Search Results

Search found 3131 results on 126 pages for 'upper stage'.

Page 109/126 | < Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >

  • How to discover classes with [Authorize] attributes using Reflection in C#? (or How to build Dynamic

    - by Pretzel
    Maybe I should back-up and widen the scope before diving into the title question... I'm currently writing a web app in ASP.NET MVC 1.0 (although I do have MVC 2.0 installed on my PC, so I'm not exactly restricted to 1.0) -- I've started with the standard MVC project which has your basic "Welcome to ASP.NET MVC" and shows both the [Home] tab and [About] tab in the upper-right corner. Pretty standard, right? I've added 4 new Controller classes, let's call them "Astronomer", "Biologist", "Chemist", and "Physicist". Attached to each new controller class is the [Authorize] attribute. For example, for the BiologistController.cs [Authorize(Roles = "Biologist,Admin")] public class BiologistController : Controller { public ActionResult Index() { return View(); } } These [Authorize] tags naturally limit which user can access different controllers depending on Roles, but I want to dynamically build a Menu at the top of my website in the Site.Master Page based on the Roles the user is a part of. So for example, if JoeUser was a member of Roles "Astronomer" and "Physicist", the navigation menu would say: [Home] [Astronomer] [Physicist] [About] And naturally, it would not list links to "Biologist" or "Chemist" controller Index page. Or if "JohnAdmin" was a member of Role "Admin", links to all 4 controllers would show up in the navigation bar. Ok, you prolly get the idea... Starting with the answer from this StackOverflow topic about Dynamic Menu building in ASP.NET, I'm trying to understand how I would fully implement this. (I'm a newbie and need a little more guidance, so please bare with me.) The answer proposes Extending the Controller class (call it "ExtController") and then have each new WhateverController inherit from ExtController. My conclusion is that I would need to use Reflection in this ExtController Constructor to determine which Classes and Methods have [Authorize] attributes attached to them to determine the Roles. Then using a Static Dictionary, store the Roles and Controllers/Methods in key-value pairs. I imagine it something like this: public class ExtController : Controller { protected static Dictionary<Type,List<string>> ControllerRolesDictionary; protected override void OnActionExecuted(ActionExecutedContext filterContext) { // build list of menu items based on user's permissions, and add it to ViewData IEnumerable<MenuItem> menu = BuildMenu(); ViewData["Menu"] = menu; } private IEnumerable<MenuItem> BuildMenu() { // Code to build a menu SomeRoleProvider rp = new SomeRoleProvider(); foreach (var role in rp.GetRolesForUser(HttpContext.User.Identity.Name)) { } } public ExtController() { // Use this.GetType() to determine if this Controller is already in the Dictionary if (!ControllerRolesDictionary.ContainsKey(this.GetType())) { // If not, use Reflection to add List of Roles to Dictionary // associating with Controller } } } Is this doable? If so, how do I perform Reflection in the ExtController constructor to discover the [Authorize] attribute and related Roles (if any) ALSO! Feel free to go out-of-scope on this question and suggest an alternate way of solving this "Dynamic Site.Master Menu based on Roles" problem. I'm the first to admit that this may not be the best approach.

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • RDP exits immediately after connecting to Windows Server 2008 R2

    - by carpat
    Background: I recently got a Windows cloud VPS server. I don't have much experience with server admin (I'm a programmer), and what little I do have is with linux servers. Ever since getting the server I've been having issues with RDP. I can connect about two or three times, after which point I can't connect until one of the tech guys "fixes" it (see below). When I connect, I can stay connected for hours with no problem. When the problem connecting starts, the first time I try to log in, the remote desktop window pops up, starts connecting, and then exits with "Your Remote Desktop session has ended". After that, for about 10-20 minutes if I try to connect again, the connections times out with Remote Desktop can't connect to the computer for one of these reasons: 1) Remote access on the server is not enabled 2) The remote computer is turned off 3) The remote computer is not available on the network then goes back to connecting once and immediately disconnecting. All of the updates are installed. The firewall has been correctly configured to let RDP traffic through. The remote setting is "Allow connections from computers running any version of Remote Desktop". I tried creating a second user, and when I can't connect, I can't connect to that user either. I've tried both soft and hard reboots, neither of which help. I've tried connecting from two different computers (both running Windows 7) from two different networks (work and home), and the behavior is the same. Everything else on the server continues to run fine (IIS-served http pages, Tomcat-served java pages, svn, ping). The "fix" that the tech guys supply is simply logging into the console on their end, after which point I can connnect 2 or 3 times again. The event viewer on the server has "authentication failure" (or something similar) events generated when I attempt to log in and can't. I can't get to the actual event at the moment as I'm currently in the can't connect stage, and waiting for the techs to log in. But when I searched for the event earlier this morning I couldn't find anything useful. Can anyone help?

    Read the article

  • controlling the class names generated by JAXB for xsd:attributeGroup?

    - by Stephen Winnall
    I am using JAXB to bind XML to Java for an application that I am writing. I have an element called measure which contains two amount elements called amount and maxAmount, with which I want to model a lower and an upper limiting value. amount and maxAmount are otherwise identical and I would like them to be implemented with the same class when unmarshalled into Java. The following is an extract from the XML schema which I feed to JAXB: <xsd:attributeGroup name="AmountAttributes"> <xsd:attribute name="quantity" type="xsd:decimal"/> <xsd:attribute name="numerator" type="xsd:nonNegativeInteger"/> <xsd:attribute name="denominator" type="xsd:positiveInteger"/> </xsd:attributeGroup> <xsd:element name="measure"> <xsd:complexType> <xsd:sequence> <xsd:element minOccurs="0" name="amount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> <xsd:element minOccurs="0" name="maxAmount"> <xsd:complexType> <xsd:attributeGroup ref="mpr:AmountAttributes"/> </xsd:complexType> </xsd:element> </xsd:sequence> </xsd:complexType> </xsd:element> JAXB creates from this a more elaborate version of the following: public class Measure { protected Measure.Amount amount; protected Measure.MaxAmount maxAmount; public static class Measure.Amount {} public static class Measure.MaxAmount {} } Measure.Amount and Measure.MaxAmount are identical except for their names, but - of course - as far as Java is concerned they have little to do with each other. Is there a way of making JAXB use the same class for both amount and maxAmount? Just to come completely clean ;-) I should mention that I generate the XML schema from RNC using Trang. If the answer to the question is "change the XML schema", I have the supplementary question "how do I change the RNC to produce that XML schema?". My RNC looks like this: AmountAttributes = QuantityAttribute? & attribute numerator { xsd:nonNegativeInteger }? & attribute denominator { xsd:positiveInteger }? QuantityAttribute = attribute quantity { xsd:decimal } Measure = element measure { element amount { AmountAttributes }?, element maxAmount { AmountAttributes }? }+ I use RNC because I find it simpler to understand, but if the solution to my problem means just using XML Schema, so be it. Steve

    Read the article

  • MongoDB and datasets that don't fit in RAM no matter how hard you shove

    - by sysadmin1138
    This is very system dependent, but chances are near certain we'll scale past some arbitrary cliff and get into Real Trouble. I'm curious what kind of rules-of-thumb exist for a good RAM to Disk-space ratio. We're planning our next round of systems, and need to make some choices regarding RAM, SSDs, and how much of each the new nodes will get. But now for some performance details! During normal workflow of a single project-run, MongoDB is hit with a very high percentage of writes (70-80%). Once the second stage of the processing pipeline hits, it's extremely high read as it needs to deduplicate records identified in the first half of processing. This is the workflow for which "keep your working set in RAM" is made for, and we're designing around that assumption. The entire dataset is continually hit with random queries from end-user derived sources; though the frequency is irregular, the size is usually pretty small (groups of 10 documents). Since this is user-facing, the replies need to be under the "bored-now" threshold of 3 seconds. This access pattern is much less likely to be in cache, so will be very likely to incur disk hits. A secondary processing workflow is high read of previous processing runs that may be days, weeks, or even months old, and is run infrequently but still needs to be zippy. Up to 100% of the documents in the previous processing run will be accessed. No amount of cache-warming can help with this, I suspect. Finished document sizes vary widely, but the median size is about 8K. The high-read portion of the normal project processing strongly suggests the use of Replicas to help distribute the Read traffic. I have read elsewhere that a 1:10 RAM-GB to HD-GB is a good rule-of-thumb for slow disks, As we are seriously considering using much faster SSDs, I'd like to know if there is a similar rule of thumb for fast disks. I know we're using Mongo in a way where cache-everything really isn't going to fly, which is why I'm looking at ways to engineer a system that can survive such usage. The entire dataset will likely be most of a TB within half a year and keep growing.

    Read the article

  • Why does this service refuse to start on Windows server 2003?

