Search Results

Search found 23347 results on 934 pages for 'key storage'.

Page 100/934 | < Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >

  • Image storage as a service

    - by Samuel
    Google App Engine provides a image API for storing / retrieving images. We are currently not in a position to deploy our application on top of App Engine because of limitations in the java frameworks (jboss seam 2.2.0) we are using to build our j2ee application. We would eventually want to deploy our production application on top of Google App Engine, but what are the short term options (java based open source products) which provides comparable functionality to Google App Engine's Image API and will have an easier migration path at a later point in time.

    Read the article

  • jQuery AJAX Loading Page Content Only After I Press Shift Key

    - by Cosmin
    My ajax + jquery loading page only after holding shift key and duplicate new empty window. If I press the loading button nothing hapen, only after I press shift key I get to load the page correctly... this is my ajax script: $(document).ready(function () { $(".getUsersA").click(function () { $.ajax({ beforeSend: function () { $(".gridD").html(spinner) }, url: 'lib/some_url.php', type: 'POST', data: ({ data1:'2013-09-01' }), success: function (results) {$(".gridD").html(results);} }); }); }); I have a second js file with just this line of code for spinner var spinner = "<img src='images/spinner.gif' border='0'>"; html code: <html> <head> <title>Title</title> <script type="text/javascript" src="js/jquery-1.10.2.js"></script> <script type="text/javascript" src="js/ajax.js"></script> <script type="text/javascript" src="js/general.js"></script> </head> <body> <h1>Putting it all tugether ... with jQuery</h1> <div class="thedivD"><a href="" class="buttonA getUsersA">Get Users</a></div> <h3>jQuery results</h3> <div class="gridD"></div> </body> </html>

    Read the article

  • problem downloading movie to iphone for storage and playback

    - by padatronic
    I am basically making a video library where you download videos and I then write them to the applications documents folder. This all works fine and if i stream the video from online it plays fine. Or indeed I can stream it from the resource folder fine. However, after downloading it and saving to the documents folder then attempting to stream I get the error 'movie format not supported' any ideas? thanks very much

    Read the article

  • Decentralized synchronized secure data storage

    - by Alberich
    Introduction Hi, I am going to ask a question which seems utopic for me, but I need to know if there is a way to achieve what I need. And if not, I need to know why not. The idea Suppose I have a database structure, in MySql. I want to create some solution to allow anyone (no matter who, no matter where) to have a synchronized copy (updated clone) of this database (with its content) Well, and it is not going to be just one synchronized copy, it could (and should) be a multiple replication (supposing the basic, this means, for example, ten copies all over the world) And, the most important thing: It must be secure. By secure I mean only real-accepted transactions will be synchronized with all the others (no matter how many) database copies/clones. Note: Since it would be quite difficult to make the synchronization in real-time, I will design everything to make this feature dispensable. So it is not required. My auto-suggestion This is how I am thinking to manage it: Time identifiers and Updates checking: Every action (insert, update, delete...) will be stored as the action instruction itself, associated to the time identifier. [I think better than a DATETIME field, it'll be an INT one, with the number of miliseconds passed from 1st january 2013 on, for example]. So each copy is going to ask to the "neighbour copy" for new actions done since last update, and execute them after checking they are allowed. Problem 1: the "neighbour copy" could be outdated too. Solution 1: do not ask just one neighbour, create a random list with some of the copies/clones and ask them for news (I could avoid the list and ask ALL the clones for updates, but this will be inefficient if clones number ascends too much). Problem 2: Real-time global synchronization is not active. What if... Someone at CLONE_ENTERPRISING inserts a row into TABLE. ... this row goes to every clone ... Someone at CLONE_FIXEMALL deletes this row. ... and at the same time, somewhere in an outdated clone ... Someone at CLONE_DROPOUT edits this row (now inexistent at the other clones) Solution 2: easy stuff, force a GLOBAL synchronization before doing any new "depending-on-third-data action" (edit, for example). This global synch. will be unnecessary when making an INSERT, for instance. Note: Well, someone could have some fun, and make the same insert in two clones... since they're not getting updated in real-time, this row will exist twice. But, it's the same as when we have one single database, in some needed cases we check if there is an existing same-row before doing the final action. Not a problem. Problem 3: It is possible to edit the code and do not filter actions, so someone could spread instructions to delete everything, or just make some trolling activity. This is not a problem, since good clones will always be somewhere. Those who got bad won't interest anymore. I really appreciate if you read. I know this is not the perfect solution, it has possibly hundred of holes, but it is my basic start. I will now appreciate anything you can teach me now. Thanks a lot. PS.: It could be that all this I am trying already exists and has its own name. Sorry for asking then (I'd anyway thank this name, if it exists)

    Read the article

  • Windows Azure - Automatic Load Balancing - partitioning

    - by veda
    I was going through some videos. I found that Windows Azure will group the blobs into partitions based on the partition key and will Automatically Load Balance these partitions on their servers. The partition key for a blob is blob name. Using the blob name, azure will automatically do partitions. Now, My question is that Can I able to make the azure to do partitions based on the Container Name. I wanted my partition key to be container name. For example, I have a storage account. In that I have 2 containers named container1 and container2. In container1, I have 1000 files named 1.txt, 2.txt, 3.txt, ......., 501.txt, 502.txt, ..... 999.txt, 1000.txt and in container2, I have another 1000 files named 1001.txt, 1002.txt, 1003.txt, ......., 1501.txt, 1502.txt, ..... 1999.txt, 2000.txt Now, Will Windows Azure will generate 2000 partitions based on the blob name and serve me through several servers??? Won't it be better if Azure partitions based on the Container name? container1 on one server and conatiner2 on another.

    Read the article

  • How to test if a doctrine records has any relations that are used

    - by murze
    Hi, I'm using a doctrine table that has several optional relations (of types Doctrine_Relation_Association and Doctrine_Relation_ForeignKey) with other tables. How can I test if a record from that table has connections with records from the related table. Here is an example to make my question more clear. Assume that you have a User and a user has a many to many relation with Usergroups and a User can have one Userrole How can I test if a give user is part of any Usergroups or has a role. The solution starts I believe with $relations = Doctrine_Core::getTable('User')->getRelations(); $user = Doctrine_Core::getTable('User')->findOne(1); foreach($relations as $relation) { //here should go a test if the user has a related record for this relation if ($relation instanceof Doctrine_Relation_Association) { //here the related table probably has more then one foreign key (ex. user_id and group_id) } if ($relation instanceof Doctrine_Relation_ForeignKey) { //here the related table probably has the primary key of this table (id) as a foreign key (user_id) } } //true or false echo $result I'm looking for a general solution that will work no matter how many relations there are between user and other tables. Thanks!

    Read the article

  • implementing cryptographic algorithms, specifically the key expansion part

    - by masseyc
    Hey, recently I picked up a copy of Applied Cryptography by Bruce Schneier and it's been a good read. I now understand how several algorithms outlined in the book work, and I'd like to start implementing a few of them in C. One thing that many of the algorithms have in common is dividing an x-bit key, into several smaller y-bit keys. For example, blowfish's key, X, is 64-bits, but you are required to break it up into two 32-bit halves; Xl and Xr. This is where I'm getting stuck. I'm fairly decent with C, but I'm not the strongest when it comes to bitwise operators and the like. After some help on IRC, I managed to come up with these two macros: #define splitup(a, b, c) {b = a >> 32; c = a & 0xffffffff; } #define combine(a, b, c) {a = (c << 32) | a;} Where a is 64 bits and b and c are 32 bits. However, the compiler warns me about the fact that I'm shifting a 32 bit variable by 32 bits. My questions are these: what's bad about shifting a 32-bit variable 32 bits? I'm guessing it's undefined, but these macros do seem to be working. Also, would you suggest I go about this another way? As I said, I'm fairly familiar with C, but bitwise operators and the like still give me a headache.

    Read the article

  • Database storage for high sample rate data in web app

    - by Jim
    I've got multiple sensors feeding data to my web app. Each channel is 5 samples per second and the data gets uploaded bundled together in 1 minute json messages (containing 300 samples). The data will be graphed using flot at multiple zoom levels from 1 day to 1 minute. I'm using Amazon SimpleDB and I'm currently storing the data in the 1 minute chunks that I receive it in. This works well for high zoom levels, but for full days there will be simply be too many rows to retrieve. The idea I've currently got is that every hour I can crawl through the data and collect together 300 samples for the last hour and store them in an hour Domain (table if you like). Does this sound like a reasonable solution? How have others implemented the same sort of systems?

    Read the article

  • .Net 4.0 Memory-Mapped Files verses RDMS Storage

    - by Harry
    I'm interested in people's thoughts comparing storing data in a traditional SQL based Database or utilising a Memory-Mapped File such as the one in the new .Net 4.0 runtime. The data in question would be arrays of simple structures. Obvious pros and cons: SQL Database Pros Adhoc query support SQL Management Tools Schema changes (adding more columns and setting default values) Memory-Mapped Pros Lighter overhead? (this is an assumption on my part) Shareable between process threads Any others? Is it worth it for performance gains?

    Read the article

  • Visual Studio 2010 "Not enough storage is available to process this command"

    - by Daniel Perez
    I'm fighting with VS 2010 and this error that seems to be very common in previous versions, but it looks like not everyone is having it in the latest version. I've got VS 2010 SP1 and I'm getting this error quite often. The problem is that it's not even enough to restart VS in order to make it go away, I usually have to restart my pc, and i'm losing a lot of time doing this (it's quite frequent) I've got Windows 7 32bits (can't upgrade to 64 bits, the company doesn't allow it), and I can't do things like creating another solution (please don't reply this :) ) I've used the command to make devenv.exe LARGEADDRESSAWARE, but the error keeps on happening My virtual memory size is set to automatic, and the weird thing is that VS doesn't even take 2gb of ram, so I don't know if the error is really because it's lacking memory, or if it's some bug in the program any ideas, things to try, something?

    Read the article

  • NHibernate query against the key field of a dictionary (map)

    - by Carl Raymond
    I have an object model where a Calendar object has an IDictionary<MembershipUser, Perms> called UserPermissions, where MembershipUser is an object, and Perms is a simple enumeration. This is in the mapping file for Calendar as <map name="UserPermissions" table="CalendarUserPermissions" lazy="true" cascade="all"> <key column="CalendarID"/> <index-many-to-many class="MembershipUser" column="UserGUID" /> <element column="Permissions" type="CalendarPermission" not-null="true" /> </map> Now I want to execute a query to find all calendars for which a given user has some permission defined. The permission is irrelevant; I just want a list of the calendars where a given user is present as a key in the UserPermissions dictionary. I have the username property, not a MembershipUser object. How do I build that using QBC (or HQL)? Here's what I've tried: ISession session = SessionManager.CurrentSession; ICriteria calCrit = session.CreateCriteria<Calendar>(); ICriteria userCrit = calCrit.CreateCriteria("UserPermissions.indices"); userCrit.Add(Expression.Eq("Username", username)); return calCrit.List<Calendar>(); This constructed invalid SQL -- the WHERE clause contained WHERE membership1_.Username = @p0 as expected, but the FROM clause didn't include the MemberhipUsers table. Also, I really had to struggle to learn about the .indices notation. I found it by digging through the NHibernate source code, and saw that there's also .elements and some other dotted notations. Where's a reference to the allowed syntax of an association path? I feel like what's above is very close, and just missing something simple.

    Read the article

  • Going "behind Hibernate's back" to update foreign key values without an associated entity

    - by Alex Cruise
    Updated: I wound up "solving" the problem by doing the opposite! I now have the entity reference field set as read-only (insertable=false updatable=false), and the foreign key field read-write. This means I need to take special care when saving new entities, but on querying, the entity properties get resolved for me. I have a bidirectional one-to-many association in my domain model, where I'm using JPA annotations and Hibernate as the persistence provider. It's pretty much your bog-standard parent/child configuration, with one difference being that I want to expose the parent's foreign key as a separate property of the child alongside the reference to a parent instance, like so: @Entity public class Child { @Id @GeneratedValue Long id; @Column(name="parent_id", insertable=false, updatable=false) private Long parentId; @ManyToOne(cascade=CascadeType.ALL) @JoinColumn(name="parent_id") private Parent parent; private long timestamp; } @Entity public class Parent { @Id @GeneratedValue Long id; @OrderBy("timestamp") @OneToMany(mappedBy="parent", cascade=CascadeType.ALL, fetch=FetchType.LAZY) private List<Child> children; } This works just fine most of the time, but there are many (legacy) cases when I'd like to put an invalid value in the parent_id column without having to create a bogus Parent first. Unfortunately, Hibernate won't save values assigned to the parentId field due to insertable=false, updatable=false, which it requires when the same column is mapped to multiple properties. Is there any nice way to "go behind Hibernate's back" and sneak values into that field without having to drop down to JDBC or implement an interceptor? Thanks!

    Read the article

  • "Special case" records for foreign key constraints

    - by keithjgrant
    Let's say I have a mysql table, called foo with a foreign key option_id constrained to the option table. When I create a foo record, the user may or may not have selected an option, and 'no option' is a viable selection. What is the best way to differentiate between 'null' (i.e. the user hasn't made a selection yet) and 'no option' (i.e. the user selected 'no option')? Right now, my plan is to insert a special record into the option table. Let's say that winds up with an id of 227 (this table already has a number of records at this point, so '1' isn't available). I have no need to access this record at a database level, and it would act as nothing more than a placeholder that the foreign key in the foo table can reference. So do I just hard-code '227' in my codebase when I'm creating 'foo' records where the user has selected 'no option'? The hard-coded id seems sloppy, and leaves room for error as the code is maintained down the road, but I'm not really sure of another approach.

    Read the article

  • Efficient persistent storage for simple id to table of values map for java

    - by wds
    I need to store some data that follows the simple pattern of mapping an "id" to a full table (with multiple rows) of several columns (i.e. some integer values [u, v, w]). The size of one of these tables would be a couple of KB. Basically what I need is to store a persistent cache of some intermediary results. This could quite easily be implemented as simple sql, but there's a couple of problems, namely I need to compress the size of this structure on disk as much as possible. (because of amount of values I'm storing) Also, it's not transactional, I just need to write once and simply read the contents of the entire table, so a relational DB isn't actually a very good fit. I was wondering if anyone had any good suggestions? For some reason I can't seem to come up with something decent atm. Especially something with an API in java would be nice.

    Read the article

  • how to check if internal storage file has any data

    - by user3720291
    public class Save extends Activity { int levels = 2; int data_block = 1024; //char[] data = new char[] {'0', '0'}; String blankval = "0"; String targetval = "0"; String temp; String tempwrite; String string = "null"; TextView tex1; TextView tex2; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.save); Intent intent = getIntent(); Bundle b = intent.getExtras(); tex1 = (TextView) findViewById(R.id.textView1); tex2 = (TextView) findViewById(R.id.textView2); if(b!=null) { string =(String) b.get("string"); } loadprev(); save(); } public void save() { if (string.equals("Blank")) blankval = "1"; if (string.equals("Target")) targetval = "1"; temp = blankval + targetval; try { FileOutputStream fos = openFileOutput("data.gds", MODE_PRIVATE); fos.write(temp.getBytes()); fos.close(); } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} tex1.setText(blankval); tex2.setText(targetval); } public void loadprev() { String final_data = ""; try { FileInputStream fis = openFileInput("data.gds"); InputStreamReader isr = new InputStreamReader(fis); char[] data = new char[data_block]; int size; while((size = isr.read(data))>0) { String read_data = String.copyValueOf(data, 0, size); final_data += read_data; data = new char[data_block]; } } catch (FileNotFoundException e) {e.printStackTrace();} catch (IOException e) {e.printStackTrace();} char[] tempread = final_data.toCharArray();; blankval = "" + tempread[0]; targetval = "" + tempread[1]; } } After much tinkering i have finally managed to get my save/load function to work, but it does have an error, pretty much i got it to work then i did a fresh reintall deleting data.gds, afterwards the save/load function crashes because the data.gds file has no previous values. can i use a if statment to check if data.gds has any values in it, if so how do i do it and if not, then what could i use instead?

    Read the article

  • Questions about using git as a backend storage system

    - by XO
    New to git here... I want to commit my personal file share to a git repo (text, docs, images etc). As I make modifications to various files over time, telling git about them along the way, how do go about things so I can: Get out of the business of traditional fulls/incrementals. Be able to do a point-in-time file or full clone restore. Basically, I want something granular, such that, if I make an edit to a file 5 times on a particular day. I will have 5 versions of that file that I can refer back to- forever. Or even just derive the a full copy of everything the way it looked on that particular day. I am currently using rsync for remote incremental syncs (no file versioning).

    Read the article

  • Reverse alphabetic sort multidimensional PHP array maintain key

    - by useyourillusiontoo
    I'm dying here, any help would be great. I've got an array that I can sort a-z on the value of a specific key but cannot sort in reverse z-a. sample of my array which i'd like to sort by ProjectName (z-a): Array ( [0] => Array ( [count] => 1 [ProjectName] => bbcjob [Postcode] => 53.471922,-2.2996078 [Sector] => Public ) [1] => Array ( [count] => 1 [ProjectName] => commercial enterprise zone [Postcode] => 53.3742081,-1.4926439 [Sector] => Public ) [2] => Array ( [count] => 1 [ProjectName] => Monkeys eat chips [Postcode] => 51.5141492,-0.2271227 [Sector] => Private the desired results would be to maintain the entire array key - value structure but with the order: Monkeys eat chips Commericial enterprise zone bbcjob I hope this makes sense

    Read the article

  • Efficient Array Storage for Binary Tree

    - by Sundararajan S
    We have to write the nodes of a binary tree to a file. What is the most space efficient way of writing a binary tree . We can store it in array format with parent in position 'i' and its childs in 2i,2i+1. But this will waste lot of space in case of sparse binary trees.

    Read the article

  • How to load an RSA key from binary data to an RSA structure using the OpenSSL C Library?

    - by Andreas Bonini
    Currently I have my private key saved in a file, private.key, and I use the following function to load it: RSA *r = PEM_read_RSAPrivateKey("private.key", NULL, NULL, NULL); This works perfectly but I'm not happy with the file-based format; I want to save my key in pure binary form (ie, no base64 or similar) in a char* variable and load/save the key from/to it. This way I have much more freedom: I'll be able to store the key directly into the application const char key[] { 0x01, 0x02, ... };, send it over a network socket, etc. Unfortunately though I haven't found a way to do that. The only way to save and load a key I know of reads/saves it to a file directly.

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Interpreter in C++: Function table storage problem

    - by sub
    In my interpreter I have built-in functions available in the language like print exit input, etc. These functions can obviously be accessed from inside the language. The interpreter then looks for the corresponding function with the right name in a vector and calls it via a pointer stored with its name. So I gather all these functions in files like io.cpp, string.cpp, arithmetic.cpp. But I have to add every function to the function list in the interpreter in order for it to be found. So in these function files I have things like: void print( arg ) { cout << arg.ToString; } I'd add this print function to the interpreter function list with: interpreter.AddFunc( "print", print ); But where should I call the interpreter.AddFunc? I can't just put it there below the print function as it has to be in a function according to the C++ syntax. Where and how should all the functions be added to the list?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >