Search Results

Search found 22128 results on 886 pages for 'point in polygon'.

Page 108/886 | < Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >

  • Android Accessing Accelerometer: Returns always 0 as Value

    - by Rotesmofa
    Hello there, i would like to use the accelerometer in an Android Handset for my Application. The data from the sensor will be saved together with a GPS Point, so the Value is only needed when the GPS Point is updated. If i use the attached Code the values is always zero. API Level 8 Permissions: Internet, Fine Location Testing Device: Galaxy S(i9000), Nexus One Any Suggestions? I am stuck at this point. Best regards from Germany, Pascal import android.app.Activity; import android.hardware.Sensor; import android.hardware.SensorEvent; import android.hardware.SensorEventListener; import android.hardware.SensorManager; import android.os.Bundle; public class AccelerometerService extends Activity{ AccelerometerData accelerometerData; private SensorManager mSensorManager; private float x,y,z; private class AccelerometerData implements SensorEventListener{ public void onSensorChanged(SensorEvent event) { x = event.values[0]; y = event.values[1]; z = event.values[2]; } public void onAccuracyChanged(Sensor sensor, int accuracy) {} } @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); mSensorManager = (SensorManager) getSystemService(SENSOR_SERVICE); mSensorManager.registerListener(accelerometerData, mSensorManager.getDefaultSensor(Sensor.TYPE_ACCELEROMETER), SensorManager.SENSOR_DELAY_FASTEST); } @Override protected void onResume() { super.onResume(); } @Override protected void onStop() { mSensorManager.unregisterListener(accelerometerData); super.onStop(); } public String getSensorString() { return ("X: " + x+"m/s, Y: "+ y +"m/s, Z: "+ z +"m/s" ); } }

    Read the article

  • google maps not showing actual map and postcode

    - by Andy
    Im trying to pass a dynamically generated postode to a page. But currently its not showing the map correctly. Any ideas? Heres my head tag <script src="http://www.google.com/jsapi?key=ABQIAAAANQzcZVPOkiHWMZO3zxREGRSlIja3KBL7jZ08tky_uJrV3vVYdxTCwTHJPA2Vn06DLdnCWvRW_w7VYQ" type="text/javascript"></script> <script language="Javascript" type="text/javascript"> var localSearch; var map; var icon; var addressMarkerOptions; google.load("search", "1"); google.load("maps", "2"); google.setOnLoadCallback(initialize); function initialize() { localSearch = new GlocalSearch(); icon = new GIcon(G_DEFAULT_ICON); addressMarkerOptions = { icon:icon , draggable: false}; map = new GMap2(document.getElementById("map")); map.addControl(new GLargeMapControl()); map.addControl(new GMapTypeControl()); plotAddress("OX4 1FJ"); } /** * This takes either a postcode or an address string * */ function plotAddress(address) { localSearch.setSearchCompleteCallback(null, function() { if (localSearch.results[0]) { var resultLat = localSearch.results[0].lat; var resultLng = localSearch.results[0].lng; var point = new GLatLng(resultLat,resultLng); var marker = new GMarker(point, addressMarkerOptions); map.addOverlay(marker); map.setCenter(point, 5, G_NORMAL_MAP); } else { alert('address not found'); } }); localSearch.execute(address + ", UK"); } </script> It slots into the code below: <div id="map">Loading...</div>

    Read the article

  • Perceptron Classification and Model Training

    - by jake pinedo
    I'm having an issue with understanding how the Perceptron algorithm works and implementing it. cLabel = 0 #class label: corresponds directly with featureVectors and tweets for m in range(miters): for point in featureVectors: margin = answers[cLabel] * self.dot_product(point, w) if margin <= 0: modifier = float(lrate) * float(answers[cLabel]) modifiedPoint = point for x in modifiedPoint: if x != 0: x *= modifier newWeight = [modifiedPoint[i] + w[i] for i in range(len(w))] w = newWeight self._learnedWeight = w This is what I've implemented so far, where I have a list of class labels in answers and a learning rate (lrate) and a list of feature vectors. I run it for the numbers of iterations in miter and then get the final weight at the end. However, I'm not sure what to do with this weight. I've trained the perceptron and now I have to classify a set of tweets, but I don't know how to do that. EDIT: Specifically, what I do in my classify method is I go through and create a feature vector for the data I'm given, which isn't a problem at all, and then I take the self._learnedWeight that I get from the earlier training code and compute the dot-product of the vector and the weight. My weight and feature vectors include a bias in the 0th term of the list so I'm including that. I then check to see if the dotproduct is less than or equal to 0: if so, then I classify it as -1. Otherwise, it's 1. However, this doesn't seem to be working correctly.