    - by PenguinCoder
    We have a Windows 2003 server with Cebos MQ1 (ver. 7 and ver. GRI) products installed that have been operational for years. After installing Microsoft 2010 C++ Redistributable package needed for other development, the MQ1 GRI service now fails to start. Event logs showed that two additional updates (.NET4 and the 2010 C++ Redistributable SP2) where installed by the redistributable as well. As soon as we discovered the MQ1 service was not starting properly, we removed these three installed packages. However the service still does not start; the dialog that pops up states 'The service started then stopped. '. Event logs when we attempt to start the service show nothing; IE: No errors, crashes, failures, or other information related to this service. Executing the MQ1Serv.exe directly specifies an issue of 'Missing command line operation, must specify install, uninstall and company abbreviation.' sc query MQ1Service(GRI) shows a clean exit for the Win32ExitCode of 0x0. Attempting to reinstall the client or server software gives an error of 'The procedure entry point ReInitializeCriticalSection could not be located in the dynamic link library KERNEL32.dll.' at the 'Registering Libraries' stage. At this point, further research has stated that the required function is in URL.dll and to verify the library is not corrupted. Running an sfc /scannow on the server has replaced a few DLLS; including the URL.DLL to versions from 2005. This actually broke other applications which required a reinstall (one of them being IE 7). After reinstall and updates, url.dll version is 7.0.5730.13 (2009) and Kernel32.dll is version 5.2.3790.4480 (2009). The MQ1 GRI service still will not start, specifying the same error as previous 'Service started then stopped'. Running a disassembler on Kernel32.dll and Url.dll show no functions named ReinitializeCriticalSection. Attempting the reinstall of the MQ1 client and server as well as starting the service again, fails once more. However, setting the compatibility mode on the MQ1 client install exe to 'Windows 95' actually gets the program to install. Setting the compatibility mode on the MQ1 server service does not enable it to start. I have been researching this problem for nearly a week and besides the advice to scan and replace url.dll, have come to no successful conclusions. This service was operational prior to the 2010 C++ install, without any additional parameters or settings. After removing the C++ install and all servicepacks/updates it installed silently, still does not correct the issue of the MQ1 GRI service not starting. Q: Has anyone else run into this or similar issue while attempting to get a service initialized? What have I overlooked or what else can I try in order to get this service started??

    Read the article

  • Resetting root password on Fedora Core 3 - serial cable access only

    - by Sensible Eddie
    A little background: We have an old rackmount server running a customised version of Fedora, manufactured by a company called Navaho. The server is a TeamCAT, running some proprietary rubbish called Freedom2. We have to keep it going - the alternative is extraordinarily expensive, and the business is not likely to be running much longer to justify changing things. Through one means or another, it has fallen upon me to try and resolve our lack of root access. The previous admin has fallen under the proverbial bus, and nobody has any clue. We have no access to the root account for this server. ssh is running on the server, and there is one account admin that we can login with, however it has no permission to do anything (ironic...) The only other way into the server is with a null-modem serial cable. This works... up to a point. I can see the BIOS, I can see the post BIOS screen, and then I see "Starting grub", followed by another screen with about four lines of Linux information, but then it stops at that point. The server continues booting, and all services come online after around two minutes, but the serial terminal displays no more information. I understand it is possible to put Linux into "single user mode" to reset a root password, but I have no idea how to do this beyond trying to interrupt it at the grub stage listed above. When I have tried it just froze. It was almost like grub had appeared (since the server did not continue booting) but I couldn't see it on the serial terminal. Which made me think maybe the grub screen has some different serial settings? I don't know... it's the first time I've ever used serial for access! A friend of mine suggested trying to use a Fedora boot CD. We could boot from USB, so something along this approach is possible but again we still can only see what's going on with the serial terminal, so it might not be achievable. Does anyone have any suggestions for things I can try? I appreciate this is a bit of a long shot, but any assistance would be invaluable. *UPDATE 1 - 28/8/12 * - we will be making some attempts on this today and will post further details later!

    Read the article

  • Repair corrupt hard disk on Mac without install CD

    - by Sarah
    The hard disk of my late 2009 MacBook Pro appears to have become corrupted. I am traveling and do not have my install CD (and won't for several weeks, nor will I be anywhere near an Apple store). The hard disk is not the original, which failed in June 2011. It's some Hitachi replacement installed by IT. History: I was typing an email this afternoon, my computer suddenly started making soft clicking sounds and then froze. I was not moving around. I rebooted, which took a while. I heard more clicking sounds and the computer froze at least once again. It's now kind of working, with mdworker sucking up one CPU. There are no awkward hard drive sounds when I run Chrome or play music. However, when I launched Stickies, I found no trace of my saved Stickies. I ran a live disk verification from within Disk Utility, and it reported Problem: As reported, I don't have access to an installation disc and am nowhere near an area where I can get one for at least two weeks. I have the option of asking someone to go to some trouble and expense to get one for me, but I'm not sure it's worth it: I've read that I can use fsck from single-user mode to repair the disk. Should I just try this? Is it risky? I'm concerned that the clicky sound portends imminent (mechanical) hard drive failure, so it's not worth doing a silly repair. This hard disk is backed up, but I definitely won't be able to access the backup while traveling. I'd like to maximize the probability that I can keep using my computer (and all its current files) while traveling. Update I bit the bullet and ran fsck -fy from single-user mode. It only needed one pass (modification) to reach the "okay" stage. However, rebooting took nearly 5 min and involved several rounds of scratchy sounds and a few bad clicks. I'm now back to kind of using my computer (the same files are missing as before). When I ran live disk verification from Disk Utility this time, however, it reported that the volume appears to be OK. Am I right to infer from the scratchy sounds, however, that my hard drive is still rapidly on its way out? Is there anything else I can do to increase its functionality over the next few weeks?

    Read the article

  • Successfully concatenating multiple videos

    - by wiseguydigital
    My mission is to create videos out of old web slideshows. To start with I have jpegs and audio files that worked as Flash slideshows in an old system, structured such as this: Audio structure my_audio_1.mp3 (this file is a 3 second mp3 of silence) my_audio_2.mp3 my_audio_3.mp3 my_audio_4 etc... roughly 30 mp3s per slideshow Image structure my_image_1.jpg (this acts as the opening slide) my_image_2.jpg my_image_3.jpg my_image_4. etc... roughly 30 images per slideshow. As there are almost 100 slideshows that must be converted to video, I have created a web-based interface using PHP to automate the process, that sits on a local system and attempts to combine the files using shell_exec(). The process uses the following workflow: Loop through each slide and make an avi or mpeg. So for instance my_mini_video_2.avi would be a video that consists of my_image_2.jpg and has a soundtrack of my_audio_2.mp3. This slide would last the length of my_audio_2.mp3. Join / stitch / concat all of the mini videos to create the final video (Using a combination of cat and either mencoder or ffmpeg (I have also tried avimerge but to no avail). Transcode the new 'master' video to various formats such as flv etc. I thought this would be simple and have been close on many occasions but it still won't work. I can't get past stage 2 as I can't get a perfect 'master' video. I have now experimented with Mencoder, FFMpeg and seem to have been through every combination I can think of. The problem is that the audio and visuals never sync, no matter what I try. Also, I have even tried created audio-less mini videos, joining the MP3s into one long MP3 using both cat and mp3wrap and then assigning the new long MP3 as the audio track, but this always produces either a very short file or a badly slowed down file and makes the female voiceover sound like a male boxer!!! There appears to be no problems at all with the original files. Does anybody have any experience in producing a video successfully from the same kind of starting point? Or any ideas on what I may be doing wrong? As an example: If I create silent mini-videos, and stitch them together into 'temp-master.mpg' and then join the MP3s together into single MP3 called 'temp-master-audio.mp3', the audio file's duration is 09:10 and the video file's duration is 08:35. They should be the same and the audio will seem sloooow. I haven't posted code as I have written lots and lots of combinations.

    Read the article

  • Finding good heuristic for A* search

    - by Martin
    I'm trying to find the optimal solution for a little puzzle game called Twiddle (an applet with the game can be found here). The game has a 3x3 matrix with the number from 1 to 9. The goal is to bring the numbers in the correct order using the minimum amount of moves. In each move you can rotate a 2x2 square either clockwise or counterclockwise. I.e. if you have this state 6 3 9 8 7 5 1 2 4 and you rotate the upper left 2x2 square clockwise you get 8 6 9 7 3 5 1 2 4 I'm using a A* search to find the optimal solution. My f() is simply the number of rotations need. My heuristic function already leads to the optimal solution but I don't think it's the best one you can find. My current heuristic takes each corner, looks at the number at the corner and calculates the manhatten distance to the position this number will have in the solved state (which gives me the number of rotation needed to bring the number to this postion) and sums all these values. I.e. You take the above example: 6 3 9 8 7 5 1 2 4 and this end state 1 2 3 4 5 6 7 8 9 then the heuristic does the following 6 is currently at index 0 and should by at index 5: 3 rotations needed 9 is currently at index 2 and should by at index 8: 2 rotations needed 1 is currently at index 6 and should by at index 0: 2 rotations needed 4 is currently at index 8 and should by at index 3: 3 rotations needed h = 3 + 2 + 2 + 3 = 10 But there is the problem, that you rotate 4 elements at once. So there a rare cases where you can do two (ore more) of theses estimated rotations in one move. This means theses heuristic overestimates the distance to the solution. My current workaround is, to simply excluded one of the corners from the calculation which solves this problem at least for my test-cases. I've done no research if really solves the problem or if this heuristic still overestimates in same edge-cases. So my question is: What is the best heuristic you can come up with? (Disclaimer: This is for a university project, so this is a bit of homework. But I'm free to use any resource if can come up with, so it's okay to ask you guys. Also I will credit Stackoverflow for helping me ;) )

    Read the article

  • Big Oh Notation - formal definition.

    - by aloh
    I'm reading a textbook right now for my Java III class. We're reading about Big-Oh and I'm a little confused by its formal definition. Formal Definition: "A function f(n) is of order at most g(n) - that is, f(n) = O(g(n)) - if a positive real number c and positive integer N exist such that f(n) <= c g(n) for all n = N. That is, c g(n) is an upper bound on f(n) when n is sufficiently large." Ok, that makes sense. But hold on, keep reading...the book gave me this example: "In segment 9.14, we said that an algorithm that uses 5n + 3 operations is O(n). We now can show that 5n + 3 = O(n) by using the formal definition of Big Oh. When n = 3, 5n + 3 <= 5n + n = 6n. Thus, if we let f(n) = 5n + 3, g(n) = n, c = 6, N = 3, we have shown that f(n) <= 6 g(n) for n = 3, or 5n + 3 = O(n). That is, if an algorithm requires time directly proportional to 5n + 3, it is O(n)." Ok, this kind of makes sense to me. They're saying that if n = 3 or greater, 5n + 3 takes less time than if n was less than 3 - thus 5n + n = 6n - right? Makes sense, since if n was 2, 5n + 3 = 13 while 6n = 12 but when n is 3 or greater 5n + 3 will always be less than or equal to 6n. Here's where I get confused. They give me another example: Example 2: "Let's show that 4n^2 + 50n - 10 = O(n^2). It is easy to see that: 4n^2 + 50n - 10 <= 4n^2 + 50n for any n. Since 50n <= 50n^2 for n = 50, 4n^2 + 50n - 10 <= 4n^2 + 50n^2 = 54n^2 for n = 50. Thus, with c = 54 and N = 50, we have shown that 4n^2 + 50n - 10 = O(n^2)." This statement doesn't make sense: 50n <= 50n^2 for n = 50. Isn't any n going to make the 50n less than 50n^2? Not just greater than or equal to 50? Why did they even mention that 50n <= 50n^2? What does that have to do with the problem? Also, 4n^2 + 50n - 10 <= 4n^2 + 50n^2 = 54n^2 for n = 50 is going to be true no matter what n is. And how in the world does picking numbers show that f(n) = O(g(n))? Please help me understand! :(

    Read the article

  • NullPointerException on TextView

    - by Stephen Adipradhana
    i get a null pointer exception and the program crash on each time i want to update the highscore text using setText(). what causes this problem? this code is when i set my layout, the layout is a part of the gameView using opengl, and i put the highscore textview on the upper left corner public void onCreate(Bundle savedInstanceState) { SFEngine.display = ((WindowManager)getSystemService(Context.WINDOW_SERVICE)).getDefaultDisplay();//ambl ukuran width height layar super.onCreate(savedInstanceState); gameView = new SFGameView(this); gameView.setLayoutParams(new RelativeLayout.LayoutParams(LayoutParams.MATCH_PARENT, LayoutParams.MATCH_PARENT)); RelativeLayout layout = new RelativeLayout(this); layout.setLayoutParams(new FrameLayout.LayoutParams(LayoutParams.MATCH_PARENT, LayoutParams.MATCH_PARENT)); TextView textBox = new TextView(this); textBox.setId(1); textBox.setText("HIGH SCORE"); textBox.setBackgroundColor(Color.BLUE); textBox.setWidth(SFEngine.display.getWidth()/2); textBox.setHeight(50); Button pauseButton = new Button(this); pauseButton.setText("PAUSE"); pauseButton.setHeight(50); pauseButton.setWidth(SFEngine.display.getWidth()/2); pauseButton.setOnTouchListener(new OnTouchListener(){ public boolean onTouch(View v, MotionEvent e) { //pause game SFEngine.isPlaying = false; Intent i1 = new Intent(SFGames.this, pause.class); gameView.onPause(); startActivityForResult(i1,0);//hrs pk result soalny mw blk lg return true; } }); RelativeLayout.LayoutParams lp_pause = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); RelativeLayout.LayoutParams lp_hs = new RelativeLayout.LayoutParams(RelativeLayout.LayoutParams.WRAP_CONTENT, RelativeLayout.LayoutParams.WRAP_CONTENT); lp_hs.addRule(RelativeLayout.ALIGN_PARENT_LEFT); lp_pause.addRule(RelativeLayout.ALIGN_PARENT_TOP); lp_pause.addRule(RelativeLayout.ALIGN_PARENT_RIGHT); textBox.setLayoutParams(lp_hs); pauseButton.setLayoutParams(lp_pause); layout.addView(gameView); layout.addView(textBox); layout.addView(pauseButton); setContentView(layout); and here is the setText code public boolean onTouchEvent (MotionEvent event){//buat nerima input user if(!SFEngine.isPlaying){ finish(); } textBox.setText("High Score :" + SFEngine.score);//here is the source of the prob .....

    Read the article

  • vmdk to live cd - VMware vmxnet virtual NIC driver Kernel panic

    - by ronalchn
    Task I am trying to convert a virtual machine to a live CD. Specifically, the virtual machine I am trying to convert is the IOI 2013 Competition Environment. In this task, I am aided by a guide Converting a virtual disk image: VDI or VMDK to an ISO you can distribute. Symptoms However, after getting through all the instructions, the live CD causes a kernel panic on boot on bare metal. In particular, the screen shows: [0.737348] cdrom: Uniform CD-ROM driver Revision: 3.20 [0.737503] sr 3:0:0:0: >Attached scsi CD-ROM sr0 [0.737638] sr 3:0:0:0: >Attached scsi generic sg2 type 5 [0.737771] Freeing unused kernel memory: 756k freed [0.738093] Write protecting the kernel text: 5960k [0.738155] Write protecting the kernel read-only data: 2424k [0.738224] NX-protecting the kernel data: 4280k Loading, please wait... [0.752252] udevd[100]: starting version 175 [0.768708] VMware vmxnet3 virtual NIC driver - version 1.1.29.0-k-NAPI [0.781204] VMware PVSCSI driver - version 1.0.2.0-k [0.789555] VMware vmxnet virtual NIC driver [0.799356] Kernel panic - not syncing: Attempted to kill init! exitcode=0x00000200 [0.799356] [0.799472] Pid: 1, comm: init Tainted: G 0 3.5.0-17-generic #28-Ubuntu [0.799549] Call Trace: [0.799603] [<c15bf0ec>] panic+0x81/0x17b [0.799654] [<c104a6a5>] do_exit+0x745/0x7a0 [0.799707] [<c104a9a4>] do_group_exit+0x34/0xa0 [0.799760] [<c104aa28>] sys_exit_group+0x18/0x20 [0.799813] [<c15cff5f>] sysenter_do_call+0x12/0x28 Possible problem I suspect that the problem is the VMware vmxnet virtual NIC driver - however, I do not know how I can uninstall it, and possibly install one for a bare metal machine. If anyone knows which packages needs installing/uninstalling at the .rootfs/ chroot directory stage, please let me know. Details on procedure Do note that after importing the .ova file into Virtualbox, the virtual machine is stored as a .vmdk file already, and not a .vdi file. I would like to point out some results of the procedure followed in case of any questions. This is after extracting the filesystem from the .raw file to the .rootfs/ directory mentioned in the blog. I changed the filesystem table as mentioned in the blog, then looked at the possible "kernel optimized for virtualization". However, I found that linux-image-generic was already installed. Also, when running the command dpkg-query --showformat='${Package}\n' -W 'vmware-tools*' (or dpkg-query --showformat='${Package}\n' -W '*-virtual'), no packages were found. Thus, I did not find any virtualization specific packages. I proceeded to generate the iso following the steps in the blog, and burned it to a DVD.

    Read the article

  • Calling managed code from unmanaged win32 assembly dll - crash

    - by JustGreg
    I'm developing a serial port dll in win32 assembly (MASM32). It has its own thread checking multiple events and at a specified buffer treshold it'd notify the managed main application by calling a callback function. It just a call with no arguments/return value. At startup the main application stores the callback function's address by calling a function in the dll: pCallBackFunction dd 0 SetCallBackPointer proc pcb:DWORD mov eax, pcb mov pCallBackFunction, eax call DWORD ptr pCallBackFunction ; verify it immediately ret SetCallBackPointer endp The upper function immediately calls back the managed application callback routine for verification purposes. It is working fine. However, when I place the call instruction to other functions in the dll it crashes the application. It doesn't matter if the call is in a simple function or in the threadproc of the dll. For example: OpenPort proc pn:byte,br:dword, inputbuffersize: dword, outputbuffersize:dword, tresholdsize: dword LOCAL dcb: DCB LOCAL SerialTimeOuts: COMMTIMEOUTS call DWORD ptr pCallBackFunction xor eax, eax mov al, pn mov [com_port+3],al etc. etc. will crash at call DWORD ptr pCallBackFunction always. Since I call SetCallBackPointer first to store a valid address in pCallBackFunction, it should have a valid address. My managed app is written in C# and the relevant part is: public partial class Form1 : Form { public delegate void CallBackDelegate(); public static CallBackDelegate mydelegate; [DllImport("serialport.dll")] private static extern void SetCallBackPointer(CallBackDelegate Delegate); [DllImport("serialport.dll")] public static extern int OpenPort(byte com, uint br, uint inbufsize, uint outbufsize, uint treshsize); public Form1() { InitializeComponent(); mydelegate =new CallBackDelegate(CallbackFunction); SetCallBackPointer(mydelegate); unsafe { int sysstat; int hResult; hResult = OpenPort(Convert.ToByte('5'), 9600, 306, 4, 4); } } public static void CallbackFunction() { MessageBox.Show( "CallBack Function Called by Windows DLL"); } The VS debugger reported that the dll had tried to read/write from/to a protected memory address. But when calling SetCallBackPointer there is no such problem. What am I doing wrong here? Any tips would be great!

    Read the article

  • elisp: posn-at-point returns nil after goto-char. How to update the display before posn-at-point?

    - by Cheeso
    In emacs lisp, posn-at-point is documented as: posn-at-point is a built-in function in C source code. (posn-at-point &optional POS WINDOW) . Return position information for buffer POS in WINDOW. POS defaults to point in WINDOW; WINDOW defaults to the selected window. . Return nil if position is not visible in window. Otherwise, the return value is similar to that returned by event-start for a mouse click at the upper left corner of the glyph corresponding to the given buffer position: (WINDOW AREA-OR-POS (X . Y) TIMESTAMP OBJECT POS (COL . ROW) IMAGE (DX . DY) (WIDTH . HEIGHT)) The posn- functions access elements of such lists. ok, now I've got a function that looks something like this: (defun my-move-and-popup-menu () "move the point, then pop up a menu." (goto-char xxxx) (setq p (posn-at-point)) (my-popup-menu p ...) ) Basically, move the point, then retrieve the screen position at that point, and then popup a menu at that screen position. But I am finding that posn-at-point returns non-nil, only if the xxxx character position (the after position) is visible in the window, before the call to goto-char. It seems that the position is not actually updated until exit from the function. If goto-char goes a long way, more than one screenful, then the retrieved position is always nil, and my code doesn't know where to popup the menu. The reason I suggest that the position is not actually updated until exit from the function - when the menu successfully pops up, the cursor is clearly visible in its previous location while the popup menu is being displayed. When I dismiss the menu, the cursor moves to where I expected it to move, after the goto-char call. How can I get the position to be really updated, between goto-char and posn-at-point, so that posn-at-point will not return nil? In a Windows Forms application I would call Form.Update() or something similar to update the display in the middle of an event handler. What's the emacs version of that?

    Read the article

  • Encapsulating a Windows.Forms.Button

    - by devoured elysium
    I want to define a special kind of button that only allows two possible labels: "ON" and "OFF". I decided to inherit from a Windows.Forms.Button to implement this but now I don't know I how should enforce this rule. Should I just override the Text property like this? public override string Text { set { throw new InvalidOperationException("Invalid operation on StartStopButton!"); } } The problem I see with this is that I am breaking the contract that all buttons should have. If any code tries something like foreach (Button button in myForm) { button.Text = "123"; } they will get an Exception if I have any of my special buttons on the form, which is something that isn't expectable. First, because people think of properties just as "public" variables, not methods, second, because they are used to using and setting whatever they want to buttons without having to worry with Exceptions. Should I instead just make the set property do nothing? That could also lead to awkward results: myButton.Text = "abc"; MessageBox.Show(abc); //not "abc"! The general idea from the OO world is to in this kind of cases use Composition instead of inheritance. public class MySpecialButton : <Some class from System.Windows.Forms that already knows how to draw itself on forms> private Button button = new Button(); //I'd just draw this button on this class //and I'd then only show the fields I consider //relevant to the outside world. ... } But to make the Button "live" on a form it must inherit from some special class. I've looked on Control, but it seems to already have the Text property defined. I guess the ideal situation would be to inherit from some kind of class that wouldn't even have the Text property defined, but that'd have position, size, etc properties available. Upper in the hierarchy, after Control, we have Component, but that looks like a really raw class. Any clue about how to achieve this? I know this was a long post :( Thanks

    Read the article

  • SQL SERVER – Beginning SQL Server: One Step at a Time – SQL Server Magazine

    - by pinaldave
    I am glad to announce that along with SQLAuthority.com, I will be blogging on the prominent site of SQL Server Magazine. My very first blog post there is already live; read here: Beginning SQL Server: One Step at a Time. My association with SQL Server Magazine has been quite long, I have written nearly 7 to 8 SQL Server articles for the print magazine and it has been a great experience. I used to stay in the United States at that time. I moved back to India for good, and during this process, I had put everything on hold for a while. Just like many things, “temporary” things become “permanent” – coming back to SQLMag was on hold for long time. Well, this New Year, things have changed – once again, I am back with my online presence at SQLMag.com. Everybody is a beginner at every task or activity at some point of his/her life: spelling words for the first time; learning how to drive for the first time, etc. No one is perfect at the start of any task, but every human is different. As time passes, we all develop our interests and begin to study our subject of interest. Most of us dream to get a job in the area of our study – however things change as time passes. I recently read somewhere online (I could not find the link again while writing this one) that all the successful people in various areas have never studied in the area in which they are successful. After going through a formal learning process of what we love, we refuse to stop learning, and we finally stop changing career and focus areas. We move, we dare and we progress. IT field is similar to our life. New IT professionals come to this field every day. There are two types of beginners – a) those who are associated with IT field but not familiar with other technologies, and b) those who are absolutely new to the IT field. Learning a new technology is always exciting and overwhelming for enthusiasts. I am working with database (in particular) for SQL Server for more than 7 years but I am still overwhelmed with so many things to learn. I continue to learn and I do not think that I should ever stop doing so. Just like everybody, I want to be in the race and get ahead in learning the technology. For the same, I am always looking for good guidance. I always try to find a good article, blog or book chapter, which can teach me what I really want to learn at this stage in my career and can be immensely helpful. Quite often, I prefer to read the material where the author does not judge me or assume my understanding. I like to read new concepts like a child, who takes his/her first steps of learning without any prior knowledge. Keeping my personal philosophy and preference in mind, I will be blogging on SQL Server Magazine site. I will be blogging on the beginners stuff. I will be blogging for them, who really want to start and make a mark in this area. I will be blogging for all those who have an extreme passion for learning. I am happy that this is a good start for this year. One of my resolutions is to help every beginner. It is totally possible that in future they all will grow and find the same article quite ‘easy‘ – well when that happens, it indicates the success of the article and material! Well, I encourage everybody to read my SQL Server Magazine blog – I will be blogging there frequently on various topics. To begin, we will be talking about performance tuning, and I assure that I will not shy away from other multiple areas. Read my SQL Server Magazine Blog: Beginning SQL Server: One Step at a Time I think the title says it all. Do leave your comments and feedback to indicate your preference of subject and interest. I am going to continue writing on subject, and the aim is of course to help grow in this field. Reference : Pinal Dave (http://blog.SQLAuthority.com) Filed under: Pinal Dave, PostADay, SQL, SQL Authority, SQL Optimization, SQL Performance, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL, Technology

    Read the article

  • Our Look at Opera 10.50 Web Browser

    - by Asian Angel
    Everyone has been talking about the newest version of Opera recently but perhaps you have not looked at it too closely yet. Today we will take a look at 10.50 and let you see what this “new browser” is all about. The New Engines Carakan JavaScript Engine: Runs web applications up to 7 times faster than its predecessor Futhark Vega Graphics Library: Enables super fast and smooth graphics on everything from tab switching to webpage animation Presto 2.5: Provides support for HTML5, CSS2.1 and the latest CSS3 standards A Look at the Features Available If you have installed or used older versions of Opera before then the default look after a clean install will probably seem rather different. The main differences in appearance are mainly located within the “glass border” areas of the browser. The “Speed Dial” setup looks and works just as well as in previous versions. You can set a favorite wallpaper or image as your background and choose the number of “dials” using the “Configure Speed Dial Command”. One of the “standout” differences is the “O Button”. All of the menus have been condensed into this single access point but it only takes a few moments to find what you are looking for. If you have used the style before in earlier versions of Opera some of the items have been moved around. For those who prefer the “Menu Bar” that can be easily restored using the “Show Menu Bar Command”. If desired you can actually “extend” the “Tab Bar” downwards to display thumbnails of your open tabs. Just use your mouse to grab the bottom of the “Tab Bar” and adjust it to suit your personal needs. The only problem with this feature is that it will quickly use up a good sized portion of your available UI and browser window space. The “Password Manager” is ready to access when needed…the background for the button will turn a shiny metallic blue when you open a webpage that you have “Login Information” saved for. One of the new features is a small “Recycle Bin Button” in the upper right corner. Clicking on this will display a list of recently closed tabs letting you have easy access to any tabs that you may have accidentally closed. This is definitely a great feature to have as an easy access button. For those who were used to how the “Zoom Feature” looked before it has a new “look” to it. Instead of the pop-up menu-type listing of “view sizes” present before you now have a slider button that you can use to adjust the zooming level. For our default setup here the “Sidebar Panels” available were: “Bookmarks, Widgets, Unite, Notes, Downloads, History, & Panels”. Additional panels such as “Links, Windows, Search, Info, etc.” are available if you want and/or need them (accessible using the “Panels Plus Sign Button”). The “Opera Link Button” makes it easy for you to synchronize your “Speed Dial, Bookmarks, Personal Bar, Custom Searches, History & Notes”. Note: “Opera Link” requires an account and can be signed up for using the link provided below. Want to share files with your family and friends? “Unite” allows you to do that and more. With “Unite” you can: “Stream Music, Show Photo Galleries, Share Files and/or Folders, & host webpages directly from your browser”. We have a more in-depth look at “Unite” in our article here. Note: Use of “Unite” requires an Opera account. Got a slow internet connection? “Opera Turbo” can help with that by running the web traffic through their “compression servers” to speed up your web browsing. Keep in mind that “Opera Turbo” will not engage if you are accessing a secure website (i.e. your bank’s website) thus preserving your security. Note: “Opera Turbo” can be set up to automatically detect slow internet connections (i.e. crowded Wi-Fi in a cafe). Opera has a built-in “Private Browsing Mode” now for those who prefer anonymous browsing and want to keep the “history records clean” on their computer. To access it go to “Tabs and windows” and select “New private tab” or “New private window” as desired. When you open your new “Private Tab or Window” you will see the following message with details on how Opera will handle browsing information and a large “door hanger symbol”. Notice that the one tab is locked into “Private Browsing Mode” while the others are still working in “Regular Browsing Mode”. Very nice! A miniature version of the “door hanger symbol” will be present on any tab that is locked into “Private Browsing Mode”. If you are using Windows 7 then you will love how things look from your “Taskbar”. Here you can see four very nice looking thumbnails for the tabs that we had open. All that you have to do is click on the desired thumbnail… The “Context Menu” looks just as lovely as the thumbnails and definitely has some terrific functionality built into it. Add Enhanced Aero Capability If you love “Aero” and want more for your new Opera install then we have the perfect theme for you. The theme’s name is Z1-AV69 and once you have downloaded it you will need to place it in the “Skins Subfolder” in Opera’s “Program Files Folder”. Note: For our example we used version 1.10 but version 2.00 is now available (link provided below). Once you have restarted Opera, go to the “O Menu” and select “Appearance”. When the “Appearance Window” opens click on “Z1-Glass Skin” and then click “OK”. All of a sudden you will have more “Aero Goodness” to enjoy. Compare this screenshot with the one at the top of this article…the only part that is not transparent now is the browser window area itself. Want even more “Aero Goodness”? Right click on the “Tab Bar” and set “Tab Bar Placement” to “Left”. Note: You can achieve the same effect by setting the “Tab Bar Placement” to “Right”. With the “Speed Dial” visible you will be able to see your wallpaper with ease. While this is obviously not for everyone it does make for a great visual trick. Portable Versions Perhaps you need this wonderful new version of Opera to go with you wherever you do during the day. Not a problem…just visit the Opera USB website to choose a version that works best for you. You can select from “Zip or Exe” setup files and if needed update an older portable version using a “Zipped Update Files Package”. If you are updating an older version keep in mind that you will need to delete the old “OperaUSB.exe. File” due to changes with the new setup files. During our tests updating older portable versions went well for the most part but we did experience a few “odd UI quirks” here and there…so we recommend setting up a clean install if possible. Conclusion The new 10.50 release is a pleasure to use and is a recommended install for your system. Whether you are considering trying Opera for the first time or have been using it for a bit we think that you will pleased with everything that the 10.50 release has to offer. For those who would like to add User Scripts to Opera be certain to look at our how-to article here. Links Download Opera 10.50 for your location (Windows) Get the latest Snapshot versions for Linux & Mac Sign up for an Opera Link account View In-Depth detail on Opera 10.50’s features Download the Z1-AV69 Aero Theme Download Portable Opera 10.50 Similar Articles Productive Geek Tips Set the Speed Dial as the Opera Startup PageSet Up User Scripts in Opera BrowserScan Files for Viruses Before You Download With Dr.WebTurn Your Computer into a File, Music, and Web Server with Opera UniteSet the Default Browser on Ubuntu From the Command Line TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 PCmover Professional Make your Joomla & Drupal Sites Mobile with OSMOBI Integrate Twitter and Delicious and Make Life Easier Design Your Web Pages Using the Golden Ratio Worldwide Growth of the Internet How to Find Your Mac Address Use My TextTools to Edit and Organize Text

    Read the article

  • Tips on installing Visual Studio 2010 SP1

    - by Jon Galloway
    Visual Studio SP1 went up on MSDN downloads (here) on March 8, and will be released publicly on March 10 here. Release announcements: Soma: Visual Studio 2010 enhancements Jason Zander: Announcing Visual Studio 2010 Service Pack 1 I started on this post with tips on installing VS2010 SP1 when I realized I’ve been writing these up for Visual Studio and .NET framework SP releases for a while (e.g. VS2008 / .NET 3.5 SP1 post, VS2005 SP1 post). Looking back the years of Visual Studio SP installs (and remembering when we’d get up to SP6 for a Visual Studio release), I’m happy to see that it just keeps getting easier. Service Packs are a lot less finicky about requiring beta software to be uninstalled, install more quickly, and are just generally a lot less scary. If I can’t have a jetpack, at least my future provided me faster, easier service packs. Disclaimer: These tips are just general things I've picked up over the years. I don't have any inside knowledge here. If you see anything wrong, be sure to let me know in the comments. You may want to check the readme file before installing - it's short, and it's in that new-fangled HTML format. On with the tips! Before starting, uninstall Visual Studio features you don't use Visual Studio service packs (and other Microsoft service packs as well) install patches for the specific features you’ve got installed. This is a big reason to always do a custom install when you first install Visual Studio, but it’s not difficult to update your existing installation. Here’s the quick way to do that: Tap the windows key and type “add or remove programs” and press enter (or click on the “Add or remove programs” link if you must).   Type “Visual Studio 2010” in the search box in the upper right corner, click on the Visual Studio program (the one with the VS infinity looking logo) and click on Uninstall/Change. Click on Add or Remove Features The next part’s up to you – what features do you actually use? I’ve been doing primarily ASP.NET MVC development in C# lately, so I selected Visual C# and Visual Web Developer. Remember that you can install features later if needed, and can also install the express versions if you want. Selecting everything just because it’s there - or you paid for it – means that you install updates for everything, every time. When you’ve made your changes, click on the Update button to uninstall unused features. Shut down all instances of Visual Studio It probably goes without saying that you should close a program down before installing it, partly to avoid the file-in-use-reboot-after-install horror. Additional "hunch / works on my machine" quality tip: On one computer I saw a note in the setup log about Visual Studio a prompt for user input to close Visual Studio, although I never saw the prompt. Just to  be sure, I'd personally open up Task Manager and kill any devenv.exe processes I saw running, as it couldn't hurt. Use the web installer I use the Web Installers whenever possible. There’s no point in downloading the DVD unless you’re doing multiple installs or won’t have internet access. The DVD IS is 1.5GB, since it needs to be able to service every possible supported installation option on both x86 and x64. The web installer is 776 KB (smaller than calc.exe), so you can start the installation right away. Like other web installers, the real benefit is that it only installs the updates you need (hence the reason for step 1 – uninstalling unused components). Instead of 1.5GB, my download was roughly 530MB. If you’re installing from MSDN (this link takes you right to the Visual Studio installs), select the first one on the list: The first step in the installation process is to analyze the machine configuration and tell you what needs to be installed. Since I've trimmed down my features, that's a pretty short list. The time's not far off where I may not install SQL Server on my dev machines, just using SQL Server Compact - that would shorten the list further. When I hit next, you can see that the download size has shrunk considerably. When I start the install, note that the installation begins while other components are downloading - another benefit of the web install. On my mid-range desktop machine, the install took 25 minutes. What if it takes longer? According to Heath Stewart (Visual Studio installer guru), average SP1 installs take roughly 45 minutes. An installation which takes hours to complete may be a sign of a problem: see his post Visual Studio 2010 Service Pack 1 installing for over 2 hours could be a sign of a problem. Why so long? Yes, even 25 minutes is a while. Heath's got another blog post explaining why the update can take longer than the initial install (see: A patch may take as long or longer to install than the target product) which explains all the additional steps and complexities a patch needs to deal with, as well as some mitigation steps that deployment authors can take to mitigate the impact. Other things to know about Visual Studio 2010 SP1 Installs over Visual Studio 2010 SP1 Beta That's nice. Previous Visual Studio versions did a number of annoying things when you installed SP's over beta's - fail with weird errors, get part way through and tell you needed to cancel and uninstall first, etc. I've installed this on two machines that had random beta stuff installed without tears. That Readme file you didn't read I mentioned the readme file earlier (http://go.microsoft.com/fwlink/?LinkId=210711 ). Some interesting things I picked up in there: 2.1.3. Visual Studio 2010 Service Pack 1 installation may fail when a USB drive or other removeable drive is connected 2.1.4. Visual Studio must be restarted after Visual Studio 2010 SP1 tooling for SQL Server Compact (Compact) 4.0 is installed 2.2.1. If Visual Studio 2010 Service Pack 1 is uninstalled, Visual Studio 2010 must be reinstalled to restore certain components 2.2.2. If Visual Studio 2010 Service Pack 1 is uninstalled, Visual Studio 2010 must be reinstalled before SP1 can be installed again 2.4.3.1. Async CTP If you installed the pre-SP1 version of Async CTP but did not uninstall it before you installed Visual Studio 2010 SP1, then your computer will be in a state in which the version of the C# compiler in the .NET Framework does not match the C# compiler in Visual Studio. To resolve this issue: After you install Visual Studio 2010 SP1, reinstall the SP1 version of the Async CTP from here. Hardware acceleration for Visual Studio is disabled on Windows XP Visual Studio 2010 SP1 disables hardware acceleration when running on Windows XP (only on XP). You can turn it back on in the Visual Studio options, under Environment / General, as shown below. See Jason Zander's post titled Performance Troubleshooting Article and VS2010 SP1 Change.

    Read the article

  • Parallelism in .NET – Part 15, Making Tasks Run: The TaskScheduler

    - by Reed
    In my introduction to the Task class, I specifically made mention that the Task class does not directly provide it’s own execution.  In addition, I made a strong point that the Task class itself is not directly related to threads or multithreading.  Rather, the Task class is used to implement our decomposition of tasks.  Once we’ve implemented our tasks, we need to execute them.  In the Task Parallel Library, the execution of Tasks is handled via an instance of the TaskScheduler class. The TaskScheduler class is an abstract class which provides a single function: it schedules the tasks and executes them within an appropriate context.  This class is the class which actually runs individual Task instances.  The .NET Framework provides two (internal) implementations of the TaskScheduler class. Since a Task, based on our decomposition, should be a self-contained piece of code, parallel execution makes sense when executing tasks.  The default implementation of the TaskScheduler class, and the one most often used, is based on the ThreadPool.  This can be retrieved via the TaskScheduler.Default property, and is, by default, what is used when we just start a Task instance with Task.Start(). Normally, when a Task is started by the default TaskScheduler, the task will be treated as a single work item, and run on a ThreadPool thread.  This pools tasks, and provides Task instances all of the advantages of the ThreadPool, including thread pooling for reduced resource usage, and an upper cap on the number of work items.  In addition, .NET 4 brings us a much improved thread pool, providing work stealing and reduced locking within the thread pool queues.  By using the default TaskScheduler, our Tasks are run asynchronously on the ThreadPool. There is one notable exception to my above statements when using the default TaskScheduler.  If a Task is created with the TaskCreationOptions set to TaskCreationOptions.LongRunning, the default TaskScheduler will generate a new thread for that Task, at least in the current implementation.  This is useful for Tasks which will persist for most of the lifetime of your application, since it prevents your Task from starving the ThreadPool of one of it’s work threads. The Task Parallel Library provides one other implementation of the TaskScheduler class.  In addition to providing a way to schedule tasks on the ThreadPool, the framework allows you to create a TaskScheduler which works within a specified SynchronizationContext.  This scheduler can be retrieved within a thread that provides a valid SynchronizationContext by calling the TaskScheduler.FromCurrentSynchronizationContext() method. This implementation of TaskScheduler is intended for use with user interface development.  Windows Forms and Windows Presentation Foundation both require any access to user interface controls to occur on the same thread that created the control.  For example, if you want to set the text within a Windows Forms TextBox, and you’re working on a background thread, that UI call must be marshaled back onto the UI thread.  The most common way this is handled depends on the framework being used.  In Windows Forms, Control.Invoke or Control.BeginInvoke is most often used.  In WPF, the equivelent calls are Dispatcher.Invoke or Dispatcher.BeginInvoke. As an example, say we’re working on a background thread, and we want to update a TextBlock in our user interface with a status label.  The code would typically look something like: // Within background thread work... string status = GetUpdatedStatus(); Dispatcher.BeginInvoke(DispatcherPriority.Normal, new Action( () => { statusLabel.Text = status; })); // Continue on in background method .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } This works fine, but forces your method to take a dependency on WPF or Windows Forms.  There is an alternative option, however.  Both Windows Forms and WPF, when initialized, setup a SynchronizationContext in their thread, which is available on the UI thread via the SynchronizationContext.Current property.  This context is used by classes such as BackgroundWorker to marshal calls back onto the UI thread in a framework-agnostic manner. The Task Parallel Library provides the same functionality via the TaskScheduler.FromCurrentSynchronizationContext() method.  When setting up our Tasks, as long as we’re working on the UI thread, we can construct a TaskScheduler via: TaskScheduler uiScheduler = TaskScheduler.FromCurrentSynchronizationContext(); We then can use this scheduler on any thread to marshal data back onto the UI thread.  For example, our code above can then be rewritten as: string status = GetUpdatedStatus(); (new Task(() => { statusLabel.Text = status; })) .Start(uiScheduler); // Continue on in background method This is nice since it allows us to write code that isn’t tied to Windows Forms or WPF, but is still fully functional with those technologies.  I’ll discuss even more uses for the SynchronizationContext based TaskScheduler when I demonstrate task continuations, but even without continuations, this is a very useful construct. In addition to the two implementations provided by the Task Parallel Library, it is possible to implement your own TaskScheduler.  The ParallelExtensionsExtras project within the Samples for Parallel Programming provides nine sample TaskScheduler implementations.  These include schedulers which restrict the maximum number of concurrent tasks, run tasks on a single threaded apartment thread, use a new thread per task, and more.

    Read the article

  • 17 new features in Visual Studio 2010

    - by vik20000in
    Visual studio 2010 has been released to RTM a few days back. This release of Visual studio 2010 comes with a big number of improvements on many fronts. In this post I will try and point out some of the major improvements in Visual Studio 2010. 1)      Visual studio IDE Improvement. Visual studio IDE has been rewritten in WPF. The look and feel of the studio has been improved for improved readability. Start page has been redesigned and template so that anyone can change the start page as they wish. 2)      Multiple Monitor - Support for Multiple Monitor was already there in Visual studio. But in this edition it has been improved as much that we can now place the document, design and code window outside the IDE in another monitor. 3)      ZOOM in Code Editor – Making the editors in WPF has made significant improvement for them. The best one that I like is the ZOOM feature. We can now zoom in the code editor with the help of the ctrl + Mouse scroll. The zoom feature does not work on the Design surface or windows with icon like solution view and toolbox. 4)      Box Selection - Another Important improvement in the Visual studio 2010 is the box selection. We can select a rectangular by holding down the Alt Key and selecting with mouse.  Now in the rectangular selection we can insert text, Paste same code in different line etc. This is helpful if you want to convert a number of variables from public to private etc… 5)      New Improved Search – One of the best productivity improvements in Visual studio 2010 is its new search as you type support. This has been done in the Navigate To window which can be brought up by pressing (Ctrl + ,). The navigate To windows also take help of the Camel casing and will be able to search with the help of camel casing when character is entered in upper case. For example we can search AOH for AddOrederHeader. 6)      Call Hierarchy – This feature is only available to the Visual C# and Visual C++ editor. The call hierarchy windows displays the calls made to and from (yes both to and from) a selected method property or a constructor. The call hierarchy also shows the implementation of interface and the overrides of virtual or abstract methods. This window is very helpful in understanding the code flow, and evaluating the effect of making changes. The best part is it is available at design time and not at runtime only like a debugger. 7)      Highlighting references – One of the very cool stuff in Visual Studio 2010 is the fact if you select a variable then all the use of that variable will be highlighted alongside. This should work for all the result of symbols returned by Find all reference. This also works for Name of class, objects variable, properties and methods. We can also use the Ctrl + Shift + Down Arrow or Up Arror to move through them. 8)      Generate from usage - The Generate from usage feature lets you use classes and members before you define them. You can generate a stub for any undefined class, constructor, method, property, field, or enum that you want to use but have not yet defined. You can generate new types and members without leaving your current location in code, This minimizes interruption to your workflow.9)      IntelliSense Suggestion Mode - IntelliSense now provides two alternatives for IntelliSense statement completion, completion mode and suggestion mode. Use suggestion mode for situations where classes and members are used before they are defined. In suggestion mode, when you type in the editor and then commit the entry, the text you typed is inserted into the code. When you commit an entry in completion mode, the editor shows the entry that is highlighted on the members list. When an IntelliSense window is open, you can press CTRL+ALT+SPACEBAR to toggle between completion mode and suggestion mode. 10)   Application Lifecycle Management – A client application for management of application lifecycle like version control, work item tracking, build automation, team portal etc is available for free (this is not available for express edition.). 11)   Start Page – The start page has been redesigned with WPF for new functionality and look. Tabbed areas are provided for content from different source including MSDN. Once you open some project the start page closes automatically. The list of recent project also lets you remove project from the list. And above all the start page is customizable enough to be changed as per individual requirement. 12)   Extension Manager – Visual Studio 2010 has provided good ways to be extended. We can also use MEF to extend most of the features of Visual Studio. The new extension manager now can go the visual studio gallery and install the extension without even opening any explorer. 13)   Code snippets – Visual studio 2010 for HTML, Jscript and Asp.net also. 14)   Improved Intelligence for JavaScript has been improved vastly (around 2-5 times). Intelligence now also shows the XML documentation comment on the go. 15)   Web Deployment – Web Deployment has been vastly improved. We can package and publish the web application in one click. Three major supported deployment scenarios are Web packages, one click deployment and Web configuration Transformation. 16)   SharePoint - Visual Studio 2010 also brings vastly improved development experience for SharePoint. We can create, edit, debug, package, deploy and activate SharePoint project from within Visual Studio. Deployment of Site is as easy as hitting F5. 17)   Azure – Visual Studio 2010 also comes with handy improvement for developing on windows Azure environment. Vikram

    Read the article

  • Apache 2.2 and FastCGI stops responding, warnings, crashes

    - by Brett
    I've seen this question posted a few times using a Google search, with no real answers. I have a multi-threaded FastCGI application running with Apache 2.2 on FreeBSD 7.2. There are a few issues with it, and I am unable to really figure out the source of the problem even after poking through a bunch of the mod_fastcgi source code. My FastCGI application gets anywhere from 2 to 15 or so hits per second, and mostly services a back-end API (the majority of web server usage is for this, and not actually serving content). Everything seems to work ok under normal conditions, but recently this problem has been becoming worse. It starts out with the FastCGI process manager apparently trying to close unneeded processes, sending them a SIGTERM signal. I catch the signal, clean up some stuff, and exit (by calling exit()) with status code 0. This process seems to result in three log messages in my httpd error log: [Tue Jun 01 14:03:31 2010] [warn] FastCGI: (dynamic) server "/home/program/wwwroot/domains/www.mydomain.com/cgi-bin/program.cgi" (pid 98182) termination signaled [Tue Jun 01 14:03:31 2010] [warn] FastCGI: (dynamic) server "/home/program/wwwroot/domains/www.mydomain.com/cgi-bin/program.cgi" (pid 98182) terminated by calling exit with status '0' [Tue Jun 01 14:03:31 2010] [warn] FastCGI: (dynamic) server "/home/program/wwwroot/domains/www.mydomain.com/cgi-bin/program.cgi" restarted (pid 98294) I am not sure why it says it is restarting the process, but in any case no core dump is ever generated so I do believe it is the FastCGI process manager doing it's thing. This makes sense because it begins to happen after the initial load increase from restarting Apache. Since it's down for a few seconds, it gets hit with a couple of hundred requests over the first few seconds it's running again (sometimes even hitting the upper limit of MAXCLIENTS in Apache), and this seems to be the process manager doing the work of spawning more processes to handle the increased load. So this all seems fine, but here is where things get weird. There are really two problems that I see. First, my multithreaded FastCGI process spawns 25 worker threads, and all seem to be used according to my internal log files (multiple processes are clearly using multiple threads to do work). However it seems that 3 or 4 FastCGI processes is not enough to handle the 5 to 15 hit per second load, even though the requests take about .02s or so to process internally. In order to be at all responsive, it seems I need 50 or more FastCGI processes, leading me to believe that FastCGI does not realize that my program is multithreaded. I've read the documentation at http://www.fastcgi.com/mod_fastcgi/docs/mod_fastcgi.html and do not see any option pertaining to multithreaded-ness, and my internal code is more or less set up just like the examples provided by the FastCGI library. The second problem I am having is that once process termination has happened a bunch of times as above (and seemingly at random), I begin getting a lot of these messages in my error log: [Tue Jun 01 14:06:22 2010] [warn] (32)Broken pipe: FastCGI: write() to PM failed (ignore if a restart or shutdown is pending) The messages occur for about half the hits I get to the server, and it completely kills the responsiveness of my application - it seems FastCGI will look for a working "pipe" until it finds one, and fail to realize that whatever application it is trying to contact is dead. It does still work though, it's just incredibly unresponsive - sometimes taking up to 40 or so seconds to process a request. I recompiled mod_fastcgi with some extra debugging around the point of the error message, and it appears that the error happens when it tries to write() to the application. The call to write() fails with a -1 return code, and sets errno to EPIPE. I am noticing that the issue happens mostly when either a crash occurs in one of the FastCGI processes, or a bunch of them are seemingly terminated by the process manager. I haven't had any core dumps though, except for one, where the backtrace outputted by gdb is just a single call to free() at address 0x0000000000000000 with nothing else in the stack trace, so I don't really know what to make of that. I'm thinking it happens sometime after the SIGTERM signal is caught, maybe some global variable not being cleaned up properly or something.

    Read the article

  • Find More Streaming TV Online with Clicker.tv

    - by DigitalGeekery
    Looking for a way to access more of your favorite TV Shows and other online entertainment? Today we’ll take a look at Clicker.tv which offers an awesome way to find tons of TV programs and movies. Clicker.tv Clicker.tv is an HTML5 web application that indexes both free and premium content from sources like Hulu, Netflix, Amazon, iTunes, and more. Some movies or episodes, such as those from Netflix and Amazon.com’s Video on Demand, will require viewers to have a membership, or pay a fee to access content. There is also a Clicker.tv app for Boxee.   Navigation Navigating in Clicker.tv is rather easy with your keyboard. Directional Keys: navigate up, down, left, and right. Enter: make a selection Backspace: return to previous screen Escape: return to the Clicker.tv home screen. Note: You can also navigate through Clicker.tv with your PC remote. Recommended Browsers Firefox 3.6 + Safari 4.0 + Internet Explorer 8 + Google Chrome Note: You’ll need the latest version of Flash installed to play the majority of content. Earlier versions of the above browsers may work, but for full keyboard functionality, stick with the recommendations. Using Clicker.tv The first time you go to Clicker.tv, (link below) you’ll be met with a welcome screen and some helpful hints. Click Enter when finished.   The Home screen feature Headliners, Trending Shows, and Trending Episodes. You can scroll through the different options and category links along the left side.   The Search link pulls up an onscreen keyboard so you can enter search terms with a remote as well as a keyboard. Type in your search terms and matching items are displayed on the screen.   You can also browse by a wide variety of categories. Select TV to browse only available TV programs. Or, browse only Movies in the movie category. There are also links for Web content and Music.   Creating an Account You can access all Clicker.tv content without an account, but a Clicker account allows users to create playlists and subscribe to shows and have them automatically added to their playlist. You’ll need to go to Clicker.com and create an account. You’ll find the link at the upper right of the page. Enter a username, password and email address. There also an option to link with Facebook, or you can simply Skip this step.   Go to Clicker.tv and sign in. You can manually type in your credentials or use the onscreen keyboard with your remote.   Settings If you’d prefer not to display content from premium sites or Netflix, you can remove them through the Settings. Toggle Amazon, iTunes and Netflix on or off.   Watching Episodes To watch an episode, select the image to begin playing from the default source, or select one of the other options. You can see in the example below that you can choose to watch the episode from Fox, Hulu, or Amazon Video on Demand.   Your episode will then launch and begin playing from your chosen source. If you choose a premium content source such as iTunes or Amazon’s VOD, you’ll be taken to the Amazon’s website or iTunes and prompted to purchase the content.   Playlists Once you’ve created an account and signed in, you can begin adding Shows to your playlist. Choose a series and select Add to Playlist.   You’ll see in the example below that Family Guy has been Added and the number 142 is shown next to the playlist icon to indicate that 142 episodes has been added to your playlist. Underneath the listings for each episode in your playlist you can mark as Watched, or Remove individual episodes.   You can also view the playlist or make any changes from the Clicker.com website. Click on “Playlist” on the top right of the Clicker.com site to access your playlists. You can select individual episodes from your playlists, remove them, or mark them as watched or unwatched. Clicker.TV and Boxee Boxee offers a Clicker.TV app that features a limited amount of the Clicker.TV content. You’ll find Clicker.TV located in the Boxee Apps Library. Select the Clicker App and then choose Start. From the Clicker App interface you can search or browse for available content. Select an episode you’d like to view… Then select play in the pop up window. You can also add it to your Boxee queue, share it, or add a shortcut, just as you can from other Boxee apps. When you click play your episode will launch and begin playing in Boxee. Conclusion Clicker.TV is currently still in Beta and has some limitations. Typical remotes won’t work completely in all external websites. So, you’ll still need a keyboard to be able to perform some operations such as switching to full screen mode. The Boxee app offers a more fully remote friendly environment, but unfortunately lacks a good portion of the Clicker.tv content. As with many content sites, availability of certain programming may be limited by your geographic location. Want to add Clicker.TV functionality to Windows Media Center? You can do so through the Boxee Integration for Windows 7 Media Center plug-in. Clicker.tv Clicker.com Similar Articles Productive Geek Tips Share Digital Media With Other Computers on a Home Network with Windows 7Stream Music and Video Over the Internet with Windows Media Player 12Listen to Online Radio with AntennaEnable Media Streaming in Windows Home Server to Windows Media PlayerNorton Internet Security 2010 [Review] TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips HippoRemote Pro 2.2 Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Nice Websites To Watch TV Shows Online 24 Million Sites Windows Media Player Glass Icons (icons we like) How to Forecast Weather, without Gadgets Outlook Tools, one stop tweaking for any Outlook version Zoofs, find the most popular tweeted YouTube videos

    Read the article

  • Agile Awakenings and the Rules of Agile

    - by Robert May
    For those that care, you can read my history of management and technology to understand why I think I’m qualified to talk about this at all.  It’s boring, so feel free to skip it. Awakenings I first started to play around with the idea of “agile” in 2004 or 2005.  I found a book on the Rational Unified Process that I thought was good, and attempted to implement parts of it.  I thought I was agile, but really, it wasn’t.   I still didn’t understand the concept of a team.  I still wanted to tell the team what to do and how to get it done.  I still thought I was smarter than the team. After that job, I started work on another project and began helping that team.  The first few months were really rough.  We were implementing Scrum, which was relatively new to everyone on the team, and, quite frankly, I was doing a poor job of it.  I was trying to micro-manage every aspect of the teams work, and we were all miserable. The moment of change came when the senior architect bailed on the project.  His comment to me was: “This isn’t Agile.  Where are the stand-ups?  Where are the stories?”  He was dead on, and I finally woke up.  I finally realized that I was the problem!  I wasn’t trusting the team.  I wasn’t helping the team.  I was being a manager. Like many (most?), I was claiming to be Agile and use Scrum, but I wasn’t in fact following the rules Scrum.  Since then, I’ve done a lot of studying, hands on practice, coaching of many different teams, and other learning around Scrum, and I have discovered that Scrum has some rules that must be followed for success, even though the process is about continuous improvement. I’ve been practicing Scrum right for about 4 years now and have helped multiple teams implement it successfully, so what you’re about to get is based on experience, rather than just theory. The Rules of Scrum In my experience, what I’ve found is that most companies that claim to be doing Scrum or Agile are actually NOT doing either.  This stems largely because they think that they can “adopt the rules of Agile that fit their organization.”  Sadly, many of them think that this means they can adopt iterations (sprints) and not much else.  Either that, or they think they can do whatever they want, or were doing before, and call it Scrum.  This is simply not true. Here are some rules that must be followed for you to really be doing Scrum.  I’ll go into detail on each one of these posts in future blog posts and update links here.  My intent is that this will help other teams implementing scrum to see more success. Agile does not allow you to do whatever you want A Product Owner is required A ScrumMaster is required The team must function as a Team, and QA must be part of the team Support from upper management is required A prioritized product backlog is required A prioritized sprint backlog is required Release planning is required Complete spring planning is required Showcases are required Velocity must be measured Retrospectives are required Daily stand-ups are required Visibility is absolutely required For now, I think that’s enough, although I reserve the right to add more.  If you’re breaking any of these rules, you’re probably not doing Scrum.  There are exceptions to these rules, but until you have practiced Scrum for a while, you don’t know what those exceptions are. Breaking the Rules Many teams break these rules because they are the ones that expose the most pain.  Scrum is not Advil.  It’s not intended to mask the pain, its intended to cure it.  Let me explain that analogy a bit more.  Recently, my 7 year old son broke his arm, quite severely (see the X-Ray to the right).  That caused him a great deal of pain.  We went first to one doctor, and after viewing the X-Ray, they determined that there was no way that they’d cast the arm at their location.  It was simply too bad of a break for them to deal with.  They did, however, give him some Advil for the pain and put a splint on his arm to stabilize the broken bones.  Within minutes, he was feeling much better.  Had we been stupid, we could have gone home and he’d have been just as happy as ever . . . until the pain medication wore off or one of his siblings touched the splint.  Then, all of that pain would come right back to the top.  Sure, he could make it go away by just taking more Advil and moving the splint out of the way, but that wasn’t going to fix the problem permanently. We ended up in an emergency room with a doctor who could fix his arm.  However, we were warned that the fix was going to be VERY painful, and it was.  Even with heavy sedation (Propofol), my son was in enough pain that he squirmed and wiggled trying to get his arm away from the doctor.  He had to endure this pain in order to have a functional arm. But the setting wasn’t the end.  He had to have several casts, had to have it re-broken once, since the first setting didn’t take and finally was given a clean bill of health. Agile implementation is much like this story.  Agile was developed as a result of people recognizing that the development methodologies that were currently in place simply were ineffective.  However, the fix to the broken development that’s been festering for many years is not painless.  Many people start Agile thinking that things will be wonderful.  They won’t!  Agile is about visibility, and often, it brings great pain to surface.  It causes all of the missed deadlines, the cowboy coders, the coasters, the micro-managers, the lazy, and all of the other problems that are really part of your development process now to become painfully visible to EVERYONE.  Many people don’t like this exposure.  Agile will make the pain better, but not if you remove the cast (the rules above) prematurely and start breaking the rules that expose the most pain.  The healing will take time and is not instant (like Advil).  Figuring out what the true source of pain and fixing it is very valuable to you, your team, and your company.  Remember as you’re doing this that Agile isn’t the source of the pain, it’s really just exposing it.  Find the source. My recommendation is that ALL of these rules are followed for a minimum of six months, and preferably for an entire year, before you decide to break any of these rules.  Get a few good releases under your belt.  Figure out what your velocity is and start firing as a team.  Chances are, after you see agile really in action, you won’t want to break the rules because you’ll see their value. More Reading Jean Tabaka recently published a list of 78 Things I Have Learned in 6 Years of Agile Coaching.  Highly recommended. Technorati Tags: Agile,Scrum,Rules

    Read the article

< Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >