Search Results

Search found 14985 results on 600 pages for 'port 25'.

Page 110/600 | < Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >

  • ssh tunnel to a remote CUPS server

    - by drevicko
    There is a CUPS server beyond a firewall and I'd like to use it's printers. I have ssh access to computers that can access the CUPS server, and can get at the servers web interface by forwarding say port 1631. I cannot forward port 631 as I've not got root access to anything on the servers network. In Ubuntu's 'Printing' control panel, I can enter the address of a server, but I've not been able to connect through the forwarded port (localhost:1631, which is forwarded to the remote CUPS server's 631 port). Any ideas?

    Read the article

  • Communicating with a remote host via HTTPS

    - by user619818
    I have developed a solution where a Java applet makes a socket connection to a port on a socket server (which happens to run on a web server). But a new client has implemented https within their LAN and so I am told communication must be via HTTPS. With standard socket communication you connect to a port on a host. But the clients HTTPS uses port 443. So will it be possible to connect to a socket server using a different port? I assume it must be possible? Any help would be much appreciated.

    Read the article

  • Wireless drivers

    - by Kencer
    The results for my laptop are as below. How will i install wireless drivers and graphics? $ lspci 00:00.0 Host bridge: Intel Corporation 2nd Generation Core Processor Family DRAM Controller (rev 09) 00:02.0 VGA compatible controller: Intel Corporation 2nd Generation Core Processor Family Integrated Graphics Controller (rev 09) 00:14.0 USB controller: Intel Corporation Panther Point USB xHCI Host Controller (rev 04) 00:16.0 Communication controller: Intel Corporation Panther Point MEI Controller #1 (rev 04) 00:1a.0 USB controller: Intel Corporation Panther Point USB Enhanced Host Controller #2 (rev 04) 00:1b.0 Audio device: Intel Corporation Panther Point High Definition Audio Controller (rev 04) 00:1c.0 PCI bridge: Intel Corporation Panther Point PCI Express Root Port 1 (rev c4) 00:1c.1 PCI bridge: Intel Corporation Panther Point PCI Express Root Port 2 (rev c4) 00:1c.3 PCI bridge: Intel Corporation Panther Point PCI Express Root Port 4 (rev c4) 00:1d.0 USB controller: Intel Corporation Panther Point USB Enhanced Host Controller #1 (rev 04) 00:1f.0 ISA bridge: Intel Corporation Panther Point LPC Controller (rev 04) 00:1f.2 SATA controller: Intel Corporation Panther Point 6 port SATA Controller [AHCI mode] (rev 04) 00:1f.3 SMBus: Intel Corporation Panther Point SMBus Controller (rev 04) 02:00.0 Network controller: Broadcom Corporation Device 4365 (rev 01) 03:00.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL8111/8168B PCI Express Gigabit Ethernet controller (rev 07) $ sudo lshw -c network *-network UNCLAIMED description: Network controller product: Broadcom Corporation vendor: Broadcom Corporation physical id: 0 bus info: pci@0000:02:00.0 version: 01 width: 64 bits clock: 33MHz capabilities: pm msi pciexpress bus_master cap_list configuration: latency=0 resources: memory:f0500000-f0507fff *-network description: Ethernet interface product: RTL8111/8168B PCI Express Gigabit Ethernet controller vendor: Realtek Semiconductor Co., Ltd. physical id: 0 bus info: pci@0000:03:00.0 logical name: eth0 version: 07 serial: 3c:97:0e:85:c0:0d size: 100Mbit/s capacity: 1Gbit/s width: 64 bits clock: 33MHz capabilities: pm msi pciexpress msix vpd bus_master cap_list ethernet physical tp mii 10bt 10bt-fd 100bt 100bt-fd 1000bt 1000bt-fd autonegotiation configuration: autonegotiation=on broadcast=yes driver=r8169 driverversion=2.3LK-NAPI duplex=full firmware=rtl8168e-3_0.0.4 03/27/12 ip=172.16.96.36 latency=0 link=yes multicast=yes port=MII speed=100Mbit/s resources: irq:43 ioport:2000(size=256) memory:f0404000-f0404fff memory:f0400000-f0403fff $ rfkill list all 0: tpacpi_bluetooth_sw: Bluetooth Soft blocked: no Hard blocked: no

    Read the article

  • pptp VPN, routing

    - by Adrian
    Details: eth0 = current internet port pptp1 = VPN connection, if I connect to my provider, he give me an IP address, which is accessible from the internet. This is what I need. I want to connect through this IP back to my PC. I want to keep my primary internet connection (eth0) on my PC for all traffic, but route traffic to VPN for specified application/or port, to access application/port from the IP, which I given from the pptp provider. Huhh? Difficult but, it is possible? If yes, how? Incoming port will be always: 33340 Outgoing port can be change, but usually it is 33330

    Read the article

  • Best way to deploy my node.js app on a Varnish/Nginx server

    - by Saif Bechan
    I am about to deploy a brand new node.js application, and I need some help setting this up. The way my setup is right now is as follows. I have Varnish running on external_ip:80 I have Nginx behind running on internal_ip:80 Both are listening on port 80, one internal port, one external. NOTE: the node.js app runs on WebSockets Now I have the my new node.js application that will listen on port 8080. Can I have varnish set up that it is in front of both nginx and node.js. Varnish has to proxy the websocket to port 8080, but then the static files such as css, js, etc has to go trough port 80 to nignx. Nginx does not support websockets out of the box, else I would so a setup like: varnish - nignx - node.js

    Read the article

  • Startech SVx41HDI Series Server Remote Control Usage Question - How do I switch away from a dead por

    - by tajh
    We have a Startech KVM over IP model SV841HDI and it was stuck pointing a port where the machine has been removed. We ended up having to physically plug something into that port in order to switch ports again, meaning that if someone in support accidentally switches to an empty port, we need to have a documented solution for making it useable again. The unit is old, no longer under warranty, firmware updates for it are no longer available (interestingly it runs a powerPC version of busybox). Since it does work well except for this one catch, we would like to avoid replacing it. Reading the manual, you have a several recommended methods. I tried them. Hit the left CTRL key a few times (as well as all the other popular KVM keys I could think of). The VNC GUI offers lots of buttons - none of them switch away from a dead port. The question is: how do I switch away from a dead port on this particular KVM remotely?

    Read the article

  • Can Ping but Cannot Telnet directly to SQL Server 2012 Cluster Nodes

    - by tresstylez
    We have a monitoring tool (Solarwinds Orion) that needs to connect to a 2-node failover SQL Server Cluster. For reasons outside of our control -- we cannot monitor the CLUSTER IP directly at this time, so we have fallen back to monitoring each cluster node IP directly. This is not working. Upon troubleshooting, we tried to test that the cluster node was listening on the proper (fixed) port by using telnet to the cluster node IP/port -- and the telnet failed. However, telnet'ing to the Cluster IP/Port was SUCCESSFUL! Each node has its own IP. Each node is listening on the identical FIXED port. Each node has Dynamic Ports disabled. Each node can be PINGED successfully from the monitoring tool. Windows Firewall is DISABLED. How can I troubleshoot why I cannot telnet to the listening port on the cluster nodes?

    Read the article

  • SSH not working from outside network

    - by alexander7567
    Ok.. First off my ISP does not block ports. I run web server just fine from another machine. I have port forwarded port 22. I can access within network but not out of.. I.E. my android. I get "The Operation Timed Out" on ConnectBot. Oh and I have allowed 22 on UFW. To answer what exactly happened was my ISP blocks port 22, even though a while back they told me they do not block any ports.. I changed it to port 27 and it worked without a problem.

    Read the article

  • HP Wireless Printer not working

    - by Omri Spector
    I have installed an HP DeskJet 4620 driver on a win 7 machine. All works perfectly for several days, and than printing is not longer possible. Instead I get the message: "Unable to communicate with printer". This happened on every Win 7 PC I tried, and none of the HP/MS sites contain any relevant info... (Posting this so that the answer appears online, as I did solve it after much work) Solution: It appears that HP installation puts a unique "port" called "HP Network re-discovery". It stops working after some time (possibly after the first time the printer/pc enter sleep mode). BUT, the standard MS TCP port works just fine. So: Go to "Printers" Right click Printer Click "Printer properties" and then "Printer" or "Fax" (for both - do all this twice) Click "Add Port..." Select "Standard TCP Port" Fill in details Move printer to use the new port by un-checking the old one and checking the new one Happy printing.

    Read the article

  • Upgrade from 13.04 to 13.10 broke remote SSH access?

    - by stackoverflowuser95
    I can no longer connect via SSH to my Ubuntu instance after upgrading from 13.04 to 13.10 with: # do-release-upgrade Connecting with $ ssh -vvv [ip here] gives me: OpenSSH_6.3, OpenSSL 1.0.1e 11 Feb 2013 debug2: ssh_connect: needpriv 0 debug1: Connecting to [ip here] [[ip here]] port 22. debug1: connect to address [ip here] port 22: Connection timed out ssh: connect to host [ip here] port 22: Connection timed out So I tried uncommenting #PasswordAuthentication yes in /etc/ssh/sshd_config, and restarting with /etc/init.d/ssh restart; but there was no difference.

    Read the article

  • Choppy USB mice on just one of USB ports

    - by user20532
    I've got Lenovo b560 laptop with latest, properly updated Kubuntu on it (11.04 natty, kernel 2.6.38-8-generic). It has three USB2.0 ports onboard. I usually plug a mouse into one of them (I've got 3 different mice - in office, at home and for when on the go). Sometimes, usually after laptop awakening from sleep, the mouse still works but cursor movements are choppy, as if the processor was extremely loaded (it's usually not). I found that if I re-plug the mouse cord into the other USB port, it works just fine. If I plug it back to problematic port, it is still choppy and remains choppy until next boot. Of course I want my mice to always work fine. Problem is: I cannot reproduce this behavior for sure, it happens sporadically but regularly. I use different USB ports (problem has ever happened on each of them since), I use different mice (each has failed me this way at least once), I cannot generally find what exactly is going wrong and why plugging to different port fixes the mouse instantly. So I'd like to hear at least clues where to look at, what to try to identify my problem. A bit of update: while beginning this post, I had the issue once again. I have just replugged the mouse back to problematic port and it is not recognized at all. On the other port it works smoothly.

    Read the article

  • USB hub keep changing ports

    - by Danniel Magno
    I have an external powered USB hub and I'm using gammu to send some SMSs, but every time the daemon connect to one specific modem, it has the port changed. Gammu is able to send just one SMS and after that the port is changed. I've already tried using: /dev/ttyUSB3 /dev/serial/by-path/pci-0000:00:0b.0-usb-0:3.4.3:1.0-port0 There is anything to do which will stop the ports to be changed or use any other fixed port? Thanks.

    Read the article

  • Allowing Skype through Squid proxy

    - by Blue Gene
    I have a squid proxy running on 192.168.1.2 on port 3000. with Squid i am able to connect to internet and browse websites but skype is not connecting even after i specified proxy server in it. In the skype configuration i mentioned it to use SOCKS5 through host 192.168.1.2 and port 3000. But still its not working.Port 443 is open in squid configuration. https is working ok as i can access gmail and bank payment sites,but skype can not access its server. acl Safe_ports port 443 # https acl SSL_ports port 443 also tried setting acl numeric_IPs dstdom_regex ^(([0-9]+\.[0-9]+\.[0-9]+\.[0-9]+)|(\[([0-9af]+)?:([0-9af:]+)?:([0-9af]+)?\])):443 acl Skype_UA browser ^skype http_access allow CONNECT numeric_IPS Skype_UA IPTABLES is set to accept all