    Read the article

  • C# WinForm Drawing - how to clear and redraw

    - by StoneHeart
    Here is screen shot of my game. On the left is my problem, seem "old draw" still existing. On the right is what it should be. http://img682.imageshack.us/img682/1058/38995989.jpg drawing code Graphics g = e.Graphics; for (int i = 1; i < 27; i += 1) { for (int j = 0; j < 18; j += 1) { ZPoint zp = zpoints[i, j]; if (zp != null) { g.DrawImage(zp.sprite_index, new Point(zp.x, zp.y)); Image arrow; if (zp.sprite_index == spr_green_zpoint) { arrow = spr_green_arrows[zp.image_index]; } else if (zp.sprite_index == spr_red_zpoint) { arrow = spr_red_arrows[zp.image_index]; } else { arrow = spr_grey_arrows[zp.image_index]; } g.DrawImage(arrow, new Point(zp.x - 4, zp.y - 4)); } } } if (latest_p1 != -1 && latest_p2 != -1) { ZPoint zp = zpoints[latest_p1, latest_p2]; if (zp != null) { g.DrawImage(spr_focus, new Point(zp.x - 6, zp.y - 6)); } }

    Read the article

  • HLSL - How can I set sampler Min/Mag/Mip filters to disable all filtering/anti-aliasing?

    - by RJFalconer
    I have a tex2D sampler I want to only return precisely those colours that are present on my texture. In the event of a texel overlapping multiple colours, I want it to pick one and have the whole texel be that colour. I think to do this I want to disable mipmapping, or at least trilinear filtering of mips. sampler2D gColourmapSampler : register(s0) = sampler_state { Texture = <gColourmapTexture>; //Defined above MinFilter = None; //Controls sampling. None, Linear, or Point. MagFilter = None; //Controls sampling. None, Linear, or Point. MipFilter = None; //Controls how the mips are generated. None, Linear, or Point. //... }; My problem is I don't really understand Min/Mag/Mip filtering, so am not sure what combination I need to set these in, or if this is even what I am after. MSDN has this to say; D3DSAMP_MAGFILTER: Magnification filter of type D3DTEXTUREFILTERTYPE D3DSAMP_MINFILTER: Minification filter of type D3DTEXTUREFILTERTYPE. D3DSAMP_MIPFILTER: Mipmap filter to use during minification. See D3DTEXTUREFILTERTYPE. D3DTEXF_NONE: When used with D3DSAMP_MIPFILTER, disables mipmapping.

    Read the article

  • Systems design question: DB connection management in load-balanced n-tier

    - by aoven
    I'm wondering about the best approach to designing a DB connection manager for a load-balanced n-tier system. Classic n-tier looks like this: Client -> BusinessServer -> DBServer A load-balancing solution as I see it would then look like this: +--> ... +--+ +--> BusinessServer +--+--> SessionServer --+ Client -> Gateway --+--> BusinessServer +--| +--> DBServer +--> BusinessServer +--+--------------------+ +--> ... +--+ As pictured, the business server component is being load-balanced via multiple instances, and a hardware gateway is distributing the load among them. Session server probably needs to be situated outside the load-balancing array, because it manages state, which mustn't be duplicated. Barring any major errors in design so far, what is the best way to implement DB connection management? I've come up with a couple of options, but there may be others I'm not aware of: Introduce a new Broker component between the DBServer and the other components and let it handle the DB connections. The upside is that all the connections can be managed from a single point, which is very convenient. The downside is that now there is an additional "single point of failure" in the system. Other components must go through it for every request that involves DB in some way, which also makes this a bottleneck. Move the DB connection management into BusinessServer and SessionServer components and let each handle its own DB connections. The upside is that there is no additional "single point of failure" or bottleneck components. The downside is that there is also no control over possible conflicts and deadlocks apart from what DBServer itself can provide. What else can be done? FWIW: Technology is .NET, but none of the vendor-specific stacks are used (e.g. no WCF, MSMQ or the like).

    Read the article

  • How can I set up an editor to work with Git on Windows?

    - by Patrick McElhaney
    I'm trying out Git on Windows. I got to the point of trying "git commit" and I got this error: Terminal is dumb but no VISUAL nor EDITOR defined. Please supply the message using either -m or -F option. So I figured out I need to have an environment variable called EDITOR. No problem. I set it to point to Notepad. That worked, almost. The default commit message opens in Notepad. But Notepad doesn't support bare line feeds. I went out and got Notepad++. But I can't figure out how to get Notepad++ set up as the %EDITOR% in such a way that it works with Git as expected. I'm not married to Notepad++. At this point I couldn't care less what editor I use. I just want to be able to type my commit messages without using -m. So, for those of you using Git on Windows: What (free) tool do you use to edit your commit message, and what do you get when you type echo %EDITOR% at the command prompt?

    Read the article

  • Float addition promoted to double?

    - by Andreas Brinck
    I had a small WTF moment this morning. Ths WTF can be summarized with this: float x = 0.2f; float y = 0.1f; float z = x + y; assert(z == x + y); //This assert is triggered! (Atleast with visual studio 2008) The reason seems to be that the expression x + y is promoted to double and compared with the truncated version in z. (If i change z to double the assert isn't triggered). I can see that for precision reasons it would make sense to perform all floating point arithmetics in double precision before converting the result to single precision. I found the following paragraph in the standard (which I guess I sort of already knew, but not in this context): 4.6.1. "An rvalue of type float can be converted to an rvalue of type double. The value is unchanged" My question is, is x + y guaranteed to be promoted to double or is at the compiler's discretion? UPDATE: Since many people has claimed that one shouldn't use == for floating point, I just wanted to state that in the specific case I'm working with, an exact comparison is justified. Floating point comparision is tricky, here's an interesting link on the subject which I think hasn't been mentioned.

    Read the article

  • WriteableBitmap failing badly, pixel array very inaccurate

    - by dawmail333
    I have tried, literally for hours, and I have not been able to budge this problem. I have a UserControl, that is 800x369, and it contains, simply, a path that forms a worldmap. I put this on a landscape page, then I render it into a WriteableBitmap. I then run a conversion to turn the 1d Pixels array into a 2d array of integers. Then, to check the conversion, I wire up the custom control's click command to use the Point.X and Point.Y relative to the custom control in the newly created array. My logic is thus: wb = new WriteableBitmap(worldMap, new TranslateTransform()); wb.Invalidate(); intTest = wb.Pixels.To2DArray(wb.PixelWidth); My conversion logic is as such: public static int[,] To2DArray(this int[] arr,int rowLength) { int[,] output = new int[rowLength, arr.Length / rowLength]; if (arr.Length % rowLength != 0) throw new IndexOutOfRangeException(); for (int i = 0; i < arr.Length; i++) { output[i % rowLength, i / rowLength] = arr[i]; } return output; } Now, when I do the checking, I get completely and utterly strange results: apparently all pixels are either at values of -1 or 0, and these values are completely independent of the original colours. Just for posterity: here's my checking code: private void Check(object sender, MouseButtonEventArgs e) { Point click = e.GetPosition(worldMap); ChangeNotification(intTest[(int)click.X,(int)click.Y].ToString()); } The result show absolutely no correlation to the path that the WriteableBitmap has rendered into it. The path has a fill of solid white. What the heck is going on? I've tried for hours with no luck. Please, this is the major problem stopping me from submitting my first WP7 app. Any guidance?

    Read the article

  • A weird crash...

    - by Nima
    Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

    Read the article

  • Auto-implemented getters and setters vs. public fields

    - by tclem
    I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

    Read the article

  • TSQL - make a literal float value

    - by David B
    I understand the host of issues in comparing floats, and lament their use in this case - but I'm not the table author and have only a small hurdle to climb... Someone has decided to use floats as you'd expect GUIDs to be used. I need to retrieve all the records with a specific float value. sp_help MyTable -- Column_name Type Computed Length Prec -- RandomGrouping float no 8 53 Here's my naive attempt: --yields no results SELECT RandomGrouping FROM MyTable WHERE RandomGrouping = 0.867153569942739 And here's an approximately working attempt: --yields 2 records SELECT RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.867153569942739 - 0.00000001 AND 0.867153569942739 + 0.00000001 -- 0.867153569942739 -- 0.867153569942739 In my naive attempt, is that literal a floating point literal? Or is it really a decimal literal that gets converted later? If my literal is not a floating point literal, what is the syntax for making a floating point literal? EDIT: Another possibility has occurred to me... it may be that a more precise number than is displayed is stored in this column. It may be impossible to create a literal that represents this number. I will accept answers that demonstrate that this is the case. EDIT: response to DVK. TSQL is MSSQLServer's dialect of SQL. This script works, and so equality can be performed deterministically between float types: DECLARE @X float SELECT top 1 @X = RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.839110948199148 - 0.000000000001 AND 0.839110948199148 + 0.000000000001 --yields two records SELECT * FROM MyTable WHERE RandomGrouping = @X I said "approximately" because that method tests for a range. With that method I could get values that are not equal to my intended value. The linked article doesn't apply because I'm not (intentionally) trying to straddle the world boundaries between decimal and float. I'm trying to work with only floats. This isn't about the non-convertibility of decimals to floats.

    Read the article

  • Signable, streamable, "readable" archive format?

    - by alexvoda
    Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • Multiple marker icons, how to add to google mashup

    - by user351189
    I have created a Google maps mashup, where with a bit of input, I have managed to have a sidebar that links to a video icon/marker that then opens up an info window showing virtual tours. I would, however, like to put different coloured marker icons on the map depending on the category that the video is in. This would be easy enough to do, but my page is made up of a mixture of J-Query and JavaScript all calling to the individual flash files. Could someone help me with the code for adding extra marker icons for different categories? Here is the code: So, after the intial 'var camera;' point, there comes this: function addMarker(point, title, video, details) { var marker = new GMarker(point, {title: title, icon:camera}); GEvent.addListener(marker, "click", function() { if (details) { marker.openInfoWindowTabsHtml([new GInfoWindowTab("Video", video), new GInfoWindowTab("More", details)]); } else { marker.openInfoWindowHtml(video); } }); Then further down, is the code for calling the individual marker image. I would like to add another image to this list - would I start out by calling the new object 'camera-red.image' or something similar? function initialize() { if (GBrowserIsCompatible()) { map = new GMap2(document.getElementById("mapDiv")); map.setCenter(new GLatLng(51.52484592590448, -0.13345599174499512), 17); map.setUIToDefault(); var uclvtSatMapType = createUclVTSatMapType() map.addMapType(uclvtSatMapType); map.setMapType(uclvtSatMapType); camera = new GIcon(G_DEFAULT_ICON); camera.image = "ucl-video.png"; camera.iconSize = new GSize(32,37); camera.iconAnchor = new GPoint(16,35); camera.infoWindowAnchor = new GPoint(16,2); addMarkersToMap(); } The actual map can be found here: link text Thanks.

    Read the article

  • Optimize a views drawing code

    - by xon1c
    Hi, in a simple drawing application I have a model which has a NSMutableArray curvedPaths holding all the lines the user has drawn. A line itself is also a NSMutableArray, containing the point objects. As I draw curved NSBezier paths, my point array has the following structure: linePoint, controlPoint, controlPoint, linePoint, controlPoint, controlPoint, etc... I thought having one array holding all the points plus control points would be more efficient than dealing with 2 or 3 different arrays. Obviously my view draws the paths it gets from the model, which leads to the actual question: Is there a way to optimize the following code (inside the view's drawRect method) in terms of speed? int lineCount = [[model curvedPaths] count]; // Go through paths for (int i=0; i < lineCount; i++) { // Get the Color NSColor *theColor = [model getColorOfPath:[[model curvedPaths] objectAtIndex:i]]; // Get the points NSArray *thePoints = [model getPointsOfPath:[[model curvedPaths] objectAtIndex:i]]; // Create a new path for performance reasons NSBezierPath *path = [[NSBezierPath alloc] init]; // Set the color [theColor set]; // Move to first point without drawing [path moveToPoint:[[thePoints objectAtIndex:0] myNSPoint]]; int pointCount = [thePoints count] - 3; // Go through points for (int j=0; j < pointCount; j+=3) { [path curveToPoint:[[thePoints objectAtIndex:j+3] myNSPoint] controlPoint1:[[thePoints objectAtIndex:j+1] myNSPoint] controlPoint2:[[thePoints objectAtIndex:j+2] myNSPoint]]; } // Draw the path [path stroke]; // Bye stuff [path release]; [theColor release]; } Thanks, xonic

    Read the article

  • Silverlight horizontal stretch and get position issue

    - by David
    I have a Grid (container) wich in turn has several grids(subContainers) arranged by rows. Each one of those "subContainers" has diferent columns and controls. And each of those "subContainers" has the horizontal alignment set to stretch, and it has to stay that way, since the layout this viewer depends on it. I use the "container" to set each control on it's adequate position. So far so good. Now comes my headache... I want to remove the control from the grid and put it in a canvas, at the same exact position, only, the position it returns is as if the control is set to the beggining of the grid and not it's true position. For testing purposes, I've set the "subContainters" horizontal alignment to center and (despite the layout is totally wrong) every control is in it's right position when sent to a canvas, wich it doesn't happen when HA = stretch. Here's the code I'm using to get position: GeneralTransform gt = nc.TransformToVisual(gridZoom); Point offset = gt.Transform(new Point()); So you can understand, for example, my first control should be somewhere like (80, 1090), but the point that I get is (3,3). Can anyone help me? Thanks

    Read the article

< Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >