Search Results

Search found 3099 results on 124 pages for 'portable areas'.

Page 112/124 | < Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >

  • Keeping track of business rules within IT department?

    - by evaldas-alexander
    I am looking for the best way to keep track of the business rules for both developers and everybody else (support staff / management) in a startup enviroment. The challenge is that our business model requires quite a lot of different business rules, which are created pretty much on the fly and evolving organically after that. After running this project for 3+ years, we have so many of such rules that often the only way to be sure about what the application is supposed to do in a certain situation is to go find the module responsible for that process and analyze its code and comments. That is all fine as long as you have one single developer who created the entire application from the scratch, but every new developer needs to go over pretty much entire codebase in order to understand how the application works. Even bigger problem is that non technical employees don't even have that option and therefore are forced to ask me pretty much every day how some certain case would be handled by the application. Quick example - we only start charging for our customer campaigns once they have been active for at least 72 hours, but at the same time we stop creating invoices for campaigns that belong to insolvent accounts and close such accounts within a month of the first failed charge. That does not apply to accounts that are set to "non-chargeable" which most commonly belongs to us since we are using the service ourselves. The invoices are created on the 1st of each month and include charges from the previous month + any current balance that the account might have. However, some customers are charged only 4 days after their invoice has been generated due to issues with their billing department. In addition to that, invoices are also created when customer deactivates his campaign, but that can only be done once the campaign is not longer under mandatory 6 month contract, unless account manager approves early deactivation. I know, that's quite a lot of rules that need to be taken into account when answering a question "when do we bill our customers", but actually I could still append an asterisk at the end of each sentence in order to disclose some rare exceptions. Of course, it would be easiest just to keep the business rules to the minimum, but we need to adapt to changing marketplace - i.e. less than a year ago we had no contracts whatsoever. One idea that I had so far was a simplistic wiki with categories corresponding to areas such as "Account activation", "Invoicing", "Collection procedures" and so on. Another idea would be to have giant interactive flowchart showing the entire customer "life cycle" from prospecting to account deactivation. What are your experiences / suggestions?

    Read the article

  • Separate specific #ifdef branches

    - by detly
    In short: I want to generate two different source trees from the current one, based only on one preprocessor macro being defined and another being undefined, with no other changes to the source. If you are interested, here is my story... In the beginning, my code was clean. Then we made a new product, and yea, it was better. But the code saw only the same peripheral devices, so we could keep the same code. Well, almost. There was one little condition that needed to be changed, so I added: #if defined(PRODUCT_A) condition = checkCat(); #elif defined(PRODUCT_B) condition = checkCat() && checkHat(); #endif ...to one and only one source file. In the general all-source-files-include-this header file, I had: #if !(defined(PRODUCT_A)||defined(PRODUCT_B)) #error "Don't make me replace you with a small shell script. RTFM." #endif ...so that people couldn't compile it unless they explicitly defined a product type. All was well. Oh... except that modifications were made, components changed, and since the new hardware worked better we could significantly re-write the control systems. Now when I look upon the face of the code, there are more than 60 separate areas delineated by either: #ifdef PRODUCT_A ... #else ... #endif ...or the same, but for PRODUCT_B. Or even: #if defined(PRODUCT_A) ... #elif defined(PRODUCT_B) ... #endif And of course, sometimes sanity took a longer holiday and: #ifdef PRODUCT_A ... #endif #ifdef PRODUCT_B ... #endif These conditions wrap anywhere from one to two hundred lines (you'd think that the last one could be done by switching header files, but the function names need to be the same). This is insane. I would be better off maintaining two separate product-based branches in the source repo and porting any common changes. I realise this now. Is there something that can generate the two different source trees I need, based only on PRODUCT_A being defined and PRODUCT_B being undefined (and vice-versa), without touching anything else (ie. no header inclusion, no macro expansion, etc)?

    Read the article

  • WPF: Improving Performance for Running on Older PCs

    - by Phil Sandler
    So, I'm building a WPF app and did a test deployment today, and found that it performed pretty poorly. I was surprised, as we are really not doing much in the way of visual effects or animations. I deployed on two machines: the fastest and the slowest that will need to run the application (the slowest PC has an Intel Celeron 1.80GHz with 2GB RAM). The application ran pretty well on the faster machine, but was choppy on the slower machine. And when I say "choppy", I mean the cursor jumped even just passing it over any open window of the app that had focus. I opened the Task Manager Performance window, and could see that the CPU usage jumped whenever the app had focus and the cursor was moving over it. If I gave focus to another (e.g. Excel), the CPU usage went back down after a second. This happened on both machines, but the choppiness was only noticeable on the slower machine. I had very limited time to tinker on the deployment machines, so didn't do a lot of detailed testing. The app runs fine on my development machine, but I also see the CPU spiking up to 10% there, just running the cursor over the window. I downloaded the WPF performance tool from MS and have been tinkering with it (on my dev machine). The docs say this about the "Frame Rate" metric in the Perforator tool: For applications without animation, this value should be near 0. The app is not doing any heavy animation, but the frame rate stays near 50 when the cursor is over any window. The screens I tested on have column headers in a grid that "highlight" and buttons that change color and appearance when scrolled over. Even moving the mouse on blank areas of the windows cause the same Frame rate and CPU usage (doesn't seem to be related to these minor animations). (Also, I am unable to figure out how to get anything but the two default tools--Perforator and Visual Profiler--installed into the WPF performance tool. That is probably a separate question). I also have Redgate's profiling tool, but I'm not sure if that can shed any light on rendering performance. So, I realize this is not an easy thing to troubleshoot without specifics or sample code (which I can't post). My questions are: What are some general things to look for (or avoid) in the code to improve performance? What steps can I take using the WPF performance tool to narrow down the problem? Is the PC spec listed above (Intel Celeron 1.80GHz with 2GB RAM) too slow to be running even vanilla WPF applications?

    Read the article

  • Rails 3: How do I call a javascript function from a js.erb file

    - by user321775
    Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

    Read the article

  • Finding contained bordered regions from Excel imports.

    - by dmaruca
    I am importing massive amounts of data from Excel that have various table layouts. I have good enough table detection routines and merge cell handling, but I am running into a problem when it comes to dealing with borders. Namely performance. The bordered regions in some of these files have meaning. Data Setup: I am importing directly from Office Open XML using VB6 and MSXML. The data is parsed from the XML into a dictionary of cell data. This wonks wonderfully and is just as fast as using docmd.transferspreadsheet in Access, but returns much better results. Each cell contains a pointer to a style element which contains a pointer to a border element that defines the visibility and weight of each border (this is how the data is structured inside OpenXML, also). Challenge: What I'm trying to do is find every region that is enclosed inside borders, and create a list of cells that are inside that region. What I have done: I initially created a BFS(breadth first search) fill routine to find these areas. This works wonderfully and fast for "normal" sized spreadsheets, but gets way too slow for imports into the thousands of rows. One problem is that a border in Excel could be stored in the cell you are checking or the opposing border in the adjacent cell. That's ok, I can consolidate that data on import to reduce the number of checks needed. One thing I thought about doing is to create a separate graph that outlines the cells using the borders as my edges and using a graph algorithm to find regions that way, but I'm having trouble figuring out how to implement the algorithm. I've used Dijkstra in the past and thought I could do similar with this. So I can span out using no endpoint to search the entire graph, and if I encounter a closed node I know that I just found an enclosed region, but how can I know if the route I've found is the optimal one? I guess I could flag that to run a separate check for the found closed node to the previous node ignoring that one edge. This could work, but wouldn't be much better performance wise on dense graphs. Can anyone else suggest a better method? Thanks for taking the time to read this.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • One Controller is Sometimes Bound Twice with Ninject

    - by Dusda
    I have the following NinjectModule, where we bind our repositories and business objects: /// <summary> /// Used by Ninject to bind interface contracts to concrete types. /// </summary> public class ServiceModule : NinjectModule { /// <summary> /// Loads this instance. /// </summary> public override void Load() { //bindings here. //Bind<IMyInterface>().To<MyImplementation>(); Bind<IUserRepository>().To<SqlUserRepository>(); Bind<IHomeRepository>().To<SqlHomeRepository>(); Bind<IPhotoRepository>().To<SqlPhotoRepository>(); //and so on //business objects Bind<IUser>().To<Data.User>(); Bind<IHome>().To<Data.Home>(); Bind<IPhoto>().To<Data.Photo>(); //and so on } } And here are the relevant overrides from our Global.asax, where we inherit from NinjectHttpApplication in order to integrate it with Asp.Net Mvc (The module lies in a separate dll called Thing.Web.Configuration): protected override void OnApplicationStarted() { base.OnApplicationStarted(); //routes and areas AreaRegistration.RegisterAllAreas(); RegisterRoutes(RouteTable.Routes); //Initializes a singleton that must reference this HttpApplication class, //in order to provide the Ninject Kernel to the rest of Thing.Web. This //is necessary because there are a few instances (currently Membership) //that require manual dependency injection. NinjectKernel.Instance = new NinjectKernel(this); //view model factory. NinjectKernel.Instance.Kernel.Bind<IModelFactory>().To<MasterModelFactory>(); } protected override NinjectControllerFactory CreateControllerFactory() { return base.CreateControllerFactory(); } protected override Ninject.IKernel CreateKernel() { var kernel = new StandardKernel(); kernel.Load("Thing.Web.Configuration.dll"); return kernel; } Now, everything works great, with one exception: For some reason, sometimes Ninject will bind the PhotoController twice. This leads to an ActivationException, because Ninject can't discern which PhotoController I want. This causes all requests for thumbnails and other user images on the site to fail. Here is the PhotoController in it's entirety: public class PhotoController : Controller { public PhotoController() { } public ActionResult Index(string id) { var dir = Server.MapPath("~/" + ConfigurationManager.AppSettings["UserPhotos"]); var path = Path.Combine(dir, id); return base.File(path, "image/jpeg"); } } Every controller works in exactly the same way, but for some reason the PhotoController gets double-bound. Even then, it only happens occasionally (either when re-building the solution, or on staging/production when the app pool kicks in). Once this happens, it continues to happen until I redeploy without changing anything. So...what's up with that?