    Read the article

  • Having two FTP ports for the user

    - by user1663896
    I'm running vsftpd on RedHat 6.4 using TLS/SSL on port 990. It works great. I have been tasked to have my VSFTPD server running on unencrypted port 21 as well. This gives my users to either use clear text FTP on port 21 or TLS/SSL on port 990. I have tried the following in my vsftpd.conf file and did not work. listen_port=990 listen_port=21 In my config file it has the following SSL parameters: chroot_local_user=YES ssl_enable=YES allow_anon_ssl=NO anonymous_enable=NO anon_world_readable_only=NO force_local_data_ssl=NO force_local_logins_ssl=NO require_ssl_reuse=NO Can VSFTPD run on port 21 and 990? Thanks in advanced.

    Read the article

  • No Sound in 12.04 on Acer TimelineX 3830TG

    - by Fawkes5
    When i first installed ubuntu 12.04 everything worked fine. All of a sudden my sound has stopped working!! This has happened before [like 2 days ago], however the next day it started working again. That may happen again...[I've already rebooted 5 times] My Sound Card is a HDA intel PCH My Sound Chip is Intel CougarPoint HDMI My machine is an Acer TimelineX 3830TG, heres my lcpci output 00:00.0 Host bridge: Intel Corporation 2nd Generation Core Processor Family DRAM Controller (rev 09) 00:01.0 PCI bridge: Intel Corporation Xeon E3-1200/2nd Generation Core Processor Family PCI Express Root Port (rev 09) 00:02.0 VGA compatible controller: Intel Corporation 2nd Generation Core Processor Family Integrated Graphics Controller (rev 09) 00:16.0 Communication controller: Intel Corporation 6 Series/C200 Series Chipset Family MEI Controller #1 (rev 04) 00:1a.0 USB controller: Intel Corporation 6 Series/C200 Series Chipset Family USB Enhanced Host Controller #2 (rev 04) 00:1b.0 Audio device: Intel Corporation 6 Series/C200 Series Chipset Family High Definition Audio Controller (rev 04) 00:1c.0 PCI bridge: Intel Corporation 6 Series/C200 Series Chipset Family PCI Express Root Port 1 (rev b4) 00:1c.1 PCI bridge: Intel Corporation 6 Series/C200 Series Chipset Family PCI Express Root Port 2 (rev b4) 00:1c.2 PCI bridge: Intel Corporation 6 Series/C200 Series Chipset Family PCI Express Root Port 3 (rev b4) 00:1c.3 PCI bridge: Intel Corporation 6 Series/C200 Series Chipset Family PCI Express Root Port 4 (rev b4) 00:1d.0 USB controller: Intel Corporation 6 Series/C200 Series Chipset Family USB Enhanced Host Controller #1 (rev 04) 00:1f.0 ISA bridge: Intel Corporation HM65 Express Chipset Family LPC Controller (rev 04) 00:1f.2 SATA controller: Intel Corporation 6 Series/C200 Series Chipset Family 6 port SATA AHCI Controller (rev 04) 00:1f.3 SMBus: Intel Corporation 6 Series/C200 Series Chipset Family SMBus Controller (rev 04) 01:00.0 VGA compatible controller: NVIDIA Corporation GF108 [GeForce GT 540M] (rev ff) 02:00.0 Ethernet controller: Atheros Communications Inc. AR8151 v2.0 Gigabit Ethernet (rev c0) 03:00.0 Network controller: Atheros Communications Inc. AR9287 Wireless Network Adapter (PCI-Express) (rev 01) 04:00.0 Unassigned class [ff00]: Realtek Semiconductor Co., Ltd. RTS5116 PCI Express Card Reader (rev 01) 05:00.0 USB controller: NEC Corporation uPD720200 USB 3.0 Host Controller (rev 04) I'm running a dual boot with Windows 7, sound always works there. I've tried loading earlier kernels [3.2.0 ] but that hasn't helped. I've tried playing with alsamixer, unmuting and raising volume, doesn't work I've tried playing with pauvcontrol, doesnt work. Althought, strangely, when i play a song, under output i can see a bar moving implying that something is working, just the sound isn't getting through my speakers. Thus it might be a hardware problem. I've tried unistalling and reinstalling pulsaudio annd alsamixer, doesn't work [maybe made it worse...]. I've heard reverting back to kernel 3.0... works, but i'm reluctant to try that[i dont know much about kernels]. Thank you. Please tell me what other information you need. EDIT: My audio has started working again after another reboot. However this time im not connected to my external audio on startup. I will see if this is the issue next time i'm at home Edit: Connecting to external audio is not the problem.

    Read the article

  • ubuntu 10.04: wlan0 No such device

    - by AodhanOL
    I am using a Dell xps l702x and I am using ubuntu 10.04 because I need to use f77 (don't ask) and I wasn't able to get it working on later versions of ubuntu. I cannot use the wifi at all. I have tried to fix it and have had limited success (changed the output from rfkill list all from Hard blocked: yes, to hard blocked: no). Here is the output from rfkill list all aodhan@aodhan-laptop:~$ rfkill list all 0: hci0: Bluetooth Soft blocked: no Hard blocked: no 1: dell-wifi: Wireless LAN Soft blocked: no Hard blocked: no 2: dell-bluetooth: Bluetooth Soft blocked: no Hard blocked: no Here is the output from iwconfig: aodhan@aodhan-laptop:~$ iwconfig lo no wireless extensions. eth0 no wireless extensions. pan0 no wireless extensions. And here is the output from ifconfig -a: aodhan@aodhan-laptop:~$ ifconfig -a eth0 Link encap:Ethernet HWaddr 5c:f9:dd:3d:f2:f7 inet addr:192.168.1.17 Bcast:192.168.1.255 Mask:255.255.255.0 inet6 addr: fe80::5ef9:ddff:fe3d:f2f7/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:3417 errors:0 dropped:0 overruns:0 frame:0 TX packets:2894 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:3317567 (3.3 MB) TX bytes:505049 (505.0 KB) Interrupt:30 Base address:0x2000 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:12 errors:0 dropped:0 overruns:0 frame:0 TX packets:12 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:720 (720.0 B) TX bytes:720 (720.0 B) pan0 Link encap:Ethernet HWaddr 7e:7e:e8:39:70:af BROADCAST MULTICAST MTU:1500 Metric:1 RX packets:0 errors:0 dropped:0 overruns:0 frame:0 TX packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:0 (0.0 B) TX bytes:0 (0.0 B) And finally, the output from lspci: 00:00.0 Host bridge: Intel Corporation Device 0104 (rev 09) 00:01.0 PCI bridge: Intel Corporation Sandy Bridge PCI Express Root Port (rev 09) 00:02.0 VGA compatible controller: Intel Corporation Device 0116 (rev 09) 00:16.0 Communication controller: Intel Corporation Cougar Point HECI Controller #1 (rev 04) 00:1a.0 USB Controller: Intel Corporation Cougar Point USB Enhanced Host Controller #2 (rev 05) 00:1b.0 Audio device: Intel Corporation Cougar Point High Definition Audio Controller (rev 05) 00:1c.0 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 1 (rev b5) 00:1c.1 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 2 (rev b5) 00:1c.3 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 4 (rev b5) 00:1c.4 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 5 (rev b5) 00:1c.5 PCI bridge: Intel Corporation Cougar Point PCI Express Root Port 6 (rev b5) 00:1d.0 USB Controller: Intel Corporation Cougar Point USB Enhanced Host Controller #1 (rev 05) 00:1f.0 ISA bridge: Intel Corporation Device 1c4b (rev 05) 00:1f.2 SATA controller: Intel Corporation Cougar Point 6 port SATA AHCI Controller (rev 05) 00:1f.3 SMBus: Intel Corporation Cougar Point SMBus Controller (rev 05) 01:00.0 VGA compatible controller: nVidia Corporation Device 1246 (rev a1) 03:00.0 Network controller: Intel Corporation Device 008a (rev 34) 04:00.0 USB Controller: NEC Corporation Device 0194 (rev 04) 0a:00.0 Ethernet controller: Realtek Semiconductor Co., Ltd. RTL8111/8168B PCI Express Gigabit Ethernet controller (rev 06) Please help me! Thank you in advance. Edit: Further info - this is a dual install with a windows 7 system as the other option. However, I can't access that until tomorrow (I won't have access to the windows 7 disc until then, and grub isn't letting me load it). Therefore, I can't be sure whether it still works on that or not. It used to, though.

