT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [1]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711262956008922510390000000002" ["SeqDocumento"]= string(1) "2" ["SigTipoDocumento"]= string(4) "OFIC" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [2]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711262956008922510390000000003" ["SeqDocumento"]= string(1) "3" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } [3]= array(6) { ["IdUsuario"]= string(30) "711262951173995330420000000001" ["IdDocumento"]= string(30) "711262956008922510390000000004" ["SeqDocumento"]= string(1) "4" ["SigTipoDocumento"]= string(3) "OUT" ["IdSigilo"]= string(1) "0" ["DesSigilo"]= string(10) "Sem Sigilo" } } ["DesPeticao"]= string(56) "Distribuição/Atribuição Ordinária por sorteio eletrônico" ["DescricaoCompleta"]= string(56) "Distribuição/Atribuição Ordinária por sorteio eletrônico" } } ["ValCausa"]= string(4) "0.00" ["OrgaoJul"]= string(45) "JUÍZO FED. DA 02A VF CRIMINAL DE PORTO ALEGRE" ["CodOrgaoJul"]= string(9) "RS0000085" ["OrgaoColegiado"]= NULL ["CodOrgaoColegiado"]= NULL ["CodOrgaoColegiadoSecretaria"]= NULL } }

    Read the article

  • String Manipultation - Get String between two other Strings?

    - by Ben
    I have a large piece of text in which there is something simular to this: !#_KT_#!COMMANDHERE!#_KT_#! I want, in VB.Net, to get the 'COMMANDHERE' part of the string, how would I go about doing this? I have this so far: Dim temp As String = WebBrowser1.Document.Body.ToString Dim startIndex As Integer = temp.IndexOf("!#__KT__#!") + 1 Dim endIndex As Integer = temp.IndexOf("!#__KT__#!", startIndex) Dim extraction As String = temp.Substring(startIndex, endIndex - startIndex).Trim TextBox1.Text = extraction However this only removes the LAST string eg: #_KT_#! COMMAND. Any help is appreciated!

    Read the article

  • sample java code for approximate string matching or boyer-moore extended for approximate string matc

    - by Dolphin
    Hi I need to find 1.mismatch(incorrectly played notes), 2.insertion(additional played), & 3.deletion (missed notes), in a music piece (e.g. note pitches [string values] stored in a table) against a reference music piece. This is either possible through exact string matching algorithms or dynamic programming/ approximate string matching algos. However I realised that approximate string matching is more appropriate for my problem due to identifying mismatch, insertion, deletion of notes. Or an extended version of Boyer-moore to support approx. string matching. Is there any link for sample java code I can try out approximate string matching? I find complex explanations and equations - but I hope I could do well with some sample code and simple explanations. Or can I find any sample java code on boyer-moore extended for approx. string matching? I understand the boyer-moore concept, but having troubles with adjusting it to support approx. string matching (i.e. to support mismatch, insertion, deletion). Also what is the most efficient approx. string matching algorithm (like boyer-moore in exact string matching algo)? Greatly appreciate any insight/ suggestions. Many thanks in advance

    Read the article

  • C - check if string is a substring of another string

    - by user69514
    I need to write a program that takes two strings as arguments and check if the second one is a substring of the first one. I need to do it without using any special library functions. I created this implementation, but I think it's always returning true as long as there is one letter that's the same in both strings. Can you help me out here. I'm not sure what I am doing wrong: #include <stdio.h> #include <string.h> int my_strstr( char const *s, char const *sub ) { char const *ret = sub; int r = 0; while ( ret = strchr( ret, *sub ) ) { if ( strcmp( ++ret, sub+1 ) == 0 ){ r = 1; } else{ r = 0; } } return r; } int main(int argc, char **argv){ if (argc != 3) { printf ("Usage: check <string one> <string two>\n"); } int result = my_strstr(argv[1], argv[2]); if(result == 1){ printf("%s is a substring of %s\n", argv[2], argv[1]); } else{ printf("%s is not a substring of %s\n", argv[2], argv[1]); } return 0; }

    Read the article

  • PHP string manipulation, inside the string

    - by James
    I have string: ABCDEFGHIJK And I have two arrays of positions in that string that I want to insert different things to. Array ( [0] => 0 [1] => 5 ) Array ( [0] => 7 [1] => 9 ) Which if I decided to add the # character and the = character, it'd produce: #ABCDE=FG#HI=JK Is there any way I can do this without a complicated set of substr? Also, # and = need to be variables that can be of any length, not just one character.

    Read the article

  • EXCEL 2010 Check if sub string value in cell match with other string from range of cells

    - by gotqn
    I am stuck with this one from hours. I have range with cells with string values: A1 text1 A2 text2 An text3 And other column with other string values like: B1 text1sampletext B2 text2sampletext B3 text3sampletext B4 text1sampletext B5 text1sampletext I have to check if text in column A is sub string of text in column B. If it is, to set in column C the text from column A. Like this: B1 text1sampletext - C1 text1 B2 text2sampletext - C1 text2 B3 text3sampletext - C1 text3 B4 text1sampletext - C1 text1 B5 text1sampletext - C1 text1

    Read the article

  • Algorithm for multiple word matching in a text, count the number of every matched word

    - by 66
    I have noticed that it has solutions for matching multiple words in a given text, such as below: http://stackoverflow.com/questions/1099985/algorithm-for-multiple-word-matching-in-text If I want to know exactly the number of appearances of each matched word in the text, my solution is like this: step 1: using ac-algorithm to obtain the maching words; step 2: count the number of each word obtained in step 1 is there a faster way? Thx~

    Read the article

  • C string question

    - by user208454
    I am writing a simple c program which reverses a string, taking the string from argv[1]. Here is the code: #include <stdio.h> #include <stdlib.h> #include <string.h> char* flip_string(char *string){ int i = strlen(string); int j = 0; // Doesn't really matter all I wanted was the same size string for temp. char* temp = string; puts("This is the original string"); puts(string); puts("This is the \"temp\" string"); puts(temp); for(i; i>=0; i--){ temp[j] = string[i] if (j <= strlen(string)) { j++; } } return(temp); } int main(int argc, char *argv[]){ puts(flip_string(argv[1])); printf("This is the end of the program\n"); } That's basically it, the program compiles and everything but does not return the temp string in the end (just blank space). In the beginning it prints temp fine when its equal to string. Furthermore if I do a character by character printf of temp in the for loop the correct temp string in printed i.e. string - reversed. just when I try to print it to standard out (after the for loop/ or in the main) nothing happens only blank space is printed.

    Read the article

  • XSLT fails to load huge XML doc after matching certain elements

    - by krisvandenbergh
    I'm trying to match certain elements using XSLT. My input document is very large and the source XML fails to load after processing the following code (consider especially the first line). <xsl:template match="XMI/XMI.content/Model_Management.Model/Foundation.Core.Namespace.ownedElement/Model_Management.Package/Foundation.Core.Namespace.ownedElement"> <rdf:RDF> <rdf:Description rdf:about=""> <xsl:for-each select="Foundation.Core.Class"> <xsl:for-each select="Foundation.Core.ModelElement.name"> <owl:Class rdf:ID="@Foundation.Core.ModelElement.name" /> </xsl:for-each> </xsl:for-each> </rdf:Description> </rdf:RDF> </xsl:template> Apparently the XSLT fails to load after "Model_Management.Model". The PHP code is as follows: if ($xml->loadXML($source_xml) == false) { die('Failed to load source XML: ' . $http_file); } It then fails to perform loadXML and immediately dies. I think there are two options now. 1) I should set a maximum executing time. Frankly, I don't know how that I do this for the built-in PHP 5 XSLT processor. 2) Think about another way to match. What would be the best way to deal with this? The input document can be found at http://krisvandenbergh.be/uml_pricing.xml Any help would be appreciated! Thanks.

    Read the article

  • Segfault when iterating over a map<string, string> and drawing its contents using SDL_TTF

    - by Michael Stahre
    I'm not entirely sure this question belongs on gamedev.stackexchange, but I'm technically working on a game and working with SDL, so it might not be entirely offtopic. I've written a class called DebugText. The point of the class is to have a nice way of printing values of variables to the game screen. The idea is to call SetDebugText() with the variables in question every time they change or, as is currently the case, every time the game's Update() is called. The issue is that when iterating over the map that contains my variables and their latest updated values, I get segfaults. See the comments in DrawDebugText() below, it specifies where the error happens. I've tried splitting the calls to it-first and it-second into separate lines and found that the problem doesn't always happen when calling it-first. It alters between it-first and it-second. I can't find a pattern. It doesn't fail on every call to DrawDebugText() either. It might fail on the third time DrawDebugText() is called, or it might fail on the fourth. Class header: #ifndef CLIENT_DEBUGTEXT_H #define CLIENT_DEBUGTEXT_H #include <Map> #include <Math.h> #include <sstream> #include <SDL.h> #include <SDL_ttf.h> #include "vector2.h" using std::string; using std::stringstream; using std::map; using std::pair; using game::Vector2; namespace game { class DebugText { private: TTF_Font* debug_text_font; map<string, string>* debug_text_list; public: void SetDebugText(string var, bool value); void SetDebugText(string var, float value); void SetDebugText(string var, int value); void SetDebugText(string var, Vector2 value); void SetDebugText(string var, string value); int DrawDebugText(SDL_Surface*, SDL_Rect*); void InitDebugText(); void Clear(); }; } #endif Class source file: #include "debugtext.h" namespace game { // Copypasta function for handling the toString conversion template <class T> inline string to_string (const T& t) { stringstream ss (stringstream::in | stringstream::out); ss << t; return ss.str(); } // Initializes SDL_TTF and sets its font void DebugText::InitDebugText() { if(TTF_WasInit()) TTF_Quit(); TTF_Init(); debug_text_font = TTF_OpenFont("LiberationSans-Regular.ttf", 16); TTF_SetFontStyle(debug_text_font, TTF_STYLE_NORMAL); } // Iterates over the current debug_text_list and draws every element on the screen. // After drawing with SDL you need to get a rect specifying the area on the screen that was changed and tell SDL that this part of the screen needs to be updated. this is done in the game's Draw() function // This function sets rects_to_update to the new list of rects provided by all of the surfaces and returns the number of rects in the list. These two parameters are used in Draw() when calling on SDL_UpdateRects(), which takes an SDL_Rect* and a list length int DebugText::DrawDebugText(SDL_Surface* screen, SDL_Rect* rects_to_update) { if(debug_text_list == NULL) return 0; if(!TTF_WasInit()) InitDebugText(); rects_to_update = NULL; // Specifying the font color SDL_Color font_color = {0xff, 0x00, 0x00, 0x00}; // r, g, b, unused int row_count = 0; string line; // The iterator variable map<string, string>::iterator it; // Gets the iterator and iterates over it for(it = debug_text_list->begin(); it != debug_text_list->end(); it++) { // Takes the first value (the name of the variable) and the second value (the value of the parameter in string form) //---------THIS LINE GIVES ME SEGFAULTS----- line = it->first + ": " + it->second; //------------------------------------------ // Creates a surface with the text on it that in turn can be rendered to the screen itself later SDL_Surface* debug_surface = TTF_RenderText_Solid(debug_text_font, line.c_str(), font_color); if(debug_surface == NULL) { // A standard check for errors fprintf(stderr, "Error: %s", TTF_GetError()); return NULL; } else { // If SDL_TTF did its job right, then we now set a destination rect row_count++; SDL_Rect dstrect = {5, 5, 0, 0}; // x, y, w, h dstrect.x = 20; dstrect.y = 20*row_count; // Draws the surface with the text on it to the screen int res = SDL_BlitSurface(debug_surface,NULL,screen,&dstrect); if(res != 0) { //Just an error check fprintf(stderr, "Error: %s", SDL_GetError()); return NULL; } // Creates a new rect to specify the area that needs to be updated with SDL_Rect* new_rect_to_update = (SDL_Rect*) malloc(sizeof(SDL_Rect)); new_rect_to_update->h = debug_surface->h; new_rect_to_update->w = debug_surface->w; new_rect_to_update->x = dstrect.x; new_rect_to_update->y = dstrect.y; // Just freeing the surface since it isn't necessary anymore SDL_FreeSurface(debug_surface); // Creates a new list of rects with room for the new rect SDL_Rect* newtemp = (SDL_Rect*) malloc(row_count*sizeof(SDL_Rect)); // Copies the data from the old list of rects to the new one memcpy(newtemp, rects_to_update, (row_count-1)*sizeof(SDL_Rect)); // Adds the new rect to the new list newtemp[row_count-1] = *new_rect_to_update; // Frees the memory used by the old list free(rects_to_update); // And finally redirects the pointer to the old list to the new list rects_to_update = newtemp; newtemp = NULL; } } // When the entire map has been iterated over, return the number of lines that were drawn, ie. the number of rects in the returned rect list return row_count; } // The SetDebugText used by all the SetDebugText overloads // Takes two strings, inserts them into the map as a pair void DebugText::SetDebugText(string var, string value) { if (debug_text_list == NULL) { debug_text_list = new map<string, string>(); } debug_text_list->erase(var); debug_text_list->insert(pair<string, string>(var, value)); } // Writes the bool to a string and calls SetDebugText(string, string) void DebugText::SetDebugText(string var, bool value) { string result; if (value) result = "True"; else result = "False"; SetDebugText(var, result); } // Does the same thing, but uses to_string() to convert the float void DebugText::SetDebugText(string var, float value) { SetDebugText(var, to_string(value)); } // Same as above, but int void DebugText::SetDebugText(string var, int value) { SetDebugText(var, to_string(value)); } // Vector2 is a struct of my own making. It contains the two float vars x and y void DebugText::SetDebugText(string var, Vector2 value) { SetDebugText(var + ".x", to_string(value.x)); SetDebugText(var + ".y", to_string(value.y)); } // Empties the list. I don't actually use this in my code. Shame on me for writing something I don't use. void DebugText::Clear() { if(debug_text_list != NULL) debug_text_list->clear(); } }

    Read the article

  • Matching unmatched strings based on a unknown pattern

    - by Polity
    Alright guys, i really hurt my brain over this one and i'm curious if you guys can give me any pointers towards the right direction i should be taking. The situation is this: Lets say, i have a collection of strings (let it be clear that the pattern of this strings is unknown. For a fact, i can say that the string contain only signs from the ASCII table and therefore, i dont have to worry about weird Chinese signs). For this example, i take the following collection of strings (note that the strings dont have to make any human sence so dont try figguring them out :)): "[001].[FOO].[TEST] - 'foofoo.test'", "[002].[FOO].[TEST] - 'foofoo.test'", "[003].[FOO].[TEST] - 'foofoo.test'", "[001].[FOO].[TEST] - 'foofoo.test.sample'", "[002].[FOO].[TEST] - 'foofoo.test.sample'", "-001- BAR.[TEST] - 'bartest.xx1", "-002- BAR.[TEST] - 'bartest.xx1" Now, what i need to have is a way of finding logical groups (and subgroups) of these set of strings, so in the above example, just by rational thinking, you can combine the first 3, the 2 after that and the last 2. Also the resulting groups from the first 5 can be combined in one main group with 2 subgroups, this should give you something like this: { { "[001].[FOO].[TEST] - 'foofoo.test'", "[002].[FOO].[TEST] - 'foofoo.test'", "[003].[FOO].[TEST] - 'foofoo.test'", } { "[001].[FOO].[TEST] - 'foofoo.test.sample'", "[002].[FOO].[TEST] - 'foofoo.test.sample'", } { "-001- BAR.[TEST] - 'bartest.xx1", "-002- BAR.[TEST] - 'bartest.xx1" } } Sorry for the layout above but indenting with 4 spaces doesnt seem to work correctly (or im frakk'n it up). Anyways, I'm not sure how to approach this problem (how to get the result desired as indicated above). First of, i thought of creating a huge set of regexes which would parse most known patterns but the amount of different patterns is just to huge that this isn't realistic. Another think i thought of was parsing each indidual word within a string (so strip all non alphabetic or numeric characters and split by those), and if X% matches, i can assume the strings belong to the same group. (where X wil probably be around 80/90). However, i find the area of speculation kinda big. For example, when matching strings with each 20 words, the change of hitting above 80% is kinda big (that means that 4 words can differ), however when matching only 8 words, 2 words at most can differ. My question to you is, what would be a logical approach in the above situation? Thanks in advance!

    Read the article

  • C# adding string elements of 4 different string arrays with each other

    - by new_coder
    Hello. I need an advice about how to create new string array from 4 different string arrays: We have 4 string arrays: string[] arr1 = new string [] {"a1","a2","a3"..., "a30"}; string[] arr2 = new string [] {"d10","d11","d12","d13","d14","d15"}; string[] arr3 = new string [] {"f1","f2","f3"...,"f20"}; string[] arr4 = new string [] {"s10","s11","s12","s13","s14"}; We need to add all string elements of all 4 arrays with each other like this: a1+d10+f1+s10 a2+d10+f1+s10 ... a1+d11+f1+s10 a2+d11+f1+s10 ... a30+d15+f20+s14 I mean all combinations in that order : arr1_element, arr2_element, arr3_element, arr4_element So the result array would be like that: string[] arr5 = new string [] {"a1d10f1s10","a2d10f1s10 "....}; Any help would be good Thank you

    Read the article

1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >