Search Results

Search found 8 results on 1 pages for 'yasmine atta hajjaj'.

Page 1/1 | 1 

  • Is there any good hosting for asp.net and MySQL

    - by HAJJAJ
    HI every one ,I have account with one of the hosting company, and i did my project in asp.net and I used MySQL for the database. the hosting company is not giving me the full privileges to create new user or to create new stored procedure!!! this is what they said for me: Due to the shared nature of our environment we had to make some modifications to your procedure (namely the definer). We also had to review your procedure to determine if it would be compatible with our environment. While your procedures will work (via phpMyAdmin or some other interface), it is unlikely they will be accessible via the Connector/.NET (ADO.NET) that your application is likely using. This is due to a security restriction with how that connector works in shared environments. http://dev.mysql.com/doc/refman/5.0/en/connector-net-programming-stored.html "Note When you call a stored procedure, the command object makes an additional SELECT call to determine the parameters of the stored procedure. You must ensure that the user calling the procedure has the SELECT privilege on the mysql.proc table to enable them to verify the parameters. Failure to do this will result in an error when calling the procedure." Unfortunately, giving read privileges on the mysql.proc table will give you access to the data of our other customers and that is not an acceptable risk. If your application can only work using stored procedures, then MSSQL will probably be the better option for your site. I apologize for the inconvenience and the wait to have this ticket completed. So is there any good hosting that any body already used it to publish his asp.net and mysql project ??? this is one of my stored procedure and i think it's sample and it will not harm any other uses!!: -- -------------------------------------------------------------------------------- -- Routine DDL -- Note: comments before and after the routine body will not be stored by the server -- -------------------------------------------------------------------------------- DELIMITER $$ CREATE DEFINER=`root`@`localhost` PROCEDURE `SpcategoriesRead`( IN PaRactioncode VARCHAR(5), IN PaRCatID BIGINT, IN PaRSearchText TEXT ) BEGIN -- CREATING TEMPORARY TABLE TO SAVE DATA FROM THE ACTIONCODE SELECTS -- DROP TEMPORARY TABLE IF EXISTS TEMP; CREATE temporary table tmp ( CatID BIGINT primary key not null, CatTitle TEXT, CatDescription TEXT, CatTitleAr TEXT, CatDescriptionAr TEXT, PictureID BIGINT, Published BOOLEAN, DisplayOrder BIGINT, CreatedOn DATE ); IF PaRactioncode = 1 THEN -- Retrive all DATA from the database -- INSERT INTO tmp SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tbcategories; ELSEIF PaRactioncode = 2 THEN -- Retrive all from the database By ID -- INSERT INTO tmp SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tbcategories WHERE CatID=PaRCatID; ELSEIF PaRactioncode = 3 THEN -- NOSET YET -- INSERT INTO tmp SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tbcategories WHERE Published=1 ORDER BY DisplayOrder; END IF; IF PaRSearchText IS NOT NULL THEN set PaRSearchText=concat('%', PaRSearchText ,'%'); SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tmp WHERE Concat(CatTitle, CatDescription, CatTitleAr, CatDescriptionAr) LIKE PaRSearchText; ELSE SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tmp; END IF; DROP TEMPORARY TABLE IF EXISTS tmp; END

    Read the article

  • Firefox hangs after upgrade to version 3.6.11

    - by Yasmine
    I just upgraded firefox to version 3.6.11 and after the installation was done I got the message that adobe flash player 10.1 needs to be downloaded so I did (even though the flash player I had before upgrading firefox was 10.1 but I reinstalled it coz I thought that since firefox got updated so it needs the plugin to be installed again) and after that whenever I open any website with flash in it (like youtube or facebook games), firefox hangs and stops responding. I don't know if this is related to firefox upgrade or the flash player. Can anyone help me on this? Thanks

    Read the article

  • WF 4.0 can't get to resume workflow on the staging/production environment

    - by Yasmine Atta Hajjaj
    I have developed various registeration workflows using WF4.0. Each work flow has various bookmarks. I am using the registeration wf for an asp.net application. I tested the asp.net application locally and it is working fine( Starting WF, Persisting to db and resuming bookmarks). When I try to test it on the staging server, everything goes messy. I can no longer resume wfs and I get an error message : System.Runtime.DurableInstancing.InstancePersistenceCommandException was unhandled by user code Message=The execution of the InstancePersistenceCommand named {urn:schemas-microsoft-com:System.Activities.Persistence/command}LoadWorkflow was interrupted by an error. Source=System.Runtime.DurableInstancing StackTrace: at System.Runtime.AsyncResult.End[TAsyncResult](IAsyncResult result) at System.Runtime.DurableInstancing.InstancePersistenceContext.OuterExecute(InstanceHandle initialInstanceHandle, InstancePersistenceCommand command, Transaction transaction, TimeSpan timeout) at System.Runtime.DurableInstancing.InstanceStore.Execute(InstanceHandle handle, InstancePersistenceCommand command, TimeSpan timeout) at System.Activities.WorkflowApplication.PersistenceManager.Load(TimeSpan timeout) at System.Activities.WorkflowApplication.LoadCore(TimeSpan timeout, Boolean loadAny) at System.Activities.WorkflowApplication.Load(Guid instanceId, TimeSpan timeout) at System.Activities.WorkflowApplication.Load(Guid instanceId) at CEO_StartUpCEORegisterationTest.LoadInstance(Guid wfInstanceId) in c:\Users\Kunoichi\Documents\Visual Studio 2010\Projects\CMERegistrationSystem\RegistrationPortal\CEO\StartUpCEORegisterationTest.aspx.cs:line 64 at CEO_StartUpCEORegisterationTest.Page_Load(Object sender, EventArgs e) in c:\Users\Kunoichi\Documents\Visual Studio 2010\Projects\CMERegistrationSystem\RegistrationPortal\CEO\StartUpCEORegisterationTest.aspx.cs:line 44 at System.Web.Util.CalliHelper.EventArgFunctionCaller(IntPtr fp, Object o, Object t, EventArgs e) at System.Web.Util.CalliEventHandlerDelegateProxy.Callback(Object sender, EventArgs e) at System.Web.UI.Control.OnLoad(EventArgs e) at System.Web.UI.Control.LoadRecursive() at System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) InnerException: System.Data.SqlClient.SqlException Message=Index 'NCIX_KeysTable_SurrogateInstanceId' on table 'KeysTable' (specified in the FROM clause) does not exist. Source=.Net SqlClient Data Provider ErrorCode=-2146232060 Class=16 LineNumber=211 Number=308 Procedure=LoadInstance Server= State=1 StackTrace: at System.Runtime.AsyncResult.End[TAsyncResult](IAsyncResult result) at System.Activities.DurableInstancing.SqlWorkflowInstanceStoreAsyncResult.SqlCommandAsyncResultCallback(IAsyncResult result) I know that this is quite verbose. But I have been banging my head against the wall for more than a week. I did search and all I came to know was to work on ms dtc. I enabled it on the staging server , I installed application server on the staging server and I am still getting the same error. I would appreciate if anyone could help with the problem. Thanks in advance :)

    Read the article

  • Cannot resolve the collation conflict ???

    - by HAJJAJ
    hi guys I had this error and i don't know how to fix it Message=Cannot resolve the collation conflict between "Arabic_CI_AS" and "SQL_Latin1_General_CP1_CI_AS" in the equal to operation. note: I already change the collation from the database option -- Collation i change it from "Arabic_CI_AS" to "SQL_Latin1_General_CP1_CI_AS" and i am still getting the same error !! any suggestion to solve this ?

    Read the article

  • Flex builder stopped generating the module swf in the output folder

    - by Yasmine
    Flex Builder suddenly stopped generating the swf of the modules in the output folder, the project properties is set to build automatically and all the modules are listed under Flex Modules in the project properties. I didn't change any configuration, I was working on a project and modifying modules and the swf files in the output folder where getting updated until suddenly I noticed that any modifications in the modules where not reflected when I run the application so I checked the swf files of the modules in the output folder I found that they don't get regenerated when the module is modified. I tried restarting the flex builder but nothing changed.

    Read the article

  • Creating a bouncing button in flex

    - by Yasmine
    I am trying to make an effect on a button that when I mouse over it, it keeps jumping up and down smoothly and when mouse out it stops. I tried this but the result was really bad: <mx:Sequence id="bounceEffect" repeatCount="0"> <mx:Move duration="2000" yBy="10" easingFunction="{Bounce.easeOut}"/> <mx:Move duration="2000" yBy="-10" easingFunction="{Bounce.easeOut}"/> </mx:Sequence> <mx:Button id="btn" label="Request Information" rollOver="bounceEffect.play([btn])" rollOut="bounceEffect.end()" fillColors="[#ff0000, #ff0000, #ff0000, #ff0000]" color="#ffffff" textRollOverColor="#ffffff" /> Can someone help me on this? There's something else I noticed when I mouse over the button and during the effect the text on the button becomes very hazy. Thanks

    Read the article

  • Convert search from SQL Server to MySQL

    - by HAJJAJ
    hi, everyone. i need to convert this one from SQL Server into MySQL IF IsNull(@SearchText, '') <> '' BEGIN SET @SearchText = '%' + @SearchText + '%' SELECT NewsID,DeptID,DeptName,Title,Details ,NewsDate,img FROM @tbSearchtextTb WHERE IsNull(Title,'')+IsNull(Details,'') LIKE @SearchText END this code will search fro my search word in this columns: Title, Details. i tried to convert this line but i had lots of errors: these are my unsuccessful attempts IF ISNULL(SearchText,'') <> '' THEN SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tmp WHERE CatTitle + CatDescription + CatTitleAr + CatDescriptionAr LIKE $SearchText; and this one IF $SearchText IS NOT NULL THEN SELECT CatID,CatTitle,CatDescription,CatTitleAr,CatDescriptionAr,PictureID,Published,DisplayOrder,CreatedOn FROM tmp WHERE ISNULL(CatTitle,'') +ISNULL(CatDescription ,'') +ISNULL(CatTitleAr ,'') +ISNULL(CatDescriptionAr,'') LIKE $SearchText; and many many other ways but i could not find any. so if you know please let me know, thanks and best regards.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

1