    Read the article

  • Coping with feelings of technical mediocrity

    - by Karim
    As I've progressed as a programmer, I noticed more nuance and areas I could study in depth. In part, I've come to think of myself from, at one point, a "guru" to now much less, even mediocre or inadequate. Is this normal, or is it a sign of a destructive excessive ambition? Background I started to program when I was still a kid, I had about 10 or 11 years. I really enjoy my work and never get bored from it. It's amazing how somebody could be paid for what he really likes to do and would be doing it anyway even for free. When I first started to program, I was feeling proud of what I was doing, each application I built was for me a success and after 2-3 year I had a feeling that I'm a coding guru. It was a nice feeling. ;-) But the more I was in the field and the more types of software I started to develop, I was starting to have a feeling that I'm completely wrong in thinking I'm a guru. I felt that I'm not even a mediocre developer. Each new field I start to work on is giving me this feeling. Like when I once developed a device driver for a client, I saw how much I need to learn about device drivers. When I developed a video filter for an application, I saw how much do I still need to learn about DirectShow, Color Spaces, and all the theory behind that. The worst thing was when I started to learn algorithms. It was several years ago. I knew then the basic structures and algorithms like the sorting, some types of trees, some hashtables, strings, etc. and when I really wanted to learn a group of structures I learned about 5-6 new types and saw that in fact even this small group has several hundred subtypes of structures. It's depressing how little time people have in their lives to learn all this stuff. I'm now a software developer with about 10 years of experience and I still feel that I'm not a proficient developer when I think about things that others do in the industry.

    Read the article

  • How do I write object classes effectively when dealing with table joins?

    - by Chris
    I should start by saying I'm not now, nor do I have any delusions I'll ever be a professional programmer so most of my skills have been learned from experience very much as a hobby. I learned PHP as it seemed a good simple introduction in certain areas and it allowed me to design simple web applications. When I learned about objects, classes etc the tutor's basic examnples covered the idea that as a rule of thumb each database table should have its own class. While that worked well for the photo gallery project we wrote, as it had very simple mysql queries, it's not working so well now my projects are getting more complex. If I require data from two separate tables which require a table join I've instead been ignoring the class altogether and handling it on a case by case basis, OR, even worse been combining some of the data into the class and the rest as a separate entity and doing two queries, which to me seems inefficient. As an example, when viewing content on a forum I wrote, if you view a thread, I retrieve data from the threads table, the posts table and the user table. The queries from the user and posts table are retrieved via a join and not instantiated as an object, whereas the thread data is called using my Threads class. So how do I get from my current state of affairs to something a little less 'stupid', for want of a better word. Right now I have a DB class that deals with connection and escaping values etc, a parent db query class that deals with the common queries and methods, and all of the other classes (Thread, Upload, Session, Photo and ones thats aren't used Post, User etc ) are children of that. Do I make a big posts class that has the relevant extra attributes that I retrieve from the users (and potentially threads) table? Do I have separate classes that populate each of their relevant attributes with a single query? If so how do I do that? Because of the way my classes are written, based on what I was taught, my db update row method, or insert method both just take the attributes as an array and update all of that, if I have extra attributes from other db tables in each class then how do I rewrite those methods as obbiously updating automatically like that would result in errors? In short I think my understanding is limited right now and I'd like some pointers when it comes to the fundamentals of how to write more complex classes.

    Read the article

  • Optimizing GDI+ drawing?

    - by user146780
    I'm using C++ and GDI+ I'm going to be making a vector drawing application and want to use GDI+ for the drawing. I'v created a simple test to get familiar with it: case WM_PAINT: GetCursorPos(&mouse); GetClientRect(hWnd,&rct); hdc = BeginPaint(hWnd, &ps); MemDC = CreateCompatibleDC(hdc); bmp = CreateCompatibleBitmap(hdc, 600, 600); SelectObject(MemDC,bmp); g = new Graphics(MemDC); for(int i = 0; i < 1; ++i) { SolidBrush sb(Color(255,255,255)); g->FillRectangle(&sb,rct.top,rct.left,rct.right,rct.bottom); } for(int i = 0; i < 250; ++i) { pts[0].X = 0; pts[0].Y = 0; pts[1].X = 10 + mouse.x * i; pts[1].Y = 0 + mouse.y * i; pts[2].X = 10 * i + mouse.x; pts[2].Y = 10 + mouse.y * i; pts[3].X = 0 + mouse.x; pts[3].Y = (rand() % 600) + mouse.y; Point p1, p2; p1.X = 0; p1.Y = 0; p2.X = 300; p2.Y = 300; g->FillPolygon(&b,pts,4); } BitBlt(hdc,0,0,900,900,MemDC,0,0,SRCCOPY); EndPaint(hWnd, &ps); DeleteObject(bmp); g->ReleaseHDC(MemDC); DeleteDC(MemDC); delete g; break; I'm wondering if I'm doing it right, or if I have areas killing the cpu. Because right now it takes ~ 1sec to render this and I want to be able to have it redraw itself very quickly. Thanks In a real situation would it be better just to figure out the portion of the screen to redraw and only redraw the elements withing bounds of this?

    Read the article

  • Are there any CMS editors out there which users can populate locked down HTML templates with content

    - by Deep
    Hi there, We work in email marketing, creating HTML/TEXT emails for clients. In essence we design HTML email templates for our clients. Clients then post us content (via a form) to populate these templates before we send them out. Right now we do this manually, basically cutting and pasting the content from their submitted form into the relevant parts of the template, which is time consuming and particularly mind-numbing. What we're looking for (and have so far been unable to find) is a simple system which will allow us to capture this client content in a sort of WYSIWYG HTML format. Basically they populate a locked down version of the template, entering text where necessary, before submitting to us. This is our most basic requirement, and a friend of mine kindly demo'd a proof of concept here: http://advantageone.co.uk/mbe/ Note: If you click on a text area in the body of the template, an editor pop ups. Now what we are looking for a CMS editor out there which can be easily adapted to do the above and the following for our end clients? User login View previously submitted campaigns that they have created and edit these Create new - selecting from template (assigned to their user/client id), perhaps being able to add new rows to the template. And have these HTML templates locked down so they can only edit what they're allowed too (like in the demo above), and perhaps make some areas required. Perhaps have a simple workflow or approval built in Allow us to lock submitted campaigns after a point so they can't be further edited, and as administrators view all campaigns from all users Be so incredibly simple, with any extraneous functionality switched off Essentially an extremley simple stripped down CMS, but we use the outputted HTML for sending out as an email, rather than publishing onto the web. Now to the actual dilemma: we're looking for something really simple, and the above sounds like a CMS. But we haven't been able to find anything that already does, or can be easily adapted to do this. Everything is either too complex, or simple and inflexible. We're sure there must be something off the shelf available, rather than us coding something ourselves. But we've kind of got stuck. Does anyone know of a system, or could recommend a system that can do the above out of the box, or with a few days tweaking? Forgive me if this is a little disjointed, if I'm being incredibly dopey and there is something out there please let me know! Kind regards, Dp.

    Read the article

  • CSS / HTML - Image will not show up

    - by weka
    Ugh, ok. I've been up all night working this thing and now an image won't show. It's so darn annoying. Trying to get this .png image to show up on a simple PHP webpage. I just wanna go to sleep X_X CSS: <style> .achievement { position:relative; width:500px; background:#B5B5B5; float:left; padding:10px; margin-bottom:10px; } .icon { float:left; width:32px; height:32px; background: url("images/trophy.php") no-repeat center; padding:05px; border:4px solid #4D4D4D; } .ptsgained { position:absolute; top:0; right:0; background:#79E310; color:#fff; font-family:Tahoma; font-weight:bold; font-size:12px; padding:5px; } .achievement h1 { color:#454545; font-size:12pt; font-family:Georgia; font-weight:none; margin:0;padding:0; } .achievement p { margin:0;padding:0; font-size:12px; font-family:Tahoma; color:#1C1C1C; } .text { margin-left:10px; float:left; } </style> HTML: <div class="achievement"> <span class="ptsgained">+10</span> <div class="icon"></div> <div class="text"><h1>All Around Submitter</h1> <p>Submit and have approved content in all 6 areas.</p> </div> </div> What am I doing wrong, guys? :\

    Read the article

  • Issue with SQL query for activity stream/feed

    - by blabus
    I'm building an application that allows users to recommend music to each other, and am having trouble building a query that would return a 'stream' of recommendations that involve both the user themselves, as well as any of the user's friends. This is my table structure: Recommendations ID Sender Recipient [other columns...] -- ------ --------- ------------------ r1 u1 u3 ... r2 u3 u2 ... r3 u4 u3 ... Users ID Email First Name Last Name [other columns...] --- ----- ---------- --------- ------------------ u1 ... ... ... ... u2 ... ... ... ... u3 ... ... ... ... u4 ... ... ... ... Relationships ID Sender Recipient Status [other columns...] --- ------ --------- -------- ------------------ rl1 u1 u2 accepted ... rl2 u3 u1 accepted ... rl3 u1 u4 accepted ... rl4 u3 u2 accepted ... So for user 'u4' (who is friends with 'u1'), I want to query for a 'stream' of recommendations relevant to u4. This stream would include all recommendations in which either the sender or recipient is u4, as well as all recommendations in which the sender or recipient is u1 (the friend). This is what I have for the query so far: SELECT * FROM recommendations WHERE recommendations.sender IN ( SELECT sender FROM relationships WHERE recipient='u4' AND status='accepted' UNION SELECT recipient FROM relationships WHERE sender='u4' AND status='accepted') OR recommendations.recipient IN ( SELECT sender FROM relationships WHERE recipient='u4' AND status='accepted' UNION SELECT recipient FROM relationships WHERE sender='u4' AND status='accepted') UNION SELECT * FROM recommendations WHERE recommendations.sender='u4' OR recommendations.recipient='u4' GROUP BY recommendations.id ORDER BY datecreated DESC Which seems to work, as far as I can see (I'm no SQL expert). It returns all of the records from the Recommendations table that would be 'relevant' to a given user. However, I'm now having trouble also getting data from the Users table as well. The Recommendations table has the sender's and recipient's ID (foreign keys), but I'd also like to get the first and last name of each as well. I think I require some sort of JOIN, but I'm lost on how to proceed, and was looking for help on that. (And also, if anyone sees any areas for improvement in my current query, I'm all ears.) Thanks!

    Read the article

  • Three ways to upload/post/convert iMovie to YouTube

    - by user44251
    For Mac users, iMovie is probably a convenient tool for making, editing their own home movies so as to upload to YouTube for sharing with more people. However, uploading iMovie files to YouTube can't be always a smooth run, I did notice many people complaining about it. This article is delivered for guiding those who are haunted by the nightmare by providing three common ways to upload iMovie files to YouTube. YouTube and iMovie YouTube is the most popular video sharing website for users to upload, share and view videos. It empowers anyone with an Internet connection the ability to upload video clips and share them with friends, family and the world. Users are invited to leave comments, pick favourites, send messages to each other and watch videos sorted into subjects and channels. YouTube accepts videos uploaded in most container formats, including WMV (Windows Media Video), 3GP (Cell Phones), AVI (Windows), MOV (Mac), MP4 (iPod/PSP), FLV (Adobe Flash), MKV (H.264). These include video codecs such as MP4, MPEG and WMV. iMovie is a common video editing software application comes with every Mac for users to edit their own home movies. It imports video footage to the Mac using either the Firewire interface on most MiniDV format digital video cameras, the USB port, or by importing the files from a hard drive where users can edit the video clips, add titles, and add music. Since 1999, eight versions of iMovie have been released by Apple, each with its own functions and characteristic, and each of them deal with videos in a way more or less different. But the most common formats handled with iMovie if specialty discarded as far as to my research are MOV, DV, HDV, MPEG-4. Three ways for successful upload iMovie files to YouTube Solution one and solution two suitable for those who are 100 certainty with their iMovie files which are fully compatible with YouTube. For smooth uploading, you are required to get a YouTube account first. Solution 1: Directly upload iMovie to YouTube Step 1: Launch iMovie, select the project you want to upload in YouTube. Step 2: Go to the file menu, click Share, select Export Movie Step 3: Specify the output file name and directory and then type the video type and video size. Solution 2: Post iMovie to YouTube straightly Step 1: Launch iMovie, choose the project you want to post in YouTube Step 2: From the Share menu, choose YouTube Step 3: In the pop-up YouTube windows, specify the name of your YouTube account, the password, choose the Category and fill in the description and tags of the project. Tick Make this movie more private on the bottom of the window, if possible, to limit those who can view the project. Click Next, and then click Publish. iMovie will automatically export and upload the movie to YouTube. Step 4: Click Tell a Friend to email friends and your family about your film. You are also allowed to copy the URL from Tell a Friend window and paste it into an email you created in your favourite email application if you like. Anyone you send to email to will be able to follow the URL directly to your movie. Note: Videos uploaded to YouTube are limited to ten minutes in length and a file size of 2GB. Solution 3: Upload to iMovie after conversion If neither of the above mentioned method works, there is still a third way to turn to. Sometimes, your iMovie files may not be recognized by YouTube due to the versions of iMovie (settings and functions may varies among versions), video itself (video format difference because of file extension, resolution, video size and length), compatibility (videos that are completely incompatible with YouTube). In this circumstance, the best and reliable method is to convert your iMovie files to YouTube accepted files, iMovie to YouTube converter will be inevitably the ideal choice. iMovie to YouTube converter is an elaborately designed tool for convert iMovie files to YouTube workable WMV, 3GP, AVI, MOV, MP4, FLV, MKV for smooth uploading with hard-to-believe conversion speed and second to none output quality. It can also convert between almost all popular popular file formats like AVI, WMV, MPG, MOV, VOB, DV, MP4, FLV, 3GP, RM, ASF, SWF, MP3, AAC, AC3, AIFF, AMR, WAV, WMA etc so as to put on various portable devices, import to video editing software or play on vast amount video players. iMovie to YouTube converter can also served as an excellent video editing tool to meet your specific program requirements. For example, you can cut your video files to a certain length, or split your video files to smaller ones and select the proper resolution suitable for demands of YouTube by Clip or Settings separately. Crop allows you to cut off unwanted black edges from your videos. Besides, you can also have a good command of the whole process or snapshot your favourite pictures from the preview window. More can be expected if you have a try.

    Read the article

  • Three ways to upload/post/convert iMovie to YouTube [closed]

    - by alexyu2010
    For Mac users, iMovie is probably a convenient tool for making, editing their own home movies so as to upload to YouTube for sharing with more people. However, uploading iMovie files to YouTube can't be always a smooth run, I did notice many people complaining about it. This article is delivered for guiding those who are haunted by the nightmare by providing three common ways to upload iMovie files to YouTube. YouTube and iMovie YouTube is the most popular video sharing website for users to upload, share and view videos. It empowers anyone with an Internet connection the ability to upload video clips and share them with friends, family and the world. Users are invited to leave comments, pick favourites, send messages to each other and watch videos sorted into subjects and channels. YouTube accepts videos uploaded in most container formats, including WMV (Windows Media Video), 3GP (Cell Phones), AVI (Windows), MOV (Mac), MP4 (iPod/PSP), FLV (Adobe Flash), MKV (H.264). These include video codecs such as MP4, MPEG and WMV. iMovie is a common video editing software application comes with every Mac for users to edit their own home movies. It imports video footage to the Mac using either the Firewire interface on most MiniDV format digital video cameras, the USB port, or by importing the files from a hard drive where users can edit the video clips, add titles, and add music. Since 1999, eight versions of iMovie have been released by Apple, each with its own functions and characteristic, and each of them deal with videos in a way more or less different. But the most common formats handled with iMovie if specialty discarded as far as to my research are MOV, DV, HDV, MPEG-4. Three ways for successful upload iMovie files to YouTube Solution one and solution two suitable for those who are 100 certainty with their iMovie files which are fully compatible with YouTube. For smooth uploading, you are required to get a YouTube account first. Solution 1: Directly upload iMovie to YouTube Step 1: Launch iMovie, select the project you want to upload in YouTube. Step 2: Go to the file menu, click Share, select Export Movie Step 3: Specify the output file name and directory and then type the video type and video size. Solution 2: Post iMovie to YouTube straightly Step 1: Launch iMovie, choose the project you want to post in YouTube Step 2: From the Share menu, choose YouTube Step 3: In the pop-up YouTube windows, specify the name of your YouTube account, the password, choose the Category and fill in the description and tags of the project. Tick Make this movie more private on the bottom of the window, if possible, to limit those who can view the project. Click Next, and then click Publish. iMovie will automatically export and upload the movie to YouTube. Step 4: Click Tell a Friend to email friends and your family about your film. You are also allowed to copy the URL from Tell a Friend window and paste it into an email you created in your favourite email application if you like. Anyone you send to email to will be able to follow the URL directly to your movie. Note: Videos uploaded to YouTube are limited to ten minutes in length and a file size of 2GB. Solution 3: Upload to iMovie after conversion If neither of the above mentioned method works, there is still a third way to turn to. Sometimes, your iMovie files may not be recognized by YouTube due to the versions of iMovie (settings and functions may varies among versions), video itself (video format difference because of file extension, resolution, video size and length), compatibility (videos that are completely incompatible with YouTube). In this circumstance, the best and reliable method is to convert your iMovie files to YouTube accepted files, iMovie to YouTube converter will be inevitably the ideal choice. iMovie to YouTube converter is an elaborately designed tool for convert iMovie files to YouTube workable WMV, 3GP, AVI, MOV, MP4, FLV, MKV for smooth uploading with hard-to-believe conversion speed and second to none output quality. It can also convert between almost all popular popular file formats like AVI, WMV, MPG, MOV, VOB, DV, MP4, FLV, 3GP, RM, ASF, SWF, MP3, AAC, AC3, AIFF, AMR, WAV, WMA etc so as to put on various portable devices, import to video editing software or play on vast amount video players. iMovie to YouTube converter can also served as an excellent video editing tool to meet your specific program requirements. For example, you can cut your video files to a certain length, or split your video files to smaller ones and select the proper resolution suitable for demands of YouTube by Clip or Settings separately. Crop allows you to cut off unwanted black edges from your videos. Besides, you can also have a good command of the whole process or snapshot your favourite pictures from the preview window. More can be expected if you have a try.

    Read the article

  • How to share internet over VPN and inside a virtual machine (Windows)?

    - by mountrix
    ` My final goal is to have a virtual machine at work in which anything that happen inside (tcp, udp, ping, ...) will use the Internet connection of a computer at home. So, if inside this VM should I open an Internet browser to a site such as "show my IP", my home IP should be printed. I am also looking for a way to debug/develop a software inside this VM, but I would like to tunnel only the connections of this software, not the full graphical interface, this is why a Remote Desktop solution won't fit me. The connection between the both computer should be secured somehow, like in a SSH tunnel. This ultimately should allow me to have a portable VM in which I can connect to whatever networks I have access at home, in a secure way. This is my configuration: At work, I have a LAN-connected desktop computer, with Windows 7 Professional Edition as a host [computer W] On this same computer, I have a Virtual Box machine running Windows XP [computer V] At home, I have a laptop computer, running Windows 7 Home Edition [computer H] This laptop is connected to a Livebox 2 broadband modem by Wifi. What I am trying to do is to sit at work in front of the virtual machine [V], and connect to a webpage as if the request was issued from the laptop [H] at home, and the data should be securely tunneled between the both. But if I am using internet directly inside [W], it should use the normal LAN interface at work. To achieve my goal, I first try using VPN, than SSH tunneling, without success. I first tried to install Teamviewer between [W] and [H]. This is working fine, I can send files, share desktop, etc. Teamviewer has a VPN mode that creates a new VPN network interface with its own IP, both on computer [W] and [H]. This allowed me to connect [H] as a network computer inside [W] and I was able to share files, but not to share Internet. At this point, I tried to use from [W] the Internet as if I was at home. I setup a route (using route add from command line in [W]) in order to instruct each packet going to a given website to pass by the new VPN interface on [W], with the hope it will be forwarded to [H], but the webpage was simply inaccessible. I then tried to setup a Windows VPN connection between [W] and [H], using the Windows 7 VPN feature. [H] was the server and [W] the client. But it failed: I got the "Unable to join a remote PC while trying to VPN" 720 Error when I was setting up the client on [W]. I think the problem is the Livebox 2 that could blocks the packets. But I am not sure of this: 1) with Teamviewer it works fine, 2) Livebox 2 has a configuration page for port mapping that gives the proper configuration to map VPN ports as an example so I guess that it should allow it, 3) I opened the ports 1723 (TCP) and 500 (UDP) according to some forums. Virtual box has a network configuration parameter in which I can use the VPN network interface created by Teamviewer as a bridged connection. This is suppose to work in the sense that all packets issued by the virtual machine [V] is supposed to go directly to [H]. But I had no internet connection inside [V]. Using the NAT mode, [V] has internet. For me this is the feature that I look for: filtering all connections from the virtual box application to the VPN network interface, and the remaining should use the normal LAN interface. Apart from the build-in feature of VBox, I even do not know if it is possible to route the packet from a given application to a given interface. Finally I tried also SSH tunneling, but this is not the solution I looked for. Using an external SSH server (Linux), I was able to create a localhost connection on [W] (or [V]), using something like 'ssh -N -D server[H]' in order to allow a web browser located in [W] to connect to any website using the SOCKS 5 proxy created locally (SOCKS is a build-in feature of SSH). But repeating the same operation on windows, using a windows SSH server inside [W] (I tried freeSSHd), it failed: SFTP worked, but not the SOCKS tunneling, it was like the browser in [H] did not find internet. Finally only Teamviewer looked able to create a VPN between [W] and [H], but I am not able to use it, as I want, I mean using the Internet connection of [H] sitting in front of [W]. I also tried to bridge the VPN interface and the wifi interface inside [H], but it blocked my laptop, and I tried also the Internet Connection Sharing, trying to share on [H] the wifi connection over the VPN interface. This fails also, but it seems because Teamviewer actually use the wifi interface to be able to provide the VPN link, so I guess I am creating a recursive loop. I do not know what to try next... Thank you for any advice!!

    Read the article

  • What would make a noise in a PC on graphics operations on a passively-cooled system?

    - by T.J. Crowder
    I have this system based on the Intel D510MO motherboard, which is basically an Atom D510 (dual-core HT Atom w/built-in GPU), an Intel NM10 chipset, and a Realtek Gigabit LAN controller. It's entirely passively cooled. I noticed almost immediately that there was a kind of very, very soft noise that corresponded with graphics operations, sort of the noise you'd get if you had a sheet of flat paper and slid something really light across it — but more electronic than that. I wrote it off as observation error and/or disk activity triggered by the graphics operation (although the latter seemed like a lot of unnecessary disk activity). It isn't. I got curious enough that I finally did a few controlled experiments, and here's what I've determined: It isn't the HDD. For one thing, the sounds the HDD makes (when seeking, when reading or writing, when just sitting there spinning) is different. For another, I used sudo hdparm -y /dev/sda (I'm using Ubuntu 10.04 LTS) to temporarily put the disk on standby while making sure that non-disk graphics op was happening in a loop. The disk spun down, but the other sound continued, corresponding perfectly with the timing of the graphics op. (Then the disk spun up again, but it takes long enough that I could rule out the HDD.) It isn't the monitor; I ensured the two were well physically-separated and the sound was definitely coming from the main box. It isn't something else in the room; the sound is coming from the box. It isn't cross-talk to an audio circuit coming out the speakers. (It doesn't have any speakers.) It isn't my mouse (e.g., when I'm trying to make graphics ops happen); the sound happens if I set up a recurring operation and don't use the mouse at all, or if I lift the mouse off the table slightly (but enough that the laser still registers movement). It isn't the voices in my head; they never whisper like that. Other observations: It doesn't seem to matter what the graphics operation is; anything that changes what's on the screen seems to do it. I get the sound when moving the mouse over the Chromium tab bar (which makes the tab backgrounds change); I get it when a web page has a counter on it that changes the text on the page: I get it when dragging window contents around. The sound is very, very slightly louder if the graphics op is larger, like scrolling a text area when writing a question on superuser.com, than for smaller operations like the tick counter on the web page. But it's very slight. It's fairly loud (and of good duration) when the op involves color changes to substantial surface areas. For instance, when asking a question here on superuser and you move the cursor between the question box and the tag box, and the help to the right fades out, changes, and fades back in. (Yet another example related to the web browser, so let me say: I hear it when operations completely unrelated to the web browser as well.) It doesn't sound like arcing or anything like that (I'd've shut off the machine Right Quick Like if it did). Moving windows does it. Scrolling windows (by and large) doesn't. I have the feeling I've heard this sort of thing before, when all system fans were on low and such, with other systems — but (again) written it off as observational error. For all the world it's like I'm hearing the CPU working (as opposed to the GPU; note the window scroll thing above) or data being transferred somewhere, but that just seems...unlikely. So what am I hearing? This may seem like a very localized question, but perhaps other silent PC enthusiasts may be interested as well...

    Read the article

  • FFMPEG Segfault Solutions

    - by Brentley_11
    I'm trying to convert a bunch of movies into h.264 mp4's using FFMPEG. These movies are sourced from various portable camcorders such as the Flip Mino HD and the Kodak ZI8. One issue I'm having with video from the ZI8 is it seems to be causing FFMPEG to segfault. Here is my command: ffmpeg -i 'XmasSailor720p60fps.MOV' -threads 2 -acodec libfaac -ab 96kb -vcodec libx264 -vpre hq -b 500kb -s 484x272 XmasSailor.mp4 Here is the output: FFmpeg version SVN-r20668, Copyright (c) 2000-2009 Fabrice Bellard, et al. built on Dec 2 2009 18:37:34 with gcc 4.2.4 (Ubuntu 4.2.4-1ubuntu4) configuration: --enable-libfaac --enable-libfaad --enable-libmp3lame --enable-libx264 --enable-gpl --enable-nonfree --enable-postproc --enable-pthreads --enable-shared libavutil 50. 5. 1 / 50. 5. 1 libavcodec 52.42. 0 / 52.42. 0 libavformat 52.39. 2 / 52.39. 2 libavdevice 52. 2. 0 / 52. 2. 0 libswscale 0. 7. 2 / 0. 7. 2 libpostproc 51. 2. 0 / 51. 2. 0 Seems stream 0 codec frame rate differs from container frame rate: 59.94 (60000/1001) -> 29.97 (30000/1001) Input #0, mov,mp4,m4a,3gp,3g2,mj2, from 'XmasSailor720p60fps.MOV': Duration: 00:00:05.37, start: 0.000000, bitrate: 12021 kb/s Stream #0.0(eng): Video: h264, yuv420p, 1280x720 [PAR 1:1 DAR 16:9], 11994 kb/s, 29.97 tbr, 90k tbn, 59.94 tbc Stream #0.1(eng): Audio: aac, 48000 Hz, stereo, s16, 128 kb/s Metadata major_brand : qt minor_version : 0 compatible_brands: qt comment : KODAK Zi8 Pocket Video Camera comment-eng : KODAK Zi8 Pocket Video Camera [libx264 @ 0x99e1020]using SAR=1/1 [libx264 @ 0x99e1020]using cpu capabilities: MMX2 SSE2Fast SSSE3 FastShuffle SSE4.1 Cache64 [libx264 @ 0x99e1020]profile High, level 2.1 Output #0, mp4, to 'XmasSailor.mp4': Stream #0.0(eng): Video: libx264, yuv420p, 484x272 [PAR 1:1 DAR 121:68], q=10-51, 500 kb/s, 30k tbn, 29.97 tbc Stream #0.1(eng): Audio: aac, 48000 Hz, stereo, s16, 96 kb/s Metadata comment : Encoded with the Statusfirm Video Transcoder Stream mapping: Stream #0.0 -> #0.0 Stream #0.1 -> #0.1 Press [q] to stop encoding [h264 @ 0x99de950]B picture before any references, skipping [h264 @ 0x99de950]decode_slice_header error [h264 @ 0x99de950]no frame! Error while decoding stream #0.0 [h264 @ 0x99de950]B picture before any references, skipping [h264 @ 0x99de950]decode_slice_header error [h264 @ 0x99de950]no frame! Error while decoding stream #0.0 frame= 20 fps= 0 q=13797729.0 size= 0kB time=0.66 bitrate= 0.6kbits/s frame= 39 fps= 37 q=13797729.0 size= 0kB time=1.30 bitrate= 0.3kbits/s frame= 48 fps= 30 q=33.0 size= 11kB time=0.10 bitrate= 903.0kbits/s frame= 58 fps= 27 q=31.0 size= 22kB time=0.43 bitrate= 421.0kbits/s frame= 67 fps= 25 q=29.0 size= 41kB time=0.73 bitrate= 462.6kbits/s frame= 75 fps= 23 q=29.0 size= 59kB time=1.00 bitrate= 486.7kbits/s frame= 83 fps= 22 q=29.0 size= 81kB time=1.27 bitrate= 521.9kbits/s frame= 90 fps= 21 q=29.0 size= 97kB time=1.50 bitrate= 530.1kbits/s frame= 98 fps= 20 q=29.0 size= 114kB time=1.77 bitrate= 526.9kbits/s frame= 106 fps= 20 q=29.0 size= 134kB time=2.04 bitrate= 537.7kbits/s frame= 114 fps= 19 q=29.0 size= 150kB time=2.30 bitrate= 533.7kbits/s frame= 122 fps= 19 q=29.0 size= 172kB time=2.57 bitrate= 547.8kbits/s frame= 130 fps= 19 q=29.0 size= 193kB time=2.84 bitrate= 557.5kbits/s frame= 136 fps= 18 q=29.0 size= 211kB time=3.04 bitrate= 570.0kbits/s frame= 144 fps= 18 q=29.0 size= 242kB time=3.30 bitrate= 599.5kbits/s frame= 152 fps= 17 q=30.0 size= 261kB time=3.57 bitrate= 598.6kbits/s frame= 157 fps= 15 q=-1.0 Lsize= 368kB time=5.21 bitrate= 579.3kbits/s video:302kB audio:61kB global headers:0kB muxing overhead 1.416371% [libx264 @ 0x99e1020]frame I:1 Avg QP:27.22 size: 8720 [libx264 @ 0x99e1020]frame P:48 Avg QP:25.15 size: 3759 [libx264 @ 0x99e1020]frame B:108 Avg QP:30.10 size: 1105 [libx264 @ 0x99e1020]consecutive B-frames: 0.6% 11.5% 28.8% 59.0% [libx264 @ 0x99e1020]mb I I16..4: 28.5% 47.6% 23.9% [libx264 @ 0x99e1020]mb P I16..4: 0.8% 1.3% 0.5% P16..4: 50.6% 17.7% 13.1% 0.0% 0.0% skip:15.9% [libx264 @ 0x99e1020]mb B I16..4: 0.2% 0.3% 0.1% B16..8: 44.0% 1.2% 2.6% direct: 5.1% skip:46.5% L0:45.5% L1:51.0% BI: 3.5% [libx264 @ 0x99e1020]final ratefactor: 23.51 [libx264 @ 0x99e1020]8x8 transform intra:49.9% inter:67.9% [libx264 @ 0x99e1020]direct mvs spatial:98.1% temporal:1.9% [libx264 @ 0x99e1020]coded y,uvDC,uvAC intra: 54.7% 76.1% 41.4% inter: 17.1% 24.4% 7.8% [libx264 @ 0x99e1020]i16 v,h,dc,p: 18% 52% 5% 25% [libx264 @ 0x99e1020]i8 v,h,dc,ddl,ddr,vr,hd,vl,hu: 12% 22% 9% 7% 10% 10% 9% 8% 13% [libx264 @ 0x99e1020]i4 v,h,dc,ddl,ddr,vr,hd,vl,hu: 13% 18% 8% 8% 10% 13% 10% 9% 12% [libx264 @ 0x99e1020]Weighted P-Frames: Y:10.4% [libx264 @ 0x99e1020]ref P L0: 60.2% 15.3% 11.0% 7.6% 5.2% 0.7% [libx264 @ 0x99e1020]ref B L0: 72.6% 15.6% 11.8% [libx264 @ 0x99e1020]kb/s:471.17 Segmentation fault I'm wondering if anyone else has ran into similar issues. I wasn't able to find anything helpful via Google. Another question I have is if anyone knows of a company that offers paid support for FFMPEG. Thank you for your time.

    Read the article

  • FFMPEG Segfault Solutions

    - by Brentley_11
    I'm trying to convert a bunch of movies into h.264 mp4's using FFMPEG. These movies are sourced from various portable camcorders such as the Flip Mino HD and the Kodak ZI8. One issue I'm having with video from the ZI8 is it seems to be causing FFMPEG to segfault. Here is my command: ffmpeg -i 'XmasSailor720p60fps.MOV' -threads 2 -acodec libfaac -ab 96kb -vcodec libx264 -vpre hq -b 500kb -s 484x272 XmasSailor.mp4 Here is the output: FFmpeg version SVN-r20668, Copyright (c) 2000-2009 Fabrice Bellard, et al. built on Dec 2 2009 18:37:34 with gcc 4.2.4 (Ubuntu 4.2.4-1ubuntu4) configuration: --enable-libfaac --enable-libfaad --enable-libmp3lame --enable-libx264 --enable-gpl --enable-nonfree --enable-postproc --enable-pthreads --enable-shared libavutil 50. 5. 1 / 50. 5. 1 libavcodec 52.42. 0 / 52.42. 0 libavformat 52.39. 2 / 52.39. 2 libavdevice 52. 2. 0 / 52. 2. 0 libswscale 0. 7. 2 / 0. 7. 2 libpostproc 51. 2. 0 / 51. 2. 0 Seems stream 0 codec frame rate differs from container frame rate: 59.94 (60000/1001) -> 29.97 (30000/1001) Input #0, mov,mp4,m4a,3gp,3g2,mj2, from 'XmasSailor720p60fps.MOV': Duration: 00:00:05.37, start: 0.000000, bitrate: 12021 kb/s Stream #0.0(eng): Video: h264, yuv420p, 1280x720 [PAR 1:1 DAR 16:9], 11994 kb/s, 29.97 tbr, 90k tbn, 59.94 tbc Stream #0.1(eng): Audio: aac, 48000 Hz, stereo, s16, 128 kb/s Metadata major_brand : qt minor_version : 0 compatible_brands: qt comment : KODAK Zi8 Pocket Video Camera comment-eng : KODAK Zi8 Pocket Video Camera [libx264 @ 0x99e1020]using SAR=1/1 [libx264 @ 0x99e1020]using cpu capabilities: MMX2 SSE2Fast SSSE3 FastShuffle SSE4.1 Cache64 [libx264 @ 0x99e1020]profile High, level 2.1 Output #0, mp4, to 'XmasSailor.mp4': Stream #0.0(eng): Video: libx264, yuv420p, 484x272 [PAR 1:1 DAR 121:68], q=10-51, 500 kb/s, 30k tbn, 29.97 tbc Stream #0.1(eng): Audio: aac, 48000 Hz, stereo, s16, 96 kb/s Metadata comment : Encoded with the Statusfirm Video Transcoder Stream mapping: Stream #0.0 -> #0.0 Stream #0.1 -> #0.1 Press [q] to stop encoding [h264 @ 0x99de950]B picture before any references, skipping [h264 @ 0x99de950]decode_slice_header error [h264 @ 0x99de950]no frame! Error while decoding stream #0.0 [h264 @ 0x99de950]B picture before any references, skipping [h264 @ 0x99de950]decode_slice_header error [h264 @ 0x99de950]no frame! Error while decoding stream #0.0 frame= 20 fps= 0 q=13797729.0 size= 0kB time=0.66 bitrate= 0.6kbits/s frame= 39 fps= 37 q=13797729.0 size= 0kB time=1.30 bitrate= 0.3kbits/s frame= 48 fps= 30 q=33.0 size= 11kB time=0.10 bitrate= 903.0kbits/s frame= 58 fps= 27 q=31.0 size= 22kB time=0.43 bitrate= 421.0kbits/s frame= 67 fps= 25 q=29.0 size= 41kB time=0.73 bitrate= 462.6kbits/s frame= 75 fps= 23 q=29.0 size= 59kB time=1.00 bitrate= 486.7kbits/s frame= 83 fps= 22 q=29.0 size= 81kB time=1.27 bitrate= 521.9kbits/s frame= 90 fps= 21 q=29.0 size= 97kB time=1.50 bitrate= 530.1kbits/s frame= 98 fps= 20 q=29.0 size= 114kB time=1.77 bitrate= 526.9kbits/s frame= 106 fps= 20 q=29.0 size= 134kB time=2.04 bitrate= 537.7kbits/s frame= 114 fps= 19 q=29.0 size= 150kB time=2.30 bitrate= 533.7kbits/s frame= 122 fps= 19 q=29.0 size= 172kB time=2.57 bitrate= 547.8kbits/s frame= 130 fps= 19 q=29.0 size= 193kB time=2.84 bitrate= 557.5kbits/s frame= 136 fps= 18 q=29.0 size= 211kB time=3.04 bitrate= 570.0kbits/s frame= 144 fps= 18 q=29.0 size= 242kB time=3.30 bitrate= 599.5kbits/s frame= 152 fps= 17 q=30.0 size= 261kB time=3.57 bitrate= 598.6kbits/s frame= 157 fps= 15 q=-1.0 Lsize= 368kB time=5.21 bitrate= 579.3kbits/s video:302kB audio:61kB global headers:0kB muxing overhead 1.416371% [libx264 @ 0x99e1020]frame I:1 Avg QP:27.22 size: 8720 [libx264 @ 0x99e1020]frame P:48 Avg QP:25.15 size: 3759 [libx264 @ 0x99e1020]frame B:108 Avg QP:30.10 size: 1105 [libx264 @ 0x99e1020]consecutive B-frames: 0.6% 11.5% 28.8% 59.0% [libx264 @ 0x99e1020]mb I I16..4: 28.5% 47.6% 23.9% [libx264 @ 0x99e1020]mb P I16..4: 0.8% 1.3% 0.5% P16..4: 50.6% 17.7% 13.1% 0.0% 0.0% skip:15.9% [libx264 @ 0x99e1020]mb B I16..4: 0.2% 0.3% 0.1% B16..8: 44.0% 1.2% 2.6% direct: 5.1% skip:46.5% L0:45.5% L1:51.0% BI: 3.5% [libx264 @ 0x99e1020]final ratefactor: 23.51 [libx264 @ 0x99e1020]8x8 transform intra:49.9% inter:67.9% [libx264 @ 0x99e1020]direct mvs spatial:98.1% temporal:1.9% [libx264 @ 0x99e1020]coded y,uvDC,uvAC intra: 54.7% 76.1% 41.4% inter: 17.1% 24.4% 7.8% [libx264 @ 0x99e1020]i16 v,h,dc,p: 18% 52% 5% 25% [libx264 @ 0x99e1020]i8 v,h,dc,ddl,ddr,vr,hd,vl,hu: 12% 22% 9% 7% 10% 10% 9% 8% 13% [libx264 @ 0x99e1020]i4 v,h,dc,ddl,ddr,vr,hd,vl,hu: 13% 18% 8% 8% 10% 13% 10% 9% 12% [libx264 @ 0x99e1020]Weighted P-Frames: Y:10.4% [libx264 @ 0x99e1020]ref P L0: 60.2% 15.3% 11.0% 7.6% 5.2% 0.7% [libx264 @ 0x99e1020]ref B L0: 72.6% 15.6% 11.8% [libx264 @ 0x99e1020]kb/s:471.17 Segmentation fault I'm wondering if anyone else has ran into similar issues. I wasn't able to find anything helpful via Google. Another question I have is if anyone knows of a company that offers paid support for FFMPEG. Thank you for your time.

    Read the article

  • Determining the required depth and specifications for a server cabinet

    - by Bingu Bingme
    I'm trying to understand the considerations ("why") that go into determining the specifications ("what") for a rackmount server cabinet, in order to determine what sort of rack I should purchase for my home use. Since this is for home use, I won't be following certain best practices (eg. hot/cold aisle, not even air conditioning) and may be willing to sacrifice in various areas in order to reduce cost and footprint - but please advise if there are safety concerns or other considerations to note. The most basic specs for a server cabinet are the dimensions (external width x external depth x usable height). Width: commonly 600mm or 800mm (if the use case requires extra clearance around the sides, such as if there is lots of cabling). In my case and most common cases, I'm going to stick with 600mm. Height: Select a sufficiently tall rack to fit my equipment. But how much may I stuff into it? Eg, if there is a 15U rack, can I really populate it with 15U of servers, or should I leave 1U at top and bottom for air circulation? Depth: Racks commonly have external depth of 600mm (network equipment), 800mm, 1000mm, or even longer. I'm trying to see how to fit into the 800mm depth. With reference to http://www.server-racks.com/rack-mount-depth.html, I'm hoping to have the front and rear posts mounted ~ 28.5" (72cm) apart, which would leave only 8cm for front space and rear space. How much rear space (from rear posts to back of rack) do I really need? I won't use cable management arms, so can I mount a 72cm depth server since the power, KVM, network cables won't take up much depth? My most important equipment are all < 60cm depth (4U chassis) and should comfortably fit within the 800mm cabinet. The rest of the equipment are very old 1U servers that range from 65-72cm depth. I might still want to make further use of them, or I might discard them since they are so old. Even if the 72cm servers cannot be powered on in an 800mm rack, I should be able to use them as 1U shelves. But, what server depth can I expect to be able to operate? Or am I forced to upgrade to 1000mm depth racks in order to use any servers deeper than 60cm? With reference to best practices for HP racks, some other specs and installation considerations: There aren't any minimum recommendations for clearance on the sides of the rack. It is recommended to leave 48" front clearance. The 48" front clearance is based on 32" chassis depth, 13" to extend the rack rails and mate the inner/outer rails, and 3" for movement. If I don't use such rails (eg, use shelves instead), it should be sufficient to leave front clearance of chassis depth + 3". It is recommended to leave 30" rear clearance "to provide space for servicing the rack". I'm planning to back the rack into a corner of the room, and wheel it slightly out when I need to access the rear. If the wheeling plan is ok, I still need to know how much rear clearance is required for air circulation and ventilation purposes. Castor wheels and stabilising feet. Since I'm backing the rack into a corner of the room, I'll only be able to set the stabilising feet on the front corners. Thoughts on safety? The rack that I'm considering has front glass doors with side ventilation slits and fully perforated rear doors. I'm hoping this will be a good balance between temperature and noise (only ventilation slits facing out the front, while the rear is facing the walls). Or is the sound of high-rpm fans going to escape through the front slits anyway and destroy my sanity?

    Read the article

  • How to stop windows resizing when the monitor display channel is turned off / switched to different source

    - by Heartspeace
    Have a new 6870 ati radeon adapter with its drivers set to 1080p 60hz resolution hooked up to a 2008 47" high end Samsung HDMI based TV. However, when the tv is turned to a different hdmi input -(when I come back into windows) somehow Windows decides to resize all the open apps to a lower resolution - including some of the side docked hidden pop-outs. When it resizes those though - it just sticked the pop-outs in the middle of the screen and all the resized windows from the open applications in the top left corner - all of them stacked on top of each other and resized to the smaller resolution. The things that seem to be ok after returning are the icons on the desktop, the taskbar, and the sidebar. Anyone have any knowledge of 1) how this happens 2) why it happens 3) how to stop it from resizing the applications and some of the docked pop-outs (they are not really resized after returning - they are just stuck in the middle of the screen approximately where they would be if the right or bottom sidebar should be if the screen was resized to that lower resolution). My hypothesis is that upon losing HDMI signal - that Windows is told by something (driver, or windows itself) that the resolution to be without a signal being present (noting that HDMI signals and handshakes are two way on HDMI devices. If it loses the signal or the tv is switched to another device - then the display adapter must figure that out and tell Windows or figures it out and designs randomly to change the display size). Any and all help is most appreciated. I asked AMD/ATI - but they said they don't know why or how this is happening. I was hoping that maybe this is THE place that the super users truly go to - those that develop display adapter drivers, or that dive deeply into these areas of windows. If there is better sites or just competing sites - please advise - noting I have already written AMD/ATI. HP Response / Additions 4/7/2011 It is really nice to get your reply Shinrai. (BTW is it proper etiquette on these forums to have a discussion?) Yet 'only one issue' - I am using a single display in this case - so Windows doesn't move application windows to another desktop. Windows (or something) decides to shrink the desktop it currently has and resize all windows to the maximum size of the desktop. As such I would be glad if Windows would just keep the current size of the one desktop that is in operation. I also know that this does NOT happen on monitors connected with DVI. There I have had one and two monitors setup and it doesn't resize those screens at all when disconnecting monitors, turning them off, whatever... they stay solid - everything in place - to such an extent that if you forgot the other monitor is off - you will have troubles finding some windows without using one of the control app utilities. So if I could even get the HDMI handling by Windows (or the display driver) ( 1] which is doing this anyway the display driver or Windows - and 2] where is that other resolution size (1024x768) coming from - its not the smallest and its not the largest?) to be having like DVI - Life would be golden (for this aspect anyway). ** found others with same problem in this thread: http://hardforum.com/showthread.php?t=1507324 Thanks, HP

    Read the article

  • volume group disappeared after xfs_check run

    - by John P
    EDIT** I have a volume group consisting of 5 RAID1 devices grouped together into a lvm and formatted with xfs. The 5th RAID device lost its RAID config (cat /proc/mdstat does not show anything). The two drives are still present (sdj and sdk), but they have no partitions. The LVM appeared to be happily using sdj up until recently. (doing a pvscan showed the first 4 RAID1 devices + /dev/sdj) I removed the LVM from the fstab, rebooted, then ran xfs_check on the LV. It ran for about half an hour, then stopped with an error. I tried rebooting again, and this time when it came up, the logical volume was no longer there. It is now looking for /dev/md5, which is gone (though it had been using /dev/sdj earlier). /dev/sdj was having read errors, but after replacing the SATA cable, those went away, so the drive appears to be fine for now. Can I modify the /etc/lvm/backup/dedvol, change the device to /dev/sdj and do a vgcfgrestore? I could try doing a pvcreate --uuid KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ /dev/sdj to make it recognize it, but I'm afraid that would erase the data on the drive UPDATE: just changing the pv to point to /dev/sdj did not work vgcfgrestore --file /etc/lvm/backup/dedvol dedvol Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Cannot restore Volume Group dedvol with 1 PVs marked as missing. Restore failed. pvscan /dev/sdj: read failed after 0 of 4096 at 0: Input/output error Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. Couldn't find device with uuid 'KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ'. PV /dev/sdd2 VG VolGroup00 lvm2 [74.41 GB / 0 free] PV /dev/md2 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md3 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md0 VG dedvol lvm2 [931.51 GB / 0 free] PV /dev/md4 VG dedvol lvm2 [931.51 GB / 0 free] PV unknown device VG dedvol lvm2 [1.82 TB / 63.05 GB free] Total: 6 [5.53 TB] / in use: 6 [5.53 TB] / in no VG: 0 [0 ] vgscan Reading all physical volumes. This may take a while... /dev/sdj: read failed after 0 of 4096 at 0: Input/output error /dev/sdj: read failed after 0 of 4096 at 2000398843904: Input/output error Found volume group "VolGroup00" using metadata type lvm2 Found volume group "dedvol" using metadata type lvm2 vgdisplay dedvol --- Volume group --- VG Name dedvol System ID Format lvm2 Metadata Areas 5 Metadata Sequence No 10 VG Access read/write VG Status resizable MAX LV 0 Cur LV 1 Open LV 0 Max PV 0 Cur PV 5 Act PV 5 VG Size 5.46 TB PE Size 4.00 MB Total PE 1430796 Alloc PE / Size 1414656 / 5.40 TB Free PE / Size 16140 / 63.05 GB VG UUID o1U6Ll-5WH8-Pv7Z-Rtc4-1qYp-oiWA-cPD246 dedvol { id = "o1U6Ll-5WH8-Pv7Z-Rtc4-1qYp-oiWA-cPD246" seqno = 10 status = ["RESIZEABLE", "READ", "WRITE"] flags = [] extent_size = 8192 # 4 Megabytes max_lv = 0 max_pv = 0 physical_volumes { pv0 { id = "Msiee7-Zovu-VSJ3-Y2hR-uBVd-6PaT-Ho9v95" device = "/dev/md2" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv1 { id = "ZittCN-0x6L-cOsW-v1v4-atVN-fEWF-e3lqUe" device = "/dev/md3" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv2 { id = "NRNo0w-kgGr-dUxA-mWnl-bU5v-Wld0-XeKVLD" device = "/dev/md0" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv3 { id = "2EfLFr-JcRe-MusW-mfAs-WCct-u4iV-W0pmG3" device = "/dev/md4" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 1953519872 # 931.511 Gigabytes pe_start = 384 pe_count = 238466 # 931.508 Gigabytes } pv4 { id = "KZron2-pPTr-ZYeQ-PKXX-4Woq-6aNc-AG4rRJ" device = "/dev/md5" # Hint only status = ["ALLOCATABLE"] flags = [] dev_size = 3907028992 # 1.81935 Terabytes pe_start = 384 pe_count = 476932 # 1.81935 Terabytes } }

    Read the article

  • Installing EclipseFP on Mac OS X

    - by Dom Kennedy
    I am trying to install EclipseFP. I'm running OS X Mavericks. I've tried following both the official installation instructions and the advice in this answer on SU, but I'm still having the same problem. I can get the plugin itself installed painlessly using Help -> Install New Software..., Bbut when I restart and switch to the Haskell perspective, things start to go wrong. The installation instructions tells me that I should receive a prompt to install BuildWrapper and Scion Browser. I do not receive this prompt. Furthermore, if I create a new Haskell project, my code has no syntax highlighting, and the Hoogle search feature does not appear to do anything. It's clear that the plugin is not set up correctly yet. I've tried running cabal update in Terminal, but this does not change anything. After several attempts going round in circles with this on Eclipse Juno, I uninstalled Eclispe and the Haskell Platform and performed a clean install of Eclipse Luna and the latest Haskell Platform. However, the problems are persisting. I've tried going into Preferences to see if I could sort any of this out manually. I should initially point out that my GHC installation seems to be correctly references under Preferences -> Haskell Implementations Under Haskell -> Helper executables, there are areas for configuring the options of both BuildWrapper and Scion Browser. At present, both are blank. I tried clicking the Install from Hackage... button beside each of them with no success; I receive an error message saying Expected executable <workspace>/.metadata/.plugins/net.sf.eclipsefp.haskell.ui/sandbox/.cabal-sandbox/bin/buildwrapper not found!` (replace buildwrapper for scion-browser and the message is the same) The Eclipse console displays the following exception after doing the above with BuildWrapper: src/Language/Haskell/BuildWrapper/GHCStorage.hs:313:32: Not in scope: data constructor ‘MatchGroup’ cabal.real: Error: some packages failed to install: buildwrapper-0.7.4 failed during the building phase. The exception was: ExitFailure 1 and after doing it for Scion-Browser: zip-archive-0.2.3.4 (reinstall) changes: text-1.1.0.0 -> 0.11.3.1 pandoc-1.12.3.3 (latest: 1.13) -http-conduit (new version) Graphalyze-0.14.1.0 (reinstall) changes: pandoc-1.12.4.2 -> 1.12.3.3, text-1.1.0.0 -> 0.11.3.1 cabal.real: The following packages are likely to be broken by the reinstalls: pandoc-1.12.4.2 unordered-containers-0.2.4.0 aeson-0.7.0.4 scientific-0.2.0.2 case-insensitive-1.1.0.3 HTTP-4000.2.10 Use --force-reinstalls if you want to install anyway. After receiving similar results as the above on previous attempts, I've tried using force-reinstalls and ended up at more dead ends. I am at a loss as to what is wrong and how to solve this. I should point out that my GHC installation appears to be correctly configured under Preferences -> Haskell -> Haskell Implementations. Apologies if any of this information is irrelevant, I'm just not really sure what is important and what isn't at this point. Any help anyone could provide me with would be greatly appreciated.

    Read the article

  • CodePlex Daily Summary for Saturday, March 06, 2010

    CodePlex Daily Summary for Saturday, March 06, 2010New ProjectsAgr.CQRS: Agr.CQRS is a C# framework for DDD applications that use the Command Query Responsibility Segregation pattern (CQRS) and Event Sourcing. BigDays 2010: Big>Days 2010BizTalk - Controlled Admin: Hi .NET folks, I am planning to start project on a Controlled BizTalk Admin tool. This tool will be useful for the organizations which have "Sh...Blacklist of Providers: Blacklist of Providers - the application for department of warehouse logistics (warehouse) at firms.Career Vector: A job board software.Chargify Demo: This is a sample website for ChargifyConceptual: Concept description and animationEric Hexter: My publicly available source code and examplesFluentNHibernate.Search: A Fluent NHibernate.Search mapping interface for NHibernate provider implementation of Lucene.NET.FreelancePlanner: FreelancePlanner is a project tracking tool for freelance translators.HTMLx - JavaScript on the Server for .NET: HTMLx is a set of libraries based on ASP.NET engine to provide JavaScript programmability on the server side. It allows Web developers to use JavaS...IronMSBuild: IronMSBuild is a custom MSBuild Task, which allows you to execute IronRuby scripts. // have to provide some examples LINQ To Blippr: LINQ to Blippr is an open source LINQ Provider for the micro-reviewing service Blippr. LINQ to Blippr makes it easier and more efficent for develo...Luk@sh's HTML Parser: library that simplifies parsing of the HTML documents, for .NETMeta Choons: Unsure as yet but will be a kind of discogs type site but different..NetWork2: NetWork2Regular Expression Chooser: Simple gui for choosing the regular expressions that have become more than simple.See.Sharper: Hopefully useful C# extensions.SharePoint 2010 Toggle User Interface: Toggle the SharePoint 2010 user interface between the new SharePoint 2010 user interface and SharePoint 2007 user interface.Silverlight DiscussionBoard for SharePoint: This is a sharepoint 3.0 webpart that uses a silverlight treeview to display metadata about sharepoint discussions anduses the html bridge to show...Simple Sales Tracking CRM API Wrapper: The Simple Sales Tracking API Wrapper, enables easy extention development and integration with the hosted service at http://www.simplesalestracking...Syntax4Word: A syntax addin for word 2007.TortoiseHg installer builder: TortoiseHg and Mercurial installer builder for Windowsunbinder: Model un binding for route value dictionariesWindows Workflow Foundation on Codeplex: This site has previews of Workflow features which are released out of band for the purposes of adoption and feedback.XNA RSM Render State Manager: Render state management idea for XNA games. Enables isolation between draw calls whilst reducing DX9 SetRenderState calls to the minimum.New ReleasesAgr.CQRS: Sourcecode package: Agr.CQRS is a C# framework for DDD applications that use the Command Query Responsibility Segregation pattern (CQRS) and Event Sourcing. This dow...Book Cataloger: Preview 0.1.6a: New Features: Export to Word 2007 Bibliography format Dictionary list editors for Binding, Condition Improvements: Stability improved Content ...Braintree Client Library: Braintree-1.1.2: Includes minor enhancements to CreditCard and ValidationErrors to support upcoming example application.CassiniDev - Cassini 3.5 Developers Edition: CassiniDev v3.5.0.5: For usage see Readme.htm in download. New in CassiniDev v3.5.0.5 Reintroduced the Lib project and signed all Implemented the CassiniSqlFixture -...Composure: Calcium-64420-VS2010rc1.NET4.SL3: This is a simple conversion of Calcium (rev 64420) built in VS2010 RC1 against .NET4 and Silverlight 3. No source files were changed and ALL test...Composure: MS AJAX Library (46266) for VS2010 RC1 .NET4: This is a quick port of Microsoft's AJAX Library (rev 46266) for Visual Studio 2010 RC1 built against .NET 4.0. Since this conversion was thrown t...Composure: MS Web Test Lightweight for VS2010 RC1 .NET4: A simple conversion of Microsoft's Web Test Lightweight for Visual Studio 2010 RC1 .NET 4.0. This is part of a larger "special request" conversion...CoNatural Components: CoNatural Components 1.5: Supporting new data types: Added support for binary data types -> binary, varbinary, etc maps to byte[] Now supporting SQL Server 2008 new types ...Extensia: Extensia 2010-03-05: Extensia is a very large list of extension methods and a few helper types. Some extension methods are not practical (e.g. slow) whilst others are....Fluent Assertions: Fluent Assertions release 1.1: In this release, we've worked hard to add some important missing features that we really needed, and also improve resiliance against illegal argume...Fluent Ribbon Control Suite: Fluent Ribbon Control Suite 1.0 RC: Fluent Ribbon Control Suite 1.0 (Release Candidate)Includes: Fluent.dll (with .pdb and .xml, debug and release version) Showcase Application Sa...FluentNHibernate.Search: 0.1 Beta: First beta versionFolderSize: FolderSize.Win32.1.0.7.0: FolderSize.Win32.1.0.6.0 A simple utility intended to be used to scan harddrives for the folders that take most place and display this to the user...Free Silverlight & WPF Chart Control - Visifire: Silverlight and WPF Step Line Chart: Hi, With this release Visifire introduces Step Line Chart. This release also contains fix for the following issues: * In WPF, if AnimatedUpd...Html to OpenXml: HtmlToOpenXml 1.0: The dll library to include in your project. The dll is signed for GAC support. Compiled with .Net 3.5, Dependencies on System.Drawing.dll and Docu...Line Counter: 1.5.1: The Line Counter is a tool to calculate lines of your code files. The tool was written in .NET 2.0. Line Counter 1.5.1 Added outline icons and lin...Lokad Cloud - .NET O/C mapper (object to cloud) for Windows Azure: Lokad.Cloud v1.0.662.1: You can get the most recent release directly from the build server at http://build.lokad.com/distrib/Lokad.Cloud/Lost in Translation: LostInTranslation v0.2: Alpha release: function complete but not UX complete.MDownloader: MDownloader-0.15.7.56349: Supported large file resumption. Fixed minor bugs.Mini C# Lab: Mini CSharp Lab Ver 1.4: The primary new feature of Ver 1.4 is batch mode! Now you can run Mini C# Lab program as a scheduled task, no UI interactivity is needed. Here ar...Mobile Store: First drop: First droppatterns & practices SharePoint Guidance: SPG2010 Drop6: SharePoint Guidance Drop Notes Microsoft patterns and practices ****************************************** ***************************************...Picasa Downloader: PicasaDownloader (41446): Changelog: Replaced some exception messages by a Summary dialog shown after downloading if there have been problems. Corrected the Portable vers...Pod Thrower: Version 1: This is the first release, I'm sure there are bugs, the tool is fully functional and I'm using it currently.PowerShell Provider BizTalk: BizTalkFactory PowerShell Provider - 1.1-snapshot: This release constitutes the latest development snapshot for the Provider. Please, leave feedback and use the Issue Tracker to help improve this pr...Resharper Settings Manager: RSM 1.2.1: This is a bug fix release. Changes Fixed plug-in crash when shared settings file was modified externally.Reusable Library Demo: Reusable Library Demo v1.0.2: A demonstration of reusable abstractions for enterprise application developerSharePoint 2010 Toggle User Interface: SharePoint Toggle User Interface: Release 1.0.0.0Starter Kit Mytrip.Mvc.Entity: Mytrip.Mvc.Entity(net3.5 MySQL) 1.0 Beta: MySQL VS 2008 EF Membership UserManager FileManager Localization Captcha ClientValidation Theme CrossBrowserTortoiseHg: TortoiseHg 1.0: http://bitbucket.org/tortoisehg/stable/wiki/ReleaseNotes Please backup your user Mercurial.ini file and then uninstall any 0.9.X release before in...Visual Studio 2010 and Team Foundation Server 2010 VM Factory: Rangers Virtualization Guidance: Rangers Virtualization Guidance Focused guidance on creating a Rangers base image manually and introduction of PowerShell scripts to automate many ...Visual Studio DSite: Advanced Email Program (Visual Basic 2008): This email program can send email to any one using your email username and email credentials. The email program can also attatch attactments to you...WPF ShaderEffect Generator: WPF ShaderEffect Generator 1.6: Several improvements and bug fixes have gone into the comment parsing code for the registers. The plug-in should now correctly pay attention to th...WSDLGenerator: WSDLGenerator 0.0.0.3: - Fixed SharePoint generated *.wsdl.aspx file - Added commandline option -wsdl which does only generate the wsdl file.Most Popular ProjectsMetaSharpRawrWBFS ManagerAJAX Control ToolkitMicrosoft SQL Server Product Samples: DatabaseSilverlight ToolkitWindows Presentation Foundation (WPF)ASP.NETLiveUpload to FacebookMicrosoft SQL Server Community & SamplesMost Active ProjectsUmbraco CMSRawrSDS: Scientific DataSet library and toolsBlogEngine.NETjQuery Library for SharePoint Web Servicespatterns & practices – Enterprise LibraryIonics Isapi Rewrite FilterFluent AssertionsComposureDiffPlex - a .NET Diff Generator

    Read the article

  • Run Windows in Ubuntu with VMware Player

    - by Matthew Guay
    Are you an enthusiast who loves their Ubuntu Linux experience but still needs to use Windows programs?  Here’s how you can get the full Windows experience on Ubuntu with the free VMware Player. Linux has become increasingly consumer friendly, but still, the wide majority of commercial software is only available for Windows and Macs.  Dual-booting between Windows and Linux has been a popular option for years, but this is a frustrating solution since you have to reboot into the other operating system each time you want to run a specific application.  With virtualization, you’ll never have to make this tradeoff.  VMware Player makes it quick and easy to install any edition of Windows in a virtual machine.  With VMware’s great integration tools, you can copy and paste between your Linux and Windows programs and even run native Windows applications side-by-side with Linux ones. Getting Started Download the latest version of VMware Player for Linux, and select either the 32-bit or 64-bit version, depending on your system.  VMware Player is a free download, but requires registration.  Sign in with your VMware account, or create a new one if you don’t already have one. VMware Player is fairly easy to install on Linux, but you will need to start out the installation from the terminal.  First, enter the following to make sure the installer is marked as executable, substituting version/build_number for the version number on the end of the file you downloaded. chmod +x ./VMware-Player-version/build_number.bundle Then, enter the following to start the install, again substituting your version number: gksudo bash ./VMware-Player-version/build_number.bundle You may have to enter your administrator password to start the installation, and then the VMware Player graphical installer will open.  Choose whether you want to check for product updates and submit usage data to VMware, and then proceed with the install as normal. VMware Player installed in only a few minutes in our tests, and was immediately ready to run, no reboot required.  You can now launch it from your Ubuntu menu: click Applications \ System Tools \ VMware Player. You’ll need to accept the license agreement the first time you run it. Welcome to VMware Player!  Now you can create new virtual machines and run pre-built ones on your Ubuntu desktop. Install Windows in VMware Player on Ubuntu Now that you’ve got VMware setup, it’s time to put it to work.  Click the Create a New Virtual Machine as above to start making a Windows virtual machine. In the dialog that opens, select your installer disk or ISO image file that you want to install Windows from.  In this example, we’re select a Windows 7 ISO.  VMware will automatically detect the operating system on the disk or image.  Click Next to continue. Enter your Windows product key, select the edition of Windows to install, and enter your name and password. You can leave the product key field blank and enter it later.  VMware will ask if you want to continue without a product key, so just click Yes to continue. Now enter a name for your virtual machine and select where you want to save it.  Note: This will take up at least 15Gb of space on your hard drive during the install, so make sure to save it on a drive with sufficient storage space. You can choose how large you want your virtual hard drive to be; the default is 40Gb, but you can choose a different size if you wish.  The entire amount will not be used up on your hard drive initially, but the virtual drive will increase in size up to your maximum as you add files.  Additionally, you can choose if you want the virtual disk stored as a single file or as multiple files.  You will see the best performance by keeping the virtual disk as one file, but the virtual machine will be more portable if it is broken into smaller files, so choose the option that will work best for your needs. Finally, review your settings, and if everything looks good, click Finish to create the virtual machine. VMware will take over now, and install Windows without any further input using its Easy Install.  This is one of VMware’s best features, and is the main reason we find it the easiest desktop virtualization solution to use.   Installing VMware Tools VMware Player doesn’t include the VMware Tools by default; instead, it automatically downloads them for the operating system you’re installing.  Once you’ve downloaded them, it will use those tools anytime you install that OS.  If this is your first Windows virtual machine to install, you may be prompted to download and install them while Windows is installing.  Click Download and Install so your Easy Install will finish successfully. VMware will then download and install the tools.  You may need to enter your administrative password to complete the install. Other than this, you can leave your Windows install unattended; VMware will get everything installed and running on its own. Our test setup took about 30 minutes, and when it was done we were greeted with the Windows desktop ready to use, complete with drivers and the VMware tools.  The only thing missing was the Aero glass feature.  VMware Player is supposed to support the Aero glass effects in virtual machines, and although this works every time when we use VMware Player on Windows, we could not get it to work in Linux.  Other than that, Windows is fully ready to use.  You can copy and paste text, images, or files between Ubuntu and Windows, or simply drag-and-drop files between the two. Unity Mode Using Windows in a window is awkward, and makes your Windows programs feel out of place and hard to use.  This is where Unity mode comes in.  Click Virtual Machine in VMware’s menu, and select Enter Unity. Your Windows desktop will now disappear, and you’ll see a new Windows menu underneath your Ubuntu menu.  This works the same as your Windows Start Menu, and you can open your Windows applications and files directly from it. By default, programs from Windows will have a colored border and a VMware badge in the corner.  You can turn this off from the VMware settings pane.  Click Virtual Machine in VMware’s menu and select Virtual Machine Settings.  Select Unity under the Options tab, and uncheck the Show borders and Show badges boxes if you don’t want them. Unity makes your Windows programs feel at home in Ubuntu.  Here we have Word 2010 and IE8 open beside the Ubuntu Help application.  Notice that the Windows applications show up in the taskbar on the bottom just like the Linux programs.  If you’re using the Compiz graphics effects in Ubuntu, your Windows programs will use them too, including the popular wobbly windows effect. You can switch back to running Windows inside VMware Player’s window by clicking the Exit Unity button in the VMware window. Now, whenever you want to run Windows applications in Linux, you can quickly launch it from VMware Player. Conclusion VMware Player is a great way to run Windows on your Linux computer.  It makes it extremely easy to get Windows installed and running, lets you run your Windows programs seamlessly alongside your Linux ones.  VMware products work great in our experience, and VMware Player on Linux was no exception. If you’re a Windows user and you’d like to run Ubuntu on Windows, check out our article on how to Run Ubuntu in Windows with VMware Player. Link Download VMware Player 3 (Registration required) Download Windows 7 Enterprise 90-day trial Similar Articles Productive Geek Tips Enable Copy and Paste from Ubuntu VMware GuestInstall VMware Tools on Ubuntu Edgy EftRestart the Ubuntu Gnome User Interface QuicklyHow to Add a Program to the Ubuntu Startup List (After Login)How To Run Ubuntu in Windows 7 with VMware Player TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Snagit 10 Get a free copy of WinUtilities Pro 2010 World Cup Schedule Boot Snooze – Reboot and then Standby or Hibernate Customize Everything Related to Dates, Times, Currency and Measurement in Windows 7 Google Earth replacement Icon (Icons we like) Build Great Charts in Excel with Chart Advisor

    Read the article

< Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >