Search Results

Search found 23347 results on 934 pages for 'key storage'.

Page 101/934 | < Previous Page | 97 98 99 100 101 102 103 104 105 106 107 108  | Next Page >

  • Efficient Array Storage for Binary Tree

    - by Sundararajan S
    We have to write the nodes of a binary tree to a file. What is the most space efficient way of writing a binary tree . We can store it in array format with parent in position 'i' and its childs in 2i,2i+1. But this will waste lot of space in case of sparse binary trees.

    Read the article

  • Custom session state provider needed for DB storage?

    - by subt13
    I know this question is related to many others, but please bear with me. I am trying an experiment to store all information in database tables instead of the ASP.NET session. In ASP.NET 4 one can create a custom provider for session. So, again should I implement a Custom Session-State Provider or should I just disable session (in Web.config)? Thanks! From the comments my question can be misunderstood. Hopefully this tidbit will help clarify: I don't want to store the session in the database. I want to store information in the database that you would typically store in the session. One reason why: I don't want to carry around a session on every page, especially if that page doesn't care about 90 percent of the information in the session

    Read the article

  • client-side data storage and retrieval with html and javascript

    - by pedalpete
    I'm building what I am hoping to be a fairly simple, quick and dirty demo app. So far, I've managed to build a bunch of components using only html and javascript. I know that eventually I'll hook-up a db, but at this point I'm just trying to show off some functionality. In the page, a user can select a bunch of other users (like friends). Then they go to a separate html page and there is some sorting info based on the selected users. So my first attempt was to put the selected users object into a cookie, and retrieve the cookie on the second page. Unfortunately, if the user changed their selection, the cookie wasn't getting updated, and my searches on StackOverflow seemed to say that deleting and updating cookies is unreliable. I tried function updateCookie(updatedUserList){ jQuery.cookie('userList',null); jQuery.cookie('userList',updatedUserList); } but though it set the cookie to null, it wouldn't update it on the second value. So I decided to put the selected users object into a form. Unfortunately, it looks like I can't retrieve the contents from the form on the client-side, only on the server-side. Is there another way to do this? I've worked in PHP and Rails, but I'm trying to do this quickly and simply before building it out into something larger and am trying to avoid any server-side processing for now, which I have managed to do up to this point.

    Read the article

  • extern and static variable storage ???

    - by Riyaz
    when will memory created for extern and static variable. Is it in stack or heap. Since its life time is till the program end, it cant be in stack it must be in heap. But size of the heap will known only at the run time. So somewhat confusion here ......

    Read the article

  • Interpreter in C++: Function table storage problem

    - by sub
    In my interpreter I have built-in functions available in the language like print exit input, etc. These functions can obviously be accessed from inside the language. The interpreter then looks for the corresponding function with the right name in a vector and calls it via a pointer stored with its name. So I gather all these functions in files like io.cpp, string.cpp, arithmetic.cpp. But I have to add every function to the function list in the interpreter in order for it to be found. So in these function files I have things like: void print( arg ) { cout << arg.ToString; } I'd add this print function to the interpreter function list with: interpreter.AddFunc( "print", print ); But where should I call the interpreter.AddFunc? I can't just put it there below the print function as it has to be in a function according to the C++ syntax. Where and how should all the functions be added to the list?

    Read the article

  • Handle BACK key event in child view

    - by Mick Byrne
    In my app, users can tap on image thumbnails to see a full size version. When the thumbnail is tapped a bunch of new views are created in code (i.e. no XML), appended at the end of the view hierarchy and some scaling and rotating transitions happen, then the full size, high res version of the image is displayed. Tapping on the full size image reverses the transitions and removes the new views from the view hierarchy. I want users to also be able to press the BACK key to reverse the image transitions. However, I can't seem to catch the KeyEvent. This is what I'm trying at the moment: // Set a click listener on the image to reverse everything frameView.setOnClickListener(new OnClickListener() { @Override public void onClick(View arg0) { zoomOut(); // This works fine } }); // Set the focus onto the frame and then set a key listener to catch the back buttons frameView.setFocusable(true); frameView.setFocusableInTouchMode(true); frameView.requestFocus(); frameView.setOnKeyListener(new OnKeyListener() { @Override public boolean onKey(View v, int keyCode, KeyEvent event) { // The code never even gets here !!! if(keyCode == KeyEvent.KEYCODE_BACK && event.getRepeatCount() == 0) { zoomOut(); return true; } return false; } });

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Find out how much storage a row is taking up in the database

    - by Vaccano
    Is there a way to find out how much space (on disk) a row in my database takes up? I would love to see it for SQL Server CE, but failing that SQL Server 2008 works (I am storing about the same data in both). The reason I ask is that I have a Image column in my SQL Server CE db (it is a varbinary[max] in the SQL 2008 db) and I need to know now many rows I can store before I max out the memory on my device.

    Read the article

  • "java.lang.OutOfMemoryError: Java heap space" in image and array storage

    - by totalconscience
    I am currently working on an image processing demonstration in java (Applet). I am running into the problem where my arrays are too large and I am getting the "java.lang.OutOfMemoryError: Java heap space" error. The algorithm I run creates an NxD float array where: N is the number of pixel in the image and D is the coordinates of each pixel plus the colorspace components of each pixel (usually 1 for grayscale or 3 for RGB). For each iteration of the algorithm it creates one of these NxD float arrays and stores it for later use in a vector, so that the user of the applet may look at the individual steps. My client wants the program to be able to load a 500x500 RGB image and run as the upper bound. There are about 12 to 20 iterations per run so that means I need to be able to store a 12x500x500x5 float in some fashion. Is there a way to process all of this data and, if possible, how? Example of the issue: I am loading a 512 by 512 Grayscale image and even before the first iteration completes I run out of heap space. The line it points me to is: Y.add(new float[N][D]) where Y is a Vector and N and D are described as above. This is the second instance of the code using that line.

    Read the article

  • String Storage and Retrieval in Android

    - by dweebsonduty
    I have a program that has items with 3 attributes. Name(String) : Count(String) : Amount(String) Currently I am writing the database when someone is trying to access a section then reading from the database. The writing is taking too long. So my question is how can I perhaps create a nested array where I can say if name = carrot then print carrot['count'] and carrot['amount']. I am very new to Java so some sample code would be great. Or any other suggestions that you may have as far as tackling this issue.

    Read the article

  • Displaying cookies as key=value for all domains?

    - by OverTheRainbow
    Hello, This question pertains to the use of the cookie-capable WebClient derived class presented in the How can I get the WebClient to use Cookies? question. I'd like to use a ListBox to... 1) display each cookie individually as "key=value" (the For Each loop displays all of them as one string), and 2) be able to display all cookies, regardless of the domain from which they came ("www.google.com", here): Imports System.IO Imports System.Net Public Class Form1 Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Dim webClient As New CookieAwareWebClient Const URL = "http://www.google.com" Dim response As String response = webClient.DownloadString(URL) RichTextBox1.Text = response 'How to display cookies as key/value in ListBox? 'PREF=ID=5e770c1a9f279d5f:TM=1274032511:LM=1274032511:S=1RDPaKJKpoMT9T54 For Each mycc In webClient.cc.GetCookies(New Uri(URL)) ListBox1.Items.Add(mycc.ToString) Next End Sub End Class Public Class CookieAwareWebClient Inherits WebClient Public cc As New CookieContainer() Private lastPage As String Protected Overrides Function GetWebRequest(ByVal address As System.Uri) As System.Net.WebRequest Dim R = MyBase.GetWebRequest(address) If TypeOf R Is HttpWebRequest Then With DirectCast(R, HttpWebRequest) .CookieContainer = cc If Not lastPage Is Nothing Then .Referer = lastPage End If End With End If lastPage = address.ToString() Return R End Function End Class Thank you.

    Read the article

  • SQL programming interface to external storage application

    - by Gopala
    My application is a non-relational database application with a tcl interface to retrieve data. I would like to add SQL programming interface to my application. Is there any library that converts SQL/PLSQL statements to API calls? It should also support stored procedures. SQLite(Embedded) has 'virtual table' mechanism that suits my requirement but it lacks stored procedure feature. -Gopala

    Read the article

  • How does Rails Plugin Storage work?

    - by Kevin
    Trying to figure out how to install rails plugins manually on windows so I have a few questions. What does the directory need to be named in vendor/plugins? Is it arbitrary or is it linked to something within the plugin config files or is that what you set in the environment.rb? Once I've copied the files to the correct directory, do I always need to run something inside like init.rb or is it good to go? What's the difference between 'require' and 'include'? Thanks!

    Read the article

  • HTML5 Offline Storage on iPad and iPhone BUG

    - by scaraveos
    Hello everyone, I created a manifest file with 1000 items. Safari, Mozilla browsers are saving the files offline successfully and even Android saves the files correctly offline. On iPad and iPhone when I am trying to save more than 300 items in some point the applicationCache returns "error". When I am trying to save less (e.x.: 200) it saves the files correctly and the applicationCache returns "cached". Any ideas? Thank you.

    Read the article

  • Java RSA Encrypt using .NET XML Key File - need help

    - by badMonkey
    In .net I have generated the following public key file: <RSAKeyValue> <Modulus>xTSiS4+I/x9awUXcF66Ffw7tracsQfGCn6g6k/hGkLquHYMFTCYk4mOB5NwLwqczwvl8HkQfDShGcvrm47XHKUzA8iadWdA5n4toBECzRxiCWCHm1KEg59LUD3fxTG5ogGiNxDj9wSguCIzFdUxBYq5ot2J4iLgGu0qShml5vwk=</Modulus> <Exponent>AQAB</Exponent> .NET is happy to encrypt using it's normal methods. I am trying to use this key to encode a string in Java and am running into an Arithmetic problem (exception) when I attempt to encrypt the string. The following is the code I am using to encrypt: byte[] modulusBytes = Base64.decode(this.getString(R.string.public_key_modulus)); byte[] exponentBytes = Base64.decode(this.getString(R.string.public_key_exponent)); BigInteger modulus = new BigInteger( modulusBytes ); BigInteger exponent = new BigInteger( exponentBytes); RSAPublicKeySpec rsaPubKey = new RSAPublicKeySpec(modulus, exponent); KeyFactory fact = KeyFactory.getInstance("RSA"); PublicKey pubKey = fact.generatePublic(rsaPubKey); Cipher cipher = Cipher.getInstance("RSA"); cipher.init(Cipher.ENCRYPT_MODE, pubKey); byte[] cipherData = cipher.doFinal( new String("big kitty dancing").getBytes() ); It is the final line in the code block that fails. I have looked at numerous examples and this is the best I could come up with. If it is not obvious, the R.string.public_key_modulus is a copy/paste of the text in the Modulus element, same applies for exponent.

    Read the article

  • how to use cherrpy built in data storage

    - by user291071
    Ok I have been reading the cherrypy documents for sometime and have not found a simple example yet. Let say I have a simple hello world site, how do I store data? Lets say I want to store a = 1, and b =2 to a dictionary using cherrypy. The config files are confusing as hell. Anyone have very simple example of storing values from a simple site in cherrypy?

    Read the article

  • Loop through Array with conditional output based on key/value pair

    - by Daniel C
    I have an array with the following columns: Task Status I would like to print out a table that shows a list of the Tasks, but not the Status column. Instead, for Tasks where the Status = 0, I want to add a tag <del> to make the completed task be crossed out. Here's my current code: foreach ($row as $key => $val){ if ($key != 'Status') print "<td>$val</td>"; else if ($val == '0') print "<td><del>$val</del></td>"; } This seems to be correct, but when I print it out, it prints all the tasks with the <del> tag. So basically the "else" clause is being run every time. Here is the var_dump($row): array 'Task' => string 'Task A' (length=6) 'Status' => string '3' (length=1) array 'Task' => string 'Task B' (length=6) 'Status' => string '0' (length=1)

    Read the article

  • List all foreign key constraints that refer to a particular column in a specific table

    - by Sid
    I would like to see a list of all the tables and columns that refer (either directly or indirectly) a specific column in the 'main' table via a foreign key constraint that has the ON DELETE=CASCADE setting missing. The tricky part is that there would be an indirect relationships buried across up to 5 levels deep. (example: ... great-grandchild- FK3 = grandchild = FK2 = child = FK1 = main table). We need to dig up the leaf tables-columns, not just the very 1st level. The 'good' part about this is that execution speed isn't of concern, it'll be run on a backup copy of the production db to fix any relational issues for the future. I did SELECT * FROM sys.foreign_keys but that gives me the name of the constraint - not the names of the child-parent tables and the columns in the relationship (the juicy bits). Plus the previous designer used short, non-descriptive/random names for the FK constraints, unlike our practice below The way we're adding constraints into SQL Server: ALTER TABLE [dbo].[UserEmailPrefs] WITH CHECK ADD CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] FOREIGN KEY([UserId]) REFERENCES [dbo].[UserMasterTable] ([UserId]) ON DELETE CASCADE GO ALTER TABLE [dbo].[UserEmailPrefs] CHECK CONSTRAINT [FK_UserEmailPrefs_UserMasterTable_UserId] GO The comments in this SO question inpire this question.

    Read the article

  • Python - Access a class from a list using a key

    - by Fake Name
    Is there any way to make a list of classes behave like a set in python? Basically, I'm working on a piece of software that does some involved string comparison, and I have a custom class for handling the strings. Therefore, there is an instance of the class for each string. As a result, I have a large list containing all these classes. I would like to be able to access them like list[key], where in this case, the key is a string the class is based off of. It seems to me that I sould be able to do this somewhat easily, by adding something like __cmp__ to the class, but either I'm being obtuse (likely), or Im missing someting in the docs. Basically, I want to be able to do something like this (Python prompt example): >>class a: ... def __init__(self, x): ... self.var = x ... >>> from test import a >>> cl = set([a("Hello"), a("World"), a("Pie")]) >>> print cl set([<test.a instance at 0x00C866C0>, <test.a instance at 0x00C866E8>, <test.a instance at 0x00C86710>]) >>> cl["World"] <test.a instance at 0x00C866E8> Thanks!

    Read the article

  • PHP & MySQL username validation and storage problem.

    - by php
    For some reason when a user enters a brand new username the error message <p>Username unavailable</p> is displayed and the name is not stored. I was wondering if some can help find the flaw in my code so I can fix this error? Thanks Here is the PHP code. if($_POST['username'] && trim($_POST['username'])!=='') { $u = "SELECT * FROM users WHERE username = '$username' AND user_id <> '$user_id'"; $r = mysqli_query ($mysqli, $u) or trigger_error("Query: $u\n<br />MySQL Error: " . mysqli_error($mysqli)); if (mysqli_num_rows($r) == TRUE) { echo '<p>Username unavailable</p>'; $_POST['username'] = NULL; } else if(isset($_POST['username']) && mysqli_num_rows($r) == 0 && strlen($_POST['username']) <= 255) { $username = mysqli_real_escape_string($mysqli, $_POST['username']); } else if($_POST['username'] && strlen($_POST['username']) >= 256) { echo '<p>Username can not exceed 255 characters</p>'; } }

    Read the article

  • Fluent NHibernate - Set reference key columns to null

    - by Matt
    Hi, I have a table of Appointments and a table of AppointmentOutcomes. On my Appointments table I have an OutcomeID field which has a foreign key to AppointmentOutcomes. My Fluent NHibernate mappings look as follows; Table("Appointments"); Not.LazyLoad(); Id(c => c.ID).GeneratedBy.Assigned(); Map(c => c.Subject); Map(c => c.StartTime); References(c => c.Outcome, "OutcomeID"); Table("AppointmentOutcomes"); Not.LazyLoad(); Id(c => c.ID).GeneratedBy.Assigned(); Map(c => c.Description); Using NHibernate, if I delete an AppointmentOutcome an exception is thrown because the foreign key is invalid. What I would like to happen is that deleting an AppointmentOutcome would automatically set the OutcomeID of any Appointments that reference the AppointmentOutcome to NULL. Is this possible using Fluent NHibernate?

    Read the article

  • Need to sort 3 arrays by one key array

    - by jeff6461
    I am trying to get 3 arrays sorted by one key array in objective c for the iphone, here is a example to help out... Array 1 Array 2 Array 3 Array 4 1 15 21 7 3 12 8 9 6 7 8 0 2 3 4 8 When sorted i want this to look like Array 1 Array 2 Array 3 Array 4 1 15 21 7 2 3 4 8 3 12 8 9 6 7 8 0 So array 2,3,4 are moving with Array 1 when sorted. Currently i am using a bubble sort to do this but it lags so bad that it crashes by app. The code i am using to do this is int flag = 0; int i = 0; int temp = 0; do { flag=1; for(i = 0; i < distancenumber; i++) { if(distance[i] > distance[i+1]) { temp = distance[i]; distance[i]=distance[i + 1]; distance[i + 1]=temp; temp = FlowerarrayNumber[i]; FlowerarrayNumber[i] = FlowerarrayNumber[i+1]; FlowerarrayNumber[i + 1] = temp; temp = BeearrayNumber[i]; BeearrayNumber[i] = BeearrayNumber[i + 1]; BeearrayNumber[i + 1] = temp; flag=0; } } }while (flag==0); where distance number is the amount of elements in all of the arrays, distance is array 1 or my key array. and the other 2 are getting sorted. If anyone can help me get a merge sort(or something faster, it is running on a iPhone so it needs to be quick and light) to do this that would be great i cannot figure out how the recursion works in this method and so having a hard time to get the code to work. Any help would be greatly appreciated

    Read the article

  • Content Provider and Image storage

    - by Paru
    I want to share some image Icons between two applications. I stored the icons in a folder from Application 1 and tried use the folder from application 2. That time i got some permission issue. I was not able add the permission also because it is not a rooted device. So i am now trying to store the icons in a content provider. Is it possible to store the images in a Content provider ? Is there any other good method to implement this ? Please help.

    Read the article

  • Accessing C++ Functions From Text storage

    - by Undawned
    I'm wondering if anyone knows how to accomplish the following: Let's say I have a bunch of data stored in SQL, lets say one of the fields could be called funcName, function name would contain data similar to "myFunction" What I'm wondering is, is there a way I can than in turn extract the function name and actually call that function? There's a few ways I can think of to accomplish this, one is changing funcName to funcId and linking up with an array or similar, but I'm looking for something a bit more dynamic that would allow me to add the data on fly without having to update the actual source code every time I add a call to a new function assuming of course that the function already exists and is accessible via scope location we call it from. Any help would be greatly appreciated.

    Read the article

< Previous Page | 97 98 99 100 101 102 103 104 105 106 107 108  | Next Page >