Search Results

Search found 4501 results on 181 pages for 'vostro 1000'.

Page 106/181 | < Previous Page | 102 103 104 105 106 107 108 109 110 111 112 113  | Next Page >

  • ArithmeticException Java?

    - by KP65
    Can anyone help me find where the execption is? I can't seem to find the problem.. public void fieldChanged(Field f, int context){ //if the submit button is clicked try{ stopTime = System.currentTimeMillis(); timeTaken = stopTime - startTime; timeInSecs = ((timeTaken/1000)); speed = 45/timeInSecs; Dialog.alert("Speed of Delivery: " + speed + "mph"); } catch(ArithmeticException e){ Dialog.alert("error " + speed); e.printStackTrace(); } } startTime variable is a global variable..

    Read the article

  • Datagrid row height doesnot shrink back

    - by prince23
    Hi, I have a data grid, in each row I have one cell which needs to have a very lengthy text which is about 1000 characters long. So I decided to put the text in the expander control keeping the cell width fixed, when the user wants to read the text, he clicks on the expander to open and reads it. The row height automatically grows when the expander is expanded but when the expander is collapsed back, the row height doesnt shirk. Can anyone pls tell me how to set the row height back after the expander is collapsed? i tried the follwing link. http://forums.silverlight.net/forums/p/133177/299186.aspx#299186 but this did not work any help would be grealty appreciated, thanks

    Read the article

  • jQuery display problem?

    - by SLAPme
    How do I hide the #changes-saved code using jQuery? For example let's say the code is displayed when the user clicks the submit button and then leaves the current web page and then returns back to the web page and the #changes-saved is no longer displayed until the submit button is clicked again. Here is the jQuery code. $(function() { $('#changes-saved').hide(); $(".save-button").click(function() { $.post($("#contact-form").attr("action"), $("#contact-form").serialize(), function(html) { $("div.contact-info-form").html(html); $('#changes-saved').append('<li>Changes saved!</li>').show().pause(1000).hide(); }); return false; // Prevent normal submit. }); });

    Read the article

  • How to get time difference in milliseconds

    - by jason45
    Hi, I can't wrap my brain around this one so I hope someone can help. I have a song track that has the song length in milliseconds. I also have the date the song played in DATETIME format. What I am trying to do is find out how many milliseconds is left in the song play time. Example $tracktime = 219238; $dateplayed = '2011-01-17 11:01:44'; $starttime = strtotime($dateplayed); I am using the following to determine time left but it does not seem correct. $curtime = time(); $timeleft = $starttime+round($tracktime/1000)-$curtime; Any help would be greatly appreciated.

    Read the article

  • Make text appear briefly in a JPanel

    - by Roo
    Hi, I am trying to make text appear briefly before it disappears. It would be along the lines of 1) Set color to black 2) wait x amount of seconds 3) set color to background color The method I call is repaint(), which then calls paintComponent(Graphics painter). repaint() is called only if I press the space-bar. I thought of trying repaint();Thread.sleep(1000);repaint(); (I do catch the Interrupt exception, just not shown), but it only calls paintComponent once per space-bar . Is there an easy way to do this or is this something that is a bit challenging?

    Read the article

  • Pagination using Ajax in jquery Datatables

    - by kshtjsnghl
    I am using dataTables plugin for a table on a page I am working on. Its basically fetching rows through an ajax call and in this ajax call, I send the search params that the user selects and the page number required. I need the Next, Previous, First and Last buttons to also fire the same ajax call, but with different page numbers, as the back-end interceptor depends on the page number. This api call would return total no. of rows(say 1000) belonging for these search params and the rows with the page size( say 50). Is there any way, I can use data table to do this?

    Read the article

  • SqlCeCommand ExecuteNonQuery performance issue

    - by Michael
    I've been asked to resolve an issue with a .Net/SqlServerCe application. Specifically, after repeated inserts against the db, performance becomes increasingly degraded. In one instance at ~200 rows, in another at ~1000 rows. In the latter case the code being used looks like this: Dim cm1 As System.Data.SqlServerCe.SqlCeCommand = cn1.CreateCommand cm1.CommandText = "INSERT INTO Table1 Values(?,?,?,?,?,?,?,?,?,?,?,?,?)" For j = 0 To ds.Tables(0).Rows.Count - 1 'this is 3110 For i = 0 To 12 cm1.Parameters(tbl(i, 0)).Value = Vals(j,i) 'values taken from a different db Next cm1.ExecuteNonQuery() Next The specifics aren't super important (like what 'tbl' is, etc) but rather whether or not this code should be expected to handle this number of inserts, or if the crawl I'm witnessing is to be expected.

    Read the article

  • Rails easy shop

    - by ciss
    I have some question about data organization in my shop. So, after easy mind hacking i decide to create three models: Item, Property and PropertyType Item: id,property_id Property: id, data, property_type_id #(data, serialized object with something like what: {:color => "red", :price => 1000} PropertyType: id, data #(data, also serialized object with {:color => :string, :price => :fixnum}) So, does this good or bad idea? I predict what I can find some problems with validations. But I really need some fields created by user via admin-panel (now I'm talking about Item Properties, which can be changed in any time)

    Read the article

  • Calling class in Java after editing file used in as source for table

    - by user2892290
    I'm currently working on a project, I'll try to subrscibe first. I save data into text file, that I use as a source for browser of that data. The browser is based on table that contains the data. I have to rewrite the source file everytime I delete or edit data. That's where the problem comes in. After deleting or editing data I call a method to create the table again, but the table never creates. Is it possibly made by editing the file and calling the method right after that? If I restart my app the table is successfully created with right data. Take in note that I don't get any error message. This is the method I use for loading data from source file: try (BufferedReader input1 = new BufferedReader(new FileReader("./src/data.src"))) { int lines = 0; while (input1.read() != -1) { if (!(input1.readLine()).equals("")) { lines++; } } input1.close(); if (lines == 0) { JOptionPane.showMessageDialog(null, "No data to load, create a note first!"); new Writer().build(frame); } else { try (BufferedReader input = new BufferedReader(new FileReader("./src/data.src"))) { Game[] g = new Game[lines]; String currentLine; String[] help; int counter = 0; while (lines > 0) { currentLine = input.readLine(); help = currentLine.split("#"); g[counter] = new Game(help[0],help[1], help[2], help[3], help[4], help[5], help[6], help[7], help[8], help[9]); counter++; lines--; } input.close(); final JButton bButton = new backButton().create(frame, mPanel); build(g, frame, bButton); mPanel.add(panel); mPanel.add(panel2); mPanel.add(searchPanel); mPanel.add(bButton); bButton.addActionListener(new ActionListener() { @Override public void actionPerformed(ActionEvent e) { frame.setCursor(Cursor.getPredefinedCursor(Cursor.WAIT_CURSOR)); panel.removeAll(); frame.setCursor(Cursor.getDefaultCursor()); } }); mPanel.setPreferredSize(new Dimension(1000, 750)); panel.setBorder(new EmptyBorder(10, 10, 10, 10)); frame.setLayout(new FlowLayout()); frame.add(mPanel); frame.pack(); JMenuBar menuBar = new Menu().create(frame, mPanel); frame.setJMenuBar(menuBar); frame.setVisible(true); Rectangle rec = GraphicsEnvironment.getLocalGraphicsEnvironment().getMaximumWindowBounds(); int width = (int) rec.getWidth(); int height = (int) rec.getHeight(); frame.setBounds(1, 3, width, height); frame.addComponentListener(new ComponentAdapter() { @Override public void componentMoved(ComponentEvent e) { frame.setLocation(1, 3); } }); And this is the method I use for creating the table: String[][] tableData = new String[g.length][9]; for (int i = 0; i < tableData.length; i++) { tableData[i][0] = g[i].getChampion(); tableData[i][1] = g[i].getRole(); tableData[i][2] = g[i].getEnemy(); tableData[i][3] = g[i].getDifficulty(); tableData[i][4] = g[i].getResult(); tableData[i][5] = g[i].getScore(); tableData[i][6] = g[i].getGameType(); tableData[i][7] = g[i].getPoints(); tableData[i][8] = g[i].getLeague(); } final JLabel searchLabel = new JLabel("Search for champion played."); final JButton searchButton = new JButton("Search"); final JTextField searchText = new JTextField(20); frame.setTitle("LoL Notepad - reading your notes"); JTable table = new JTable(tableData, columnNames); final JScrollPane scrollPane = new JScrollPane(table); scrollPane.setPreferredSize(new Dimension(980, 500)); panel2.setPreferredSize(new Dimension(1000, 550)); panel2.setVisible(false); panel2.setBorder(new EmptyBorder(10, 10, 10, 10)); panel3.setVisible(false); panel.setLayout(new FlowLayout()); panel.add(scrollPane); searchPanel.add(searchLabel); searchPanel.add(searchText); searchPanel.add(searchButton); searchButton.addActionListener(new ActionListener() { @Override public void actionPerformed(ActionEvent e) { try { frame.setCursor(Cursor.getPredefinedCursor(Cursor.WAIT_CURSOR)); search(g, searchText.getText(), frame, bButton); frame.setCursor(Cursor.getDefaultCursor()); } catch (IOException ex) { Logger.getLogger(Reader.class.getName()).log(Level.SEVERE, null, ex); } } }); table.addMouseListener(new MouseAdapter() { @Override public void mousePressed(MouseEvent e) { if (e.getClickCount() == 1) { JTable target = (JTable) e.getSource(); panel.setVisible(false); searchPanel.setVisible(false); bButton.setVisible(false); int row = target.getSelectedRow(); specific(row, g, frame, bButton); } } });

    Read the article

  • Threading and iterating through changing collections

    - by adamjellyit
    In C# (console app) I want to hold a collection of objects. All objects are of same type. I want to iterate through the collection calling a method on each object. And then repeat the process continuously. However during iteration objects can be added or removed from the list. (The objects themselves will not be destroyed .. just removed from the list). Not sure what would happen with a foreach loop .. or other similar method. This has to have been done 1000 times before .. can you recommend a solid approach?

    Read the article

  • Sending message to multiple contacts of mobile by providing search facility in J2ME

    - by learn
    I wan to send the message to multiple contacts in the contactlist for(int j=0;j<vector.size();j++){ listofContacts=new ListofContacts(); listofContacts=(ListofContacts)vector.elementAt(j); list.setFitPolicy(1); list.append(listofContacts.contactname + " "+ listofContacts.contactno,null); System.out.println(listofContacts.contactname + " "+ listofContacts.contactno); } here i have taken all the contacts of contact list in vector and the listofcontacts is the class containing the name and number. To show the list of contacts for selection i am using list control with multiple choice. The code is working fine and message is sent to all the contacts which are selected by the user but as we know there may be 1000 of contacts in phonebook and in these case to select a particular user we have to scroll down the list. Now how to keep the search facility so that we can directly go to the required contact and if it is not possible with the list control which control is to be used so that multiple contacts can be selected and also search facility is available.

    Read the article

  • Long to timestamp for historic data (pre-1900s)

    - by Mike
    I have a database of start and stop times that have previously all had fairly recent data (1960s through present day) which i've been able to store as long integers. This is very simialr to unix timestamps, only with millisecond precision, so a function like java.util.Date.getTime() would be the value of the current time. This has worked well so far, but we recently got data from the 1860s, and the following code no longer works: to_timestamp('1-JAN-1970 00:00:00', 'dd-mon-yyyy hh24:mi:ss') + numtodsinterval(int_to_convert/(1000),'SECOND' ); This wraps the date and we get timestamps in the year 2038. Is there a way around this issue? All of the documentation i've looked at the documentation and timestamps should be able to handle years all the way back to the -4000 (BC), so i'm suspecting an issue with the numtodsinterval. Any ideas suggestions would be greatly appreciated.

    Read the article

  • Is it possible to implement a lightweight database using Blackberry Persistance options?

    - by Tobias
    First I would like to explain why I want to use alternate Blackberry Persistance options rather than a Blackberry database itself, say SQLite. The reason is that the application i'm designing, I want it to be used in all the previous versions of Blackberry rather than just the ones having OS 5.0 or greater. Now, coming back to the actual question, I have got a database that I want to replicate to be used in the Blackberry application. The database has 8 tables and each table has approximately 12 different columns. One of the table has 1000 rows. Now if I was to implement this DB for a Blackberry application , keeping in mind that it will work on all the versions of Blackberry, what would be the best way to implement it?

    Read the article

  • Is there a way in C# 4.0 to have a method take a delegate with the parameters baked in?

    - by Rob Packwood
    I have this code for reporting on a simple demo app I am writing: private static void ReportOnTimedProcess(Action process) { var stopwatch = new Stopwatch(); stopwatch.Start(); process(); stopwatch.Stop(); Console.WriteLine("Process took {0} seconds", stopwatch.ElapsedMilliseconds*1000); } I basically want to track the time of any process. I am trying to have this method take a delegate as a parameter that can have any number of varying parameters. Is there some way an Expression can do this?

    Read the article

  • Problem with jQuery animation

    - by Daemon
    I have a problem with an animation in jQuery using ajax. On the click of an button (actually an tag), I call a ajax method, and have the following written inside the success parameter: success: function(msg) { $('.ContentsMainRight').children().fadeOut(500, function() { $('.ContentsMainRight').html(msg.d); $('.ContentsMainRight').children().fadeIn(1000); }); }, This have the following result. The contents of a div fade out over 500ms as it's supposed to. Then the html contents of the div are swapped, but then the last part did not work as I hoped. The html returned by the ajax method include some text inside a tag, and a image inside a tag. The result is that the text is automatically displayed instantly with no fadein, but the img that is put fades in over 1 second. Why is the text and image treated differently? -Daemon

    Read the article

  • Getting service unavailable message when sending messages to google xmpp using wokkel

    - by Code freak
    Hi, I made a wokkel (twisted python) bot to send and receive messages from the google xmpp service. Everything (auth, presence) etc works fine. One of the rquirements of our prject is that we need to send broadcast messages to everyone in the list. Normal messages and replies work fin, but when i snd a broadcast message, i get this service unavailable error 503 message. There are about 1000 user in my contact list. Is this some bug in the code or is it google policy to prevent rapid messaging. Also, how do other google bots cater to a large contact base ? does google provide a commercial solution for such applications ? Thanks

    Read the article

  • wcf net.tcp service fails to start when extra properties are set

    - by Pharabus
    i have a current project that runs fine with a self hosted net.tcp binding if I uses the following host.AddServiceEndpoint(typeof(IMonitorService), new NetTcpBinding() {PortSharingEnabled = false }, ""); host.AddServiceEndpoint(ServiceMetadataBehavior.MexContractName, MetadataExchangeBindings.CreateMexTcpBinding(), "mex"); however if I ammend to the below it fails to run with the message that there is already an endpoint on the port, can anyone explain why adding the extra properties causes it to fail? host.AddServiceEndpoint(typeof(IMonitorService), new NetTcpBinding() {PortSharingEnabled = false,ListenBacklog=1000,ReceiveTimeout=new TimeSpan(0,3,0) }, ""); host.AddServiceEndpoint(ServiceMetadataBehavior.MexContractName, MetadataExchangeBindings.CreateMexTcpBinding(), "mex"); Edit: testing confirms that the ReceiveTimeout property works Ok, as soon as I add the MaxConnections or ListenBacklog the service fails start Edit 2: this link seems to imply i ned portsharing is i want to modify these properies, not sure I am understanding it.

    Read the article

  • Filtering Data in a Text File with Python

    - by YAS
    I'm new to Python (like Zygote new), and it's just to supplement another program but what I need is I have a text file that's a group of items for a game and it is formatted so: [1] Name=Blah Faction=Blahdiddly Cost=1000 [2] Name=Meh Faction=MehMeh Cost=2000 [3] Name=Lollypop Faction=Blahdiddly Cost=100 And I need to be able to find out what groups (the numbers in brackets) have matching values. So if I search Faction=Blahdiddly Group 1 & 3 will come up. I unfortunately have NO idea how to do this. Can anyone help?

    Read the article

  • What kind of hosting is used for *tube sites?

    - by playcat
    Hello, I'm not sure if this is the right place for this question, and will be happy to remove the Q if needed. When a site grows from a just-a-fun project to a site with bigger load of visitor, and you want to enable them to upload videos, you might find yourself in a need of a better hosting, including dedicated server and a no-limit web traffic (or some reasonable limit). So, if people can upload their videos, and if page has around 1000-10000 visitors per day, what kind of hosting is there to choose from? What is needed in that case? Thx

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • how to get change event on created fields in jquery

    - by frosty
    I have some jquery code the creates an quantity text box. Like so <input type="text" value="1000" class="qty" name="[0].Quantity"> I wish to add some validation to this text box but can hit the method. I believe i need to utlise Live(). But can't quite figure out how this is implemented. This is where i'm at $(document).ready(function () { $(".qty").change(checkValue); }); function checkValue() { alert("on change"); }

    Read the article

  • Selecting a sequence of elements from the IList

    - by KhanS
    I have a IList. where the object PersonDetails consists of the persons name, address and phone number. The list consists of more than 1000 person details. I would like to display 50 PersonDetails per page. Is there a way to select only 50 elements from the list, and return them. For example. myList.select(1,50) myList.select(51, 100) I am able to select only first 50 by using. myList.Take(50); The entire list is at the wcf service, and i would like to get only fifty elements at a time.

    Read the article

  • networkstream always empty!

    - by ALEX
    hey I'm writing on an Server-Client program but when my client sends something, it never reaches my server! I'm sending like this: public void Send(string s) { char[] chars = s.ToCharArray(); byte[] bytes = chars.CharToByte(); nstream.Write(bytes, 0, bytes.Length); nstream.Flush(); } and Receiving in a background thread like this void CheckIncoming(object dd) { RecievedDelegate d = (RecievedDelegate)dd; try { while (true) { List<byte> bytelist = new List<byte>(); System.Threading.Thread.Sleep(1000); int ssss; ssss = nstream.ReadByte(); if (ssss > 1) { System.Diagnostics.Debugger.Break(); } if (bytelist.Count != 0) { d.Invoke(bytelist.ToArray()); } } } catch (Exception exp) { MSGBOX("ERROR:\n" + exp.Message); } } the ssss int is never 1 whats happening here???

    Read the article

  • How do you automatically refresh part of a page automatically using AJAX?

    - by Ryan
    $messages = $db->query("SELECT * FROM chatmessages ORDER BY datetime DESC, displayorderid DESC LIMIT 0,10"); while($message = $db->fetch_array($messages)) { $oldmessages[] = $message['message']; } $oldmessages = array_reverse($oldmessages); ?> <div id="chat"> <?php for ($count = 0; $count < 9; $count++) { echo $oldmessages[$count]; } ?> <script language="javascript" type="text/javascript"> <!-- setInterval( "document.getElementById('chat').innerHTML='<NEW CONTENT OF #CHAT>'", 1000 ); --> </script> </div> I'm trying to create a PHP chatroom script but I'm having a lot of trouble getting it to AutoRefresh The content should automatically update to , how do you make it do that? I've been searching for almost an hour

    Read the article

  • What magical thing could be killing my Drupal session and anywhere from 15-45 minutes of activity?

    - by jini
    I am using a standard Drupal install hosted on a LAMP stack. My settings.php has the following set: ini_set('session.gc_probability', 1); ini_set('session.gc_divisor', 100); ini_set('session.gc_maxlifetime', 200000); ini_set('session.cookie_lifetime', 2000000); my php.ini file has: session.gc_probability = 1 session.gc_divisor = 1000 session.gc_maxlifetime = 1440 Also I have checked that the safe mode is off so that my settings.php file is able to override main php.ini variables. Also since the person can get log out at 15 minutes, it is making me wonder whether php.ini has anything to do with it anyways. I have combed through my code and it seems to work fine on my local host however on server it is having issues. Where else can i possibly check?????

    Read the article

< Previous Page | 102 103 104 105 106 107 108 109 110 111 112 113  | Next Page >