    Read the article

  • USB 3.0 randomly disconnecting and reconnecting

    - by user1624552
    I had an old laptop that died so I have bought a new one. I have taken the 2.5 SATA hard drive from the old laptop and I have put it into an external 2.5 SATA enclosure usb 3.0 and I connect it to the new laptop. My new laptop has Windows 8 64 bit installed. When I connect the external hard drive to the new laptop throught USB 3.0 port, it gets randomly disconnecting and reconnecting continuously, even when I am not using it. Also happens if I connect to another usb 3.0 port. Also I have observed that If I connect the external hard drive to a USB 2.0 port instead of an USB 3.0 port all work ok, no randomly disconnection and reconnection occurs. It only happens when I connect it to an USB 3.0 port. Some ideas to solve this issue?

    Read the article

  • javax.ejb.NoSuchEJBException after redeploying EJBs

    - by vetler
    Using Glassfish 3.0.1 ... If I have a web application accessing EJBs in another application remotely, and the remote application containing the EJBs is redeployed, I get a javax.ejb.NoSuchEJBException (see stacktrace below). Shouldn't this work? I can see that the EJB in question was successfully deployed, using the exact same JNDI name. Is there any other way to fix this than to restart the web application? It should be noted that in this particular example that the stacktrace is from, I'm accessing a servlet that injects the bean with CDI: public class StatusServlet extends HttpServlet { @Inject private StatusService statusService; @Override public void doGet(final HttpServletRequest req, final HttpServletResponse res) throws IOException { res.getWriter().write(statusService.getStatus()); } } The injection is done with the following producer to get the right EJB: public class StatusServiceProducer extends AbstractServiceProducer { @EJB(name = "StatusService") private StatusService service; @Produces public StatusService getService(final InjectionPoint ip) { return service; } } A producer is used to make it easier to wrap the service in a proxy, and to make it easier to change how the EJBs are looked up. The StatusService interface and implementation is as follows: @Stateless(name = "StatusService") public class StatusServiceImpl implements StatusService { private static final String OK = "OK"; public String getStatus() { // Some code return OK; } } public interface StatusService { String getStatus(); } Full stacktrace: [#|2011-01-12T10:45:28.273+0100|WARNING|glassfish3.0.1|javax.enterprise.system.container.web.com.sun.enterprise.web|_ThreadID=50;_ThreadName=http-thread-pool-8080-(1);|StandardWrapperValve[Load Balancer status servlet]: PWC1406: Servlet.service() for servlet Load Balancer status servlet threw exception javax.ejb.NoSuchEJBException at org.example.service._StatusService_Wrapper.getStatus(org/example/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: java.rmi.NoSuchObjectException: CORBA OBJECT_NOT_EXIST 1330446338 No; nested exception is: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.javax.rmi.CORBA.Util.mapSystemException(Util.java:280) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:200) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) ... 39 more Caused by: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:513) at com.sun.corba.ee.impl.protocol.giopmsgheaders.MessageBase.getSystemException(MessageBase.java:913) at com.sun.corba.ee.impl.protocol.giopmsgheaders.ReplyMessage_1_2.getSystemException(ReplyMessage_1_2.java:129) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.getSystemExceptionReply(CorbaMessageMediatorImpl.java:681) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.processResponse(CorbaClientRequestDispatcherImpl.java:510) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:153) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) ... 42 more |#]

    Read the article

  • How to select from tableA sum of grouped numbers from tableB above their sums average in Oracle?

    - by Nazgulled
    I have data like this: tableA.ID --------- 1 2 3 tableB.ID tableB.NUM -------------------- 1 10 1 15 2 18 3 12 2 15 3 13 1 12 I need to select tableA IDs where the sum of their NUMs in tableB is above the average of all tableA IDs sums. In other words: SUM ID=1 -> 10+15+12 = 37 SUM ID=2 -> 18+12+15 = 45 SUM ID=3 -> 12+13 = 25 AVG ALL IDs -> (37+45+25)/3 = 35 The SELECT must only show ID 1 and 2 because 37 35, 45 35 but 25 < 35. This is my current query which is working fine: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > ( SELECT AVG(MY_SUM) FROM ( SELECT SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID GROUP BY tableA.ID ) ) GROUP BY tableA.ID But I have a feeling there might be a better way without all those nested SELECTs. Perhaps 2, but 3 feels like too much. I'm probably wrong though. For instance, why can't I do something simple like this: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > AVG(SUM(tableB.NUM)) GROUP BY tableA.ID Or this: SELECT tableA.ID, SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING MY_SUM > AVG(MY_SUM) GROUP BY tableA.ID

    Read the article

  • Why can't I send SOAP requests to Ebay finding API with this php?

    - by Jay
    This is my code: <?php error_reporting(E_ALL); //new instance of soapClient pointing to Ebay finding api $client = new SoapClient("http://developer.ebay.com/webservices/finding/latest/FindingService.wsdl"); //attach required parameters to soap message header $header_arr = array(); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "SOAP11"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-NAME", "FindingService"); $header_arr[] = new SoapHeader("X-EBAY-SOA-OPERATION-NAME", "findItemsByKeywords"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-VERSION", "1.0.0"); $header_arr[] = new SoapHeader("X-EBAY-SOA-GLOBAL-ID", "EBAY-GB"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SECURITY-APPNAME", "REMOVED"); $header_arr[] = new SoapHeader("X-EBAY-SOA-REQUEST-DATA-FORMAT", "XML"); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "XML"); $test = $client->__setSoapHeaders($header_arr); $client->__setLocation("http://svcs.ebay.com/services/search/FindingService/v1");//endpoint $FindItemsByKeywordsRequest = array( "keywords" => "potter" ); $result = $client->__soapCall("findItemsByKeywords", $FindItemsByKeywordsRequest); //print_r($client->__getFunctions()); //print_r($client->__getTypes()); //print_r($result); ? And this is the error I receive: Fatal error: Uncaught SoapFault exception: [axis2ns2:Server] Missing SOA operation name header in C:\xampplite\htdocs\OOP\newfile.php:25 Stack trace: #0 C:\xampplite\htdocs\OOP\newfile.php(25): SoapClient-__soapCall('findItemsByKeyw...', Array) #1 {main} thrown in C:\xampplite\htdocs\OOP\newfile.php on line 25 It doesnt make sense, I have already set the operation name in the header of the request... Does anyone know what is wrong here?

    Read the article

  • word wrap in tcpdf

    - by ChuckO
    I'm using tcpdf to creat a pdf version of the html table below. How do I word wrap the text in the cells? <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <style type="text/css"> table.frm { width: 960px; Height:400px; margin-left: auto; margin-right: auto; border-width: 0px 0px 0px 0px; border-spacing: 0px; border-style: solid solid solid solid; border-color: gray gray gray gray; border-collapse: collapse; background-color: white; font-family: Verdana,Arial,Helvetica,sans-serif; font-size: 11px; } table.frm th { Width: 120px; border-width: 1px 1px 1px 1px; padding: 1px 1px 1px 1px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } table.frm td { width: 120px; height: 80px; vertical-align: top; border-width: 1px 1px 1px 1px; padding: 2px 2px 2px 2px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } </style> <title>Weekly Menu</title> </head> <body> <table class="frm"> <tr> <th align="center" colspan="8"><b>WEEKLY MENU</b></th> </tr> <tr> <th align="center" colspan="8"><b>Your Name Here</b></th> </tr> <tr> <th></th> <th>Monday</th> <th>Tuesday</th> <th>Wednesday</th> <th>Thursday</th> <th>Friday</th> <th>Saturday</th> <th>Sunday</th> </tr> <tr> <td><b>Breakfast</b></td> <td>Scrambled Eggs Black Coffee</td> <td>Vegetable Omelet Black Coffee</td> <td>2 slices Toast Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Orange Juice Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Pancakes w/syrup Black Coffee</td> </tr> <tr> <td><b>Lunch</b></td> <td>Tuna Salad Sandwich Diet Coke</td> <td>Greek Salad Black Coffee</td> <td></td> <td>Amer Cheese Sandwich Orange Juice</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Dinner</b></td> <td>Burger Fried Onions Diet Coke</td> <td>Steak Fries Diet Sprite</td> <td></td> <td>Chicken Cutlet Baked Potato Peas</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Snack</b></td> <td>Apple</td> <td>Orange</td> <td>Sm bag of chips</td> <td>Celery Sticks</td> <td></td> <td></td> <td></td> </tr> </table> </body> </html> This is the tcpdf code: $pdf = new TCPDF('Landscape', 'mm', '', true, 'UTF-8', false); $pdf->SetTitle('Weekly Menu'); $pdf->SetMargins(15, 7.5, 12.5); $pdf->SetAutoPageBreak(TRUE, PDF_MARGIN_BOTTOM); $pdf->SetPrintHeader(false); $pdf->SetPrintFooter(false); $pdf->AddPage(); $pdf->setFormDefaultProp(array('lineWidth'=>0, 'borderStyle'=>'dot', 'fillColor'=>array(235, 235, 255), 'strokeColor'=>array(255,255,250))); $pdf->SetFont('times', 'BU', 12); $pdf->cell(250, 8, 'Weekly Menu', 0, 1, 'C'); $pdf->cell(250, 8, $yourname, 0, 1, 'C'); $pdf->SetFont('times', '', 10); $cw=35; $ch=25; $pdf->SetXY(15,50); $pdf->cell(25,5,'',1,0,'L'); $pdf->cell($cw,5,$day1,1,0,'C'); $pdf->cell($cw,5,$day2,1,0,'C'); $pdf->cell($cw,5,$day3,1,0,'C'); $pdf->cell($cw,5,$day4,1,0,'C'); $pdf->cell($cw,5,$day5,1,0,'C'); $pdf->cell($cw,5,$day6,1,0,'C'); $pdf->cell($cw,5,$day7,1,1,'C'); $pdf->cell(25,$ch,'Breakfast',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->breakfast,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Lunch',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->lunch,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Dinner',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->dinner,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Snack',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->snack,1,1,'L',0,0,false,'','T'); EOD;

    Read the article

  • XML String into a DataGridView (C#)

    - by Justin Daniels
    I am currently working with a webservice to pull a report about users in a remote support system. After pulling my report and receiving the result, I am given the following string back by the method: <report><header><field id="0">Source</field><field id="1">Session ID</field><field id="2">Date</field><field id="3">Name</field><field id="24">Technician Name</field><field id="25">Technician ID</field></header><data><row><field id="0">Email</field><field id="1">55037806</field><field id="2">4/13/2010 2:28:06 AM</field><field id="3">Bill Gates</field><field id="24">John</field><field id="25">1821852</field></row><row><field id="0">Telephone</field><field id="1">55034548</field><field id="2">4/13/2010 12:59:44 AM</field><field id="3">Steve Jobs</field><field id="24">John</field><field id="25">1821852</field></row></data></report> After receiving this string, I need to take it and display the actual data in a datagridview. I've tried putting it into an XMLDocument then reading that, but it seems to keep failing. Just interested in another set of eyes :) Application is written in C# in VS2010.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 106 107 108 109 110 111 112 113 114 115 116 117  | Next Page >