Search Results

Search found 5166 results on 207 pages for 'xpath expression'.

Page 100/207 | < Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • PHP SimpleXML recursive function to list children and attibutes

    - by Phill Pafford
    I need some help on the SimpleXML calls for a recursive function that lists the elements name and attributes. Making a XML config file system but each script will have it's own config file as well as a new naming convention. So what I need is an easy way to map out all the elements that have attributes, so like in example 1 I need a simple way to call all the processes but I don't know how to do this without hard coding the elements name is the function call. Is there a way to recursively call a function to match a child element name? I did see the xpath functionality but I don't see how to use this for attributes. Any ideas? Also does the XML in the examples look correct? can I structure my XML like this? Example 1: <application> <processes> <process id="123" name="run batch A" /> <process id="122" name="run batch B" /> <process id="129" name="run batch C" /> </processes> <connections> <databases> <database usr="test" pss="test" hst="test" dbn="test" /> </databases> <shells> <ssh usr="test" pss="test" hst="test-2" /> <ssh usr="test" pss="test" hst="test-1" /> </shells> </connections> </application> Example 2: <config> <queues> <queue id="1" name="test" /> <queue id="2" name="production" /> <queue id="3" name="error" /> </queues> </config> Pseudo code: // Would return matching process id getProcess($process_id) { return the process attributes as array that are in the XML } // Would return matching DBN (database name) getDatabase($database_name) { return the database attributes as array that are in the XML } // Would return matching SSH Host getSSHHost($ssh_host) { return the ssh attributes as array that are in the XML } // Would return matching SSH User getSSHUser($ssh_user) { return the ssh attributes as array that are in the XML } // Would return matching Queue getQueue($queue_id) { return the queue attributes as array that are in the XML } EDIT: Can I pass two parms? on the first method you have suggested @Gordon public function findProcessById($id, $name) { $attr = false; $el = $this->xml->xpath("//process[@id='$id']"); // How do I also filter by the name? if($el && count($el) === 1) { $attr = (array) $el[0]->attributes(); $attr = $attr['@attributes']; } return $attr; }

    Read the article

  • Converting a WPFToolkit DataGrid from 1D list to 2D matrix

    - by user61073
    Hello - I am wondering if anyone has attempted the following or has an idea as to how to do it. I have a WPFToolkit DataGrid which is bound to an ObservableCollection of items. As such, the DataGrid is shown with as many rows in the ObservableCollection, and as many columns as I have defined in for the DataGrid. That all is good. What I now need is to provide another view of the same data, only, instead, the DataGrid is shown with as many cells in the ObservableCollection. So let's say, my ObservableCollection has 100 items in it. The original scenario showed the DataGrid with 100 rows and 1 column. In the modified scenario, I need to show it with 10 rows and 10 columns, where each cell shows the value that was in the original representation. In other words, I need to transform my 1D ObservableCollection to a 2D ObservableCollection and display it in the DataGrid. I know how to do that programmatically in the code behind, but can it be done in XAML? Let me simplify the problem a little, in case anybody can have a crack at this. The XAML below does the following: * Defines an XmlDataProvider just for dummy data * Creates a DataGrid with 10 columns o each column is a DataGridTemplateColumn using the same CellTemplate * The CellTemplate is a simple TextBlock bound to an XML element If you run the XAML below, you will find that the DataGrid ends up with 5 rows, one for each book, and 10 columns that have identical content (all showing the book titles). However, what I am trying to accomplish, albeit with a different data set, is that in this case, I would end up with one row, with each book title appearing in a single cell in row 1, occupying cells 0-4, and nothing in cells 5-9. Then, if I added more data and had 12 books in my XML data source, I would get row 1 completely filled (cells covering the first 10 titles) and row 2 would get the first 2 cells filled. Can my scenario be accomplished primarily in XAML, or should I resign myself to working in the code behind? Any guidance would greatly be appreciated. Thanks so much! <UserControl xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:custom="http://schemas.microsoft.com/wpf/2008/toolkit" mc:Ignorable="d" x:Name="UserControl" d:DesignWidth="600" d:DesignHeight="400" > <UserControl.Resources> <XmlDataProvider x:Key="InventoryData" XPath="Inventory/Books"> <x:XData> <Inventory xmlns=""> <Books> <Book ISBN="0-7356-0562-9" Stock="in" Number="9"> <Title>XML in Action</Title> <Summary>XML Web Technology</Summary> </Book> <Book ISBN="0-7356-1370-2" Stock="in" Number="8"> <Title>Programming Microsoft Windows With C#</Title> <Summary>C# Programming using the .NET Framework</Summary> </Book> <Book ISBN="0-7356-1288-9" Stock="out" Number="7"> <Title>Inside C#</Title> <Summary>C# Language Programming</Summary> </Book> <Book ISBN="0-7356-1377-X" Stock="in" Number="5"> <Title>Introducing Microsoft .NET</Title> <Summary>Overview of .NET Technology</Summary> </Book> <Book ISBN="0-7356-1448-2" Stock="out" Number="4"> <Title>Microsoft C# Language Specifications</Title> <Summary>The C# language definition</Summary> </Book> </Books> <CDs> <CD Stock="in" Number="3"> <Title>Classical Collection</Title> <Summary>Classical Music</Summary> </CD> <CD Stock="out" Number="9"> <Title>Jazz Collection</Title> <Summary>Jazz Music</Summary> </CD> </CDs> </Inventory> </x:XData> </XmlDataProvider> <DataTemplate x:Key="GridCellTemplate"> <TextBlock> <TextBlock.Text> <Binding XPath="Title"/> </TextBlock.Text> </TextBlock> </DataTemplate> </UserControl.Resources> <Grid x:Name="LayoutRoot"> <custom:DataGrid HorizontalAlignment="Stretch" VerticalAlignment="Stretch" IsSynchronizedWithCurrentItem="True" Background="{DynamicResource WindowBackgroundBrush}" HeadersVisibility="All" RowDetailsVisibilityMode="Collapsed" SelectionUnit="CellOrRowHeader" CanUserResizeRows="False" GridLinesVisibility="None" RowHeaderWidth="35" AutoGenerateColumns="False" CanUserReorderColumns="False" CanUserSortColumns="False"> <custom:DataGrid.Columns> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="01" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="02" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="03" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="04" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="05" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="06" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="07" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="08" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="09" /> <custom:DataGridTemplateColumn CellTemplate="{StaticResource GridCellTemplate}" Header="10" /> </custom:DataGrid.Columns> <custom:DataGrid.ItemsSource> <Binding Source="{StaticResource InventoryData}" XPath="Book"/> </custom:DataGrid.ItemsSource> </custom:DataGrid> </Grid>

    Read the article

  • help with xml parsing using php

    - by fayer
    i've got following example xml: <entity id="1"> <name>computer</name> <type>category</type> <entities> <entity id="2"> <name>mac</name> <type>category</type> </entity> <entity id="3"> <name>linux</name> <type>category</type> <entities> <entity id="4"> <name>ubuntu</name> <type>category</type> </entity> <entity id="5"> <name>redhat</name> <type>category</type> <entities> <entity id="6"> <name>server</name> <type>category</type> </entity> <entity id="7"> <name>desktop</name> <type>category</type> </entity> </entities> </entity> </entities> </entity> </entities> </entity> if i've got an id, lets say 5. is it possible to retrieve the following: the name of the entity with the id=5 (redhat) ALL the child entities and their name and id (server/6 and desktop/7) all the parent entities and their name and id (computer/1, mac/2 and linux/3) im a noob on parsing xml. is this accomplished by xpath only or xquery/xpath? i would appreciate if someone could give me some example code to do this with simplexml. thanks!

    Read the article

  • Complex sorting of XML subnodes in .Net3.5 onwards

    - by MicMit
    XML structure expressed in Xpath kind of Records/Record/Actions/Action/ActionDate the other node on the same level Records/Record/Actions/Action/CTCDate Is there easy or not easy way to sort it on "order by ActionDate,CTCDate" ( in SQL notation ), but per Actions for each selected Record when we iterate somehow ( not per XML file ). File around 50M

    Read the article

  • Could not find function: resolve-uri

    - by Nisarg Mehta
    When i am trying to transform xml it gives me erro that Could not find function: resolve-uri where resolve-uri is a xpath function . below is my xslt line which will use resolve uri function . <xsl:variable name="filename" select="resolve-uri(concat($dir,'/',$xmlFileName,'_',position(),'.xml'))" /> Can anybody please help me.Is it because of xslt version difference ? Thanks in Advance.

    Read the article

  • How to select TreePanel node(Parent/child) in selenium java

    - by sai kumar
    My Application having TreePanel Element and I have to select the root node at the begining to add child node underit. When I try to click on root node using its XPATH String locator = "//div[@id='resultPropertyTree']/div/table/tbody/tr/td"; selenium.clickAt(locator,"0,1"); The entire element is going invisible hence script throwing debug exception saying the element is invisible/not got the focus etc. Can anybody help me out on handling above is appreciated. Regards Sai

    Read the article

  • Html Agility Pack: DescendantsOrSelf() not returning HTML element

    - by Program.X
    I have some HTML, eg: <%@ Page Title="About Us" Language="C#" MasterPageFile="~/Site.master" AutoEventWireup="true" CodeBehind="ContentManagedTargetPage.aspx.cs" Inherits="xxx.ContentManagedTargetPage" %> <%@ Register TagPrefix="CxCMS" Namespace="xxx.ContentManagement.ASPNET.UI" Assembly="xxx.ContentManagement.ASPNET" %> <asp:Content ID="HeaderContent" runat="server" ContentPlaceHolderID="HeadContent"> </asp:Content> <asp:Content ID="BodyContent" runat="server" ContentPlaceHolderID="MainContent"> <h2> Content Managed </h2> <p> Put content here. [<CxCMS:ContentManagedPlaceHolder Key="keyThingy" runat="server" />] </p> </asp:Content> And I want to find all the instances of the CxCMS:ContentManagedPlaceHolder element. I'm using HTML Agility Pack, which seems the best fit. However, despite looking at the [meagre] documentation, I can't get my code to work. I would expect the following to work: string searchForElement = "CxCMS:ContentManagedPlaceHolder"; IEnumerable<HtmlNode> contentPlaceHolderHtmlNodes = HtmlDocument.DocumentNode.Descendants(searchForElement); int count = contentPlaceHolderHtmlNodes.Count(); But I get nothing back. If I change to DescendantsOrSelf, I get the document node back, "#document" - which is incorrect: string searchForElement = "CxCMS:ContentManagedPlaceHolder"; IEnumerable<HtmlNode> contentPlaceHolderHtmlNodes = HtmlDocument.DocumentNode.DescendantsOrSelf(searchForElement); int count = contentPlaceHolderHtmlNodes.Count(); I also tried using LINQ: string searchForElement = "CxCMS:ContentManagedPlaceHolder"; IEnumerable<HtmlNode> contentPlaceHolderHtmlNodes = HtmlDocument.DocumentNode.DescendantsOrSelf().Where(q=>q.Name==searchForElement); int count = contentPlaceHolderHtmlNodes.Count(); As neither of these methods work, I moved onto using SelectNodes, instead: string searchForElement = "CxCMS:ContentManagedPlaceHolder"; string xPath="//"+searchForElement // "//CxCMS:ContentManagedPlaceHolder" var nodes= HtmlDocument.DocumentNode.SelectNodes(xPath); This just throws the exception: "Namespace Manager or XsltContext needed. This query has a prefix, variable, or user-defined function.". I can't find any way of adding namespace management to the HtmlDocument object. What am I missing, here? The DescendantsOrSelf() method works if using a "standard" HTML tag, such as "p", but not the one I have. Surely it should work? (It needs to!)

    Read the article

  • Query an XmlDocument without getting a 'Namespace prefix is not defined' problem

    - by Dan Revell
    I've got an Xml document that both defines and references some namespaces. I load it into an XmlDocument object and to the best of my knowledge I create a XmlNamespaceManager object with which to query Xpath against. Problem is I'm getting XPath exceptions that the namespace "my" is not defined. How do I get the namespace manager to see that the namespaces I am referencing are already defined. Or rather how do I get the namespace definitions from the document to the namespace manager. Furthermore tt strikes me as strange that you have to provide a namespace manager to the document which you create from the documents nametable in the first place. Even if you need to hardcode manual namespaces why can't you add them directly to the document. Why do you always have to pass this namespace manager with every single query? What can't XmlDocument just know? The Code: XmlDocument xmlDoc = new XmlDocument(); xmlDoc.Load(programFiles + @"Common Files\Microsoft Shared\web server extensions\12\TEMPLATE\FEATURES\HfscBookingWorkflow\template.xml"); XmlNamespaceManager ns = new XmlNamespaceManager(xmlDoc.NameTable); XmlNode referenceNode = xmlDoc.SelectSingleNode("/my:myFields/my:ReferenceNumber", ns); referenceNode.InnerXml = this.bookingData.ReferenceNumber; XmlNode titleNode = xmlDoc.SelectSingleNode("/my:myFields/my:Title", ns); titleNode.InnerXml = this.bookingData.FamilyName; ... The Xml: <?xml version="1.0" encoding="UTF-8" ?> <?mso-infoPathSolution name="urn:schemas-microsoft-com:office:infopath:Inspection:-myXSD-2010-01-15T18-21-55" solutionVersion="1.0.0.104" productVersion="12.0.0" PIVersion="1.0.0.0" ?> <?mso-application progid="InfoPath.Document" versionProgid="InfoPath.Document.2"?> - <my:myFields xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xhtml="http://www.w3.org/1999/xhtml" xmlns:my="http://schemas.microsoft.com/office/infopath/2003/myXSD/2010-01-15T18:21:55" xmlns:xd="http://schemas.microsoft.com/office/infopath/2003"> <my:DateRequested xsi:nil="true" /> <my:DateVisited xsi:nil="true" /> <my:ReferenceNumber /> <my:FireCall>false</my:FireCall> ...

    Read the article

< Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >