Search Results

Search found 3684 results on 148 pages for 'sequence logo'.

Page 112/148 | < Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >

  • Make Your PC Look Like Windows Phone 7

    - by Matthew Guay
    Windows Phone 7 offers a unique and exciting UI that displays lots of information efficiently on the screen.  And with a simple Rainmeter theme, you can have the same UI and content directly on your Windows 7 desktop. Turn your Desktop into a Windows Phone 7 lookalike To give your Windows 7 desktop a Windows Phone 7 makeover, first you need to have the free Rainmeter application installed.  If you do not have it installed, download it from the link below and run the setup.  Accept the license agreement, and install it with the default settings. By default Rainmeter will automatically run when you start your computer.  If you do not want this, you can uncheck the box during the setup. Now, download the Omnimo UI theme for Rainmeter (link below).  You will need to unzip the folder first. This theme uses the Segoe UI and the Segoe UI Light font, so Windows Vista users need to install the segoeuil.ttf font first, and XP users need to install both the segoeui.ttf and the segoeuil.ttf font first.  Copy the appropriate fonts to C:\Windows\Fonts, or in Vista double-click on the font and select Install. Now, run the Rainmeter theme setup.  Double-click on the Rainstaller.exe in the Omnimo folder. Click Express install to add the theme and skin to Rainmeter. Click Finish, and by default Rainmeter will open with your new theme. When the new theme opens the first time, you will be asked to read the readme, or simply go to the gallery. When you open the gallery, you can choose from a wide variety of tiles and gadgets to place on your desktop.  You can also choose a different color scheme for your tiles. Once you’re done, click the X in the top right hand corner to close the Gallery.  Welcome to your Windows Phone 7 desktop!  Many of the gadgets are dynamic, and you can change the settings for most of them.  The only thing missing is the transition animations that Windows Phone 7 shows when you launch an application. To make it look even more like Windows Phone 7, you can change your background to black.  This makes the desktop theme really dramatic. And, if you want to add gadgets or change the color scheme, simply click on the + logo on the top. Windows Phone 7 Desktop Wallpapers If you’d prefer to simply change your background, My Microsoft Life has several very nice Windows Phone 7 wallpapers available for free.  Click the link below to download these and other Microsoft-centric wallpapers. If you can’t wait to get the new Windows phone 7, this is a great way to start experiencing the beauty of the phone UI on your desktop. Links Download Rainmeter Download the Omnimo UI Rainmeter theme Download Windows Phone 7 inspired wallpapers Similar Articles Productive Geek Tips Try out Windows Phone 7 on your PC todayTest All Features of Windows Phone 7 On Your PCHow-To Geek on Lifehacker: How to Make Windows Vista Less AnnoyingCreate a Shortcut or Hotkey to Mute the System Volume in WindowsMake Ubuntu Automatically Save Changes to Your Session TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 Norwegian Life If Web Browsers Were Modes of Transportation Google Translate (for animals) Roadkill’s Scan Port scans for open ports Out of 100 Tweeters Out of band Security Update for Internet Explorer

    Read the article

  • Moving from WDS to MDT + WDS - Prestaged Computer Name

    - by MSCF
    We previously used just WDS to deploy our images. WDS was setup to request approval for new machines. We used the "Name and Approve" option to name the machines as we added them. If it was pre-existing, it would just use the existing computer name from AD. Then in our unattend.xml file we had Computername=%MACHINENAME%. This picked up the name we gave it during approval and set the computer name accordingly. We are now implementing MDT to manage our images and drivers. But upon testing, we noticed it would assign random computer names. I went into the Unattend.xml for the deploy task sequence and added that value under Specialize amd64_Microsoft-Windows-Shell-Setup_neutral Computername=%MACHINENAME%. But when we try applying the image, it errors out at that point of the install. How can an MDT deployment be configured to leverage the pre-staged name? Some additional info: Error message during the imaging process: Windows could not parse or process the unattend answer file for pass [specialize]. The settings specified in the answer file cannot be applied. The error was detected while processing settings for component [Microsoft-Windows-Shell-Setup].? setuperr.log: 2014-07-22 14:02:13, Error [setup.exe] [Action Queue] : Unattend action failed with exit code 4 2014-07-22 14:02:13, Error [setup.exe] Execution of unattend GCs failed; hr = 0x0; pResults-hrResult = 0x8030000b

    Read the article

  • fsck on LVM snapshots

    - by Alpha01
    I'm trying to do some file system checks using LVM snapshots of our Logical Volumes to see if any of them have dirty file systems. The problem that I have is that our LVM only has one Volume Group with no available space. I was able to do fsck's on some of the logical volumes using a loopback file system. However my question is, is it possible to create a 200GB loopback file system, and saved it on the same partition/logical volume that I'll be taking a snapshot of? Is LVM smart enough to not take a snapshot copy of the actual snapshot? [root@server z]# vgdisplay --- Volume group --- VG Name Web2-Vol System ID Format lvm2 Metadata Areas 1 Metadata Sequence No 29 VG Access read/write VG Status resizable MAX LV 0 Cur LV 6 Open LV 6 Max PV 0 Cur PV 1 Act PV 1 VG Size 544.73 GB PE Size 4.00 MB Total PE 139450 Alloc PE / Size 139450 / 544.73 GB Free PE / Size 0 / 0 VG UUID BrVwNz-h1IO-ZETA-MeIf-1yq7-fHpn-fwMTcV [root@server z]# df -h Filesystem Size Used Avail Use% Mounted on /dev/sda2 9.7G 3.6G 5.6G 40% / /dev/sda1 251M 29M 210M 12% /boot /dev/mapper/Web2--Vol-var 12G 1.1G 11G 10% /var /dev/mapper/Web2--Vol-var--spool 12G 184M 12G 2% /var/spool /dev/mapper/Web2--Vol-var--lib--mysql 30G 15G 14G 52% /var/lib/mysql /dev/mapper/Web2--Vol-usr 13G 3.3G 8.9G 27% /usr /dev/mapper/Web2--Vol-z 468G 197G 267G 43% /z /dev/mapper/Web2--Vol-tmp 3.0G 76M 2.8G 3% /tmp tmpfs 7.9G 92K 7.9G 1% /dev/shm The logical volume in question is /dev/mapper/Web2--Vol-z. I'm afraid if I created the loopback file system in /dev/mapper/Web2--Vol-z and take a snapshot of it, the disk size will be trippled in size, thus running out of disk space available.

    Read the article

  • Open Office crashes, recovers, crashes again

    - by Daniel R Hicks
    After completely reinstalling my laptop due to apparent registry corruption, I've encountered a problem with Open Office: I open a simple Calc spreadsheet, it comes up normally, but then after anywhere from 5 seconds to several minutes (without even touching the Calc window) OO crashes, then comes up through recovery. If I let it "recover" it will do so and bring the spreadsheet up again, only to repeat the crash scenario again. If I kept clicking "OK" it would apparently do this all day. I reinstalled OO once and the problem went away for awhile, but it came back. I then attempted to "reset" my profile (ie, rename the OO user directory in App Data), but OO crashed during the first startup after that, then resumed the original behavior. If I open the same file using Excel it complains of errors in the file, and "recovers" them, but the "error report" it generates contains no details. If I save the "recovered" file then OO Calc will open it, but the problem returns after saving again. Any ideas? (The system is Vista SP2, running OO 3.4.1) How to reproduce: Start Open Office Calc. Save workspace as "CrashTest.ods" From Task Manager kill Open Office (soffice.exe/bin -- one of each) Double click on the saved "CrashTest.ods" in Explorer. OO puts up a message that recovery will occur -- allow it. When the Calc window comes up, don't touch it -- just wait about 10 seconds. Calc window closes and OO puts up a message that recovery will occur -- from now on the sequence will repeat. I suspect this behavior is limited to a few (recent) versions of OO, and very possibly only Calc. Reported as Open Office Bug 1211094. Sigh!! As much as it irritates me, I'm having to switch over to Excel for several things I used to do with Calc. Excel has a miserable UI, but at least it says up for longer than 10 seconds.

    Read the article

  • Error when trying to deploy Windows XP SP3 with WDS

    - by Nic Young
    I have created a WDS server running Windows Server 2008 R2. I have built my custom images of Windows 7 using WAIK and MDT 2010 that are installed on the server. I used this guide to help me through the process. The Windows 7 images that I have created capture and deploy properly. I am attempting to follow the same steps from the guide I linked to capture and deploy a Windows XP SP3 image. I am able to sysprep and capture the reference machine with no errors. I am then able to import the custom .wim that I just captured in to MDT 2010 with no issues either. However when I try to deploy this image to a test virtual machine I get the following error: Deployment Error: I have made sure that the .iso that I am importing the source files from originally to create the sysprep and capture sequence is indeed a Windows XP SP3 iso. When I first select a PE boot environment before I deploy I select the x86 PE boot image that I created originally when making this for my Windows 7 deployments. Could this be the issue? If so how do I make a boot image specific for Windows XP SP3 deployments? I have Googled around for this error and some places point to the deployment image not being able to find setup.exe and other important system files for installing the operating system. If so, how do I add these to the image? Any ideas?

    Read the article

  • Recursive move utility on Unix?

    - by Thomas Vander Stichele
    Sometimes I have two trees that used to have the same content, but have grown out of sync (because I moved disks around or whatever). A good example is a tree where I mirror upstream packages from Fedora. I want to merge those two trees again by moving all of the files from tree1 into tree2. Usually I do this with: rsync -arv tree1/* tree2 Then delete tree1. However, this takes an awful lot of time and disk space, and it would be much easier to be able to do: mv -r tree1/* tree2 In other words, a recursive move. It would be faster because first of all it would not even copy, just move the inodes, and second I wouldn't need a delete at the end. Does this exist ? As a test case, consider the following sequence of commands: $ mkdir -p a/b $ touch a/b/c1 $ rsync -arv a/ a2 sending incremental file list created directory ./ b/ b/c1 b/c2 sent 173 bytes received 57 bytes 460.00 bytes/sec total size is 0 speedup is 0.00 $ touch a/b/c2 What command would now have the effect of moving a/b/c2 to a2/b/c2 and then deleting the a subtree (since everything in it is already in the destination tree) ?

    Read the article

  • Google, typography, and cognitive fluency for persuasion

    - by Roger Hart
    Cognitive fluency is - roughly - how easy it is to think about something. Mere Exposure (or familiarity) effects are basically about reacting more favourably to things you see a lot. Which is part of why marketers in generic spaces like insipid mass-market lager will spend quite so much money on getting their logo daubed about the place; or that guy at the bus stop starts to look like a dating prospect after a month or two. Recent thinking suggests that exposure effects likely spin off cognitive fluency. We react favourably to things that are easier to think about. I had to give tech support to an older relative recently, and suggested they Google the problem. They were confused. They could not, apparently, Google the problem, because part of it was that their Google toolbar had mysteriously vanished. Once I'd finished trying not to laugh, I started thinking about typography. This is going somewhere, I promise. Google is a ubiquitous brand. Heck, it's a verb, and their recent, jaw-droppingly well constructed Paris advert is more or less about that ubiquity. It trades on Google's integration into any information-seeking behaviour. But, as my tech support encounter suggests, people settle into comfortable patterns of thinking about things. They build schemas, and altering them can take work. Maybe the ubiquity even works to cement that. Alongside their online effort, Google is running billboard campaigns to advertise Chrome, a free product in a crowded space. They are running these ads in some kind of kooky Calibri / Comic Sans hybrid. Now, at first it seems odd that one of the world's more ubiquitous brands needs to run a big print campaign in public places - surely they have all the fluency they need? Well, not so much. Chrome, after all, is not the same as their core product, so there's some basic awareness work to do, and maybe a whole new batch of exposure effect to try and grab. But why the typeface? It's heavily foregrounded, and the ads are extremely textual. Plus, don't we all know that jovial, off-beat fonts look unprofessional, or something? There's a whole bunch of people who want (often rightly) to ban Comic Sans I wonder, though. Are Google trying to subtly disrupt cognitive fluency? There's an interesting paper (pdf) about - among other things - the effects of typography on they way people answer survey questions. Participants given the slightly harder to read question gave more abstract answers. The paper references other work suggesting that generally speaking, less-fluent question framing elicits more considered answers. The Chrome ad typeface is less fluent for print. Reactions may therefore be more considered, abstract, and disruptive. Is that, in fact, what Google need? They have brand ubiquity, but they want here to change accustomed behaviour, to get people to think about changing their browser. Is this actually a very elegant piece of persuasive information design? If you think about their "what is a browser?" vox pop research video, there's certainly a perceptual barrier they're going to have to tackle somehow.

    Read the article

  • Plymouth and GRUB do not show at all

    - by WarriorIng64
    I am using Ubuntu 11.04 64-bit as my only OS on my desktop computer, which used to only run Ubuntu 10.04 LTS until I had the time to upgrade it with a fresh install. It uses integrated NVIDIA graphics (listed as a GeForce 6150SE nForce 430 by the NVIDIA X Server Settings utility) with the current proprietary driver as provided by the Additional Drivers utility, and has a VGA connection to a 1680x1050 Acer monitor. I used to get the (ugly-looking version of) Plymouth graphical boot screen while under 10.04. It didn't look that great, but I was fine with it. Now, it doesn't show on 11.04 at all during boot (I just get an error message in a moving gray box from the monitor saying "Input Not Supported"), and only rarely it will show on shutdown, all garbled up. I could not get GRUB to show during boot while holding down Shift, either (same error message), but pressing Enter while it should be up starts the system normally. A picture of the error message I was getting: Once fully booted, the system still shows the login screen and desktop just fine. Any information on how to troubleshoot this would be appreciated. If there's any hardware-specific stuff I forgot to include here, let me know the relevant commands to run in a comment below. Things that I've tried: Running plymouth in a framebuffer: no effect Booting with nomodeset as my grub boot: option no effect Booting with nomodeset and plymouth in a framebuffer: no effect other than Plymouth showing during shutdown only Following the Softpedia instructions for fixing Plymouth's resolution: Problem mostly solved, except logo does not show in Plymouth during boot, and both grub and Plymouth are slightly off-center #4 above, but with nomodeset removed as a grub boot option: same effect as #4 #5 above, but with vt.handoff=7 added as a grub boot option: same effect as #4 I have added the current contents of /etc/default/grub as requested in the comments: # If you change this file, run 'update-grub' afterwards to update # /boot/grub/grub.cfg. # For full documentation of the options in this file, see: # info -f grub -n 'Simple configuration' GRUB_DEFAULT=0 GRUB_HIDDEN_TIMEOUT=0 GRUB_HIDDEN_TIMEOUT_QUIET=true GRUB_TIMEOUT=10 GRUB_DISTRIBUTOR=`lsb_release -i -s 2> /dev/null || echo Debian` GRUB_CMDLINE_LINUX_DEFAULT="quiet splash video=uvesafb:mode_option=1280x1024-24,mtrr=3,scroll=ywrap" GRUB_CMDLINE_LINUX="" # Uncomment to enable BadRAM filtering, modify to suit your needs # This works with Linux (no patch required) and with any kernel that obtains # the memory map information from GRUB (GNU Mach, kernel of FreeBSD ...) #GRUB_BADRAM="0x01234567,0xfefefefe,0x89abcdef,0xefefefef" # Uncomment to disable graphical terminal (grub-pc only) #GRUB_TERMINAL=console # The resolution used on graphical terminal # note that you can use only modes which your graphic card supports via VBE # you can see them in real GRUB with the command `vbeinfo' GRUB_GFXMODE=1280x1024 # Uncomment if you don't want GRUB to pass "root=UUID=xxx" parameter to Linux #GRUB_DISABLE_LINUX_UUID=true # Uncomment to disable generation of recovery mode menu entries #GRUB_DISABLE_RECOVERY="true" # Uncomment to get a beep at grub start #GRUB_INIT_TUNE="480 440 1" CURRENT STATUS: I forgot to uncomment one line as per "things that I've tried" #4, so I took care of that. I can now see GRUB during startup when I hold Shift and a normal-looking Plymouth during shutdown...but Plymouth during boot is now just a solid purple screen. In each case, it's displayed a little off-center to the left, with a thin black bar running down the right side of the monitor. The error pictured above no longer shows. I'd say this problem is about 2/3 solved now. UPDATE: After Natty started freezing up on me, I decided to dual-boot with Oneiric, which unfortunately shows the same problems. Rather than trying all these workarounds though, I decided to do what I should have done from the start and file a pair of bug reports. LAST UPDATE: Bug 850908 has been confirmed as a legitimate nouveaufb bug. I have overwritten my 11.04 partition with 12.04 LTS, and I can confirm at this time that the issue is present there, as well. I will now flag this question to be closed, yet I hope it was helpful for anyone who experienced similar issues; if you are still having the same problem as me, please go there and mark yourself as affected. Thanks!

    Read the article

  • Customizing Spaces UI

    - by vijaykumar.yenne
    In most common scenarios we stumble up on use cases to customize the Web center spaces UI. Is the Spaces UI customizable? What is the extent to which we can customize? How do i customize it? These are some questions that developers/architects normally come across. Well to clear the air, OOTB spaces comes with some default "site templates" and it also gives a flexibility to create custom site templates suiting the organization needs. The site templates concept has been introduced in the latest PS1 release of webcenter and to customize/create the the new site template, we have to leverage the Extend Spaces Project available on OTN. You could download the the project from here. Also there is white paper available on what all can be customized/extended from spaces perspective listed here . There is a specific details outlined on how to create custom site template in the Customizing Site Template white paper. One of the things the white paper high lights is "While you can create new site templates and modify the sample site templates but you cannot modify either of the out-of-the-box site templates ie the default and maximized. So if my need is to either increase the size of header to fit in a bigger logo or introduce couple of extra links on the default/maximized lay out how do i achieve this? All you need to do is customize the OOTB shell (shell-config.xml). 1. Copy the shell config's available in the Source Files Directory of the extended spaces unzipped directory into the CustomSite Template Project ExtendWebCenterSpaces\CustomSiteTemplate\custom\oracle\webcenter\webcenterapp\metadata\shell 2. Modify the appropriate shell 3. Deploy the CustomSite Template as ADF Jar 4. ensure you have the profile dependency on the aboproject int he custom webcenter spaces project 5. Deploy the Spaces Extension on the Webcenter Spaces Instance. (Details in the first white paper). You should see the changes immediately. eg: In the default shell, i have changed the height from 30 to 60 to increase the header size height="60" This is what i get to see : If you have worked on the R1 release time frame, where you created a custom shell/chrome, how do we make them compatible and make it available in the Spaces PS1 instance? All you need to do is the following: 1. Copy the custom shell in to the shell directory of the custom site template project 2. Register the shell with WCSiteTemplates.xml available in the same project. Eg : Yo can add the below entry pagePath="/oracle/webcenter/webcenterapp/view/templates/MyShellTemplate.jspx" pageDefPath="/oracle/webcenter/webcenterapp/bindings/pageDefs/oracle_webcenter_webcenterapp_view_templates_WebCenterAppShellTemplatePageDef.xml" displayName="myShell" chromeLevel="myShell"/ Note : pagePath - Absolute path of the template JSPX file. This path must be unique. So you might have to do the following to get your custom chrome working absolutely fine with no problems at all: 1. Create a jspx page, say /custom/mysite/SiteTemplate.jspx 2. Include the the default jspx in the new site template like following SiteTemplate.jspx ------------------ 3. Add the newly created site template in the WCSiteTemplate.xml file like following - pagePath="/custom/mysite/SiteTemplate.jspx" pageDefPath="/oracle/webcenter/webcenterapp/bindings/pageDefs/oracle_webcenter_webcenterapp_view_templates_WebCenterAppShellTemplatePageDef.xml" displayName="myShell" chromeLevel="myShell"/

    Read the article

  • Sparc v440 unable 2 boot after recommended patch install

    - by user100660
    After installing the October 2011 recommended patch bundle on a Solaris 10 the host fails to boot. The output is {0} ok boot SC Alert: Host System has Reset screen not found. keyboard not found. Keyboard not present. Using ttya for input and output. Sun Fire V440, No Keyboard Copyright 1998-2003 Sun Microsystems, Inc. All rights reserved. OpenBoot 4.10.10, 8192 MB memory installed, Serial #54744555. Ethernet address 0:3:ba:43:55:eb, Host ID: 834355eb. Rebooting with command: boot Boot device: /pci@1f,700000/scsi@2/disk@0,0:a File and args: \ Evaluating: Out of memory Warning: Fcode sequence resulted in a net stack depth change of 1 Evaluating: Evaluating: The file just loaded does not appear to be executable. {3} ok If I do a boot -F failsafe the host come up and I'm able to mount the root device (ufs on /dev/dsk/c1t0d0s0) and nothing appears broken, i.e I can see the logfiles from the patch install etc. Root device still have 1GB+ free. Only 2 kernel patches was installed from the patch bundle: 144500-19 & 147440-02. Any hints how to debug it further, etc.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • How to bypass resume from hibernate

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • BES Express - configure MDS to push messages from 3rd party web application

    - by Max Gontar
    Hi! I have developed IIS web service to send PAP messages using Blackberry Push API over MDS. And there is an application installed on device, configured to receive push messages on appropriate port. Everything works well on MDS simulator. But it's not working well in real environment: I have installed BES Express and register several devices. I can browse MDS url with appropriate port, so url is correct. Also port enabled for reliable pushes is used in push message and in device application. Here is MDS simulator log: <2011-01-12 14:00:03.456 EET>:[272]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PapServlet: request from 0:0:0:0:0:0:0:1 564 bytes...> <2011-01-12 14:00:03.476 EET>:[273]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Mapping PAP request to push request for pushID:pushID:asdas> <2011-01-12 14:00:03.479 EET>:[274]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PushServlet: POST request from [UNKNOWN @ 0:0:0:0:0:0:0:1] to [PAPDEST=WAPPUSH%3D2100000A%253A100%2FTYPE%3DUSER%40rim.net&PORT=100&REQUESTURI=/] : -1 bytes...> <2011-01-12 14:00:03.480 EET>:[275]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = submitting push message with id:pushID:asdas> <2011-01-12 14:00:03.482 EET>:[276]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Executing push submit command for pushID:pushID:asdas> <2011-01-12 14:00:03.483 EET>:[278]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Pushing message to: 2100000a> <2011-01-12 14:00:03.484 EET>:[279]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:1> <2011-01-12 14:00:03.489 EET>:[280]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = added server-initiated connection = -872546301, push id = pushID:asdas> <2011-01-12 14:00:03.491 EET>:[281]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Available threads in DefaultJobPool = 9 running JobRunner: DefaultJobRunner-7> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 8 headers> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 9 headers> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.501 EET>:[284]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Finished JobRunner: DefaultJobRunner-7, available threads in DefaultJobPool = 10, time spent = 8ms> <2011-01-12 14:00:03.521 EET>:[287]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 2100000a> <2011-01-12 14:00:03.526 EET>:[290]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 1288699908, DEVICEPIN = 2100000a, VERSION = 16, CONNECTIONID = -872546301, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [MGONTAR/10.10.0.35:100], SIZE = 339> <2011-01-12 14:00:03.531 EET>:[291]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:0> <2011-01-12 14:00:03.591 EET>:[292]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 1288699908, STATE = DELIVERED> <2011-01-12 14:00:03.600 EET>:[296]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Device connections: AVG latency (msecs)79> <2011-01-12 14:00:03.600 EET>:[297]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, Removed push connection:-872546301> <2011-01-12 14:00:07.015 EET>:[298]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 2100000a> And here is real MDS log: <2011-01-12 11:35:02.763 GMT>:[3932]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PapServlet: request from 192.168.1.241 583 bytes...> <2011-01-12 11:35:02.897 GMT>:[3933]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Mapping PAP request to push request for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PushServlet: POST request from [UNKNOWN @ 192.168.1.241] to [PAPDEST=WAPPUSH%3D22D7F6BD%253A7874%2FTYPE%3DUSER%40rim.net&PORT=7874&REQUESTURI=/]> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<push id: pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3935]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, submitting push message with id:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3936]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Executing push submit command for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.911 GMT>:[3937]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Pushing message to: 22d7f6bd> <2011-01-12 11:35:02.912 GMT>:[3938]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:1> <2011-01-12 11:35:02.931 GMT>:[3939]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, added server-initiated connection = -1848311806, push id = pushID:sdfsdfwerwer> <2011-01-12 11:35:03.240 GMT>:[3940]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:03.241 GMT>:[3941]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 536543251, DEVICEPIN = 22d7f6bd, USERID = u3, VERSION = 16, CONNECTIONID = -1848311806, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [LDN-Server1/192.168.1.240:7874], SIZE = 383> <2011-01-12 11:35:03.241 GMT>:[3942]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:0> <2011-01-12 11:35:03.253 GMT>:[3943]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = SEND, TAG = 536543251, SIZE = 570> <2011-01-12 11:35:03.838 GMT>:[3944]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Receiving, VERSION = 1, COMMAND = STATUS, TAG = 536543251, SIZE = 10, STATE = DELIVERED> <2011-01-12 11:35:04.104 GMT>:[3945]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 536543251, STATE = DELIVERED> <2011-01-12 11:35:04.121 GMT>:[3946]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Device connections: AVG latency (msecs)893> <2011-01-12 11:35:04.135 GMT>:[3947]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<INFO >:<LAYER = IPPP, DEVICEPIN = 22d7f6bd, DOMAINNAME = LDN-Server1/192.168.1.240, CONNECTION_TYPE = PUSH_CONN, ConnectionId = -1848311806, DURATION(ms) = 1151, MFH_KBytes = 0, MTH_KBytes = 0.374, MFH_PACKET_COUNT = 0, MTH_PACKET_COUNT = 1> <2011-01-12 11:35:04.144 GMT>:[3948]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, Removed push connection:-1848311806> <2011-01-12 11:35:09.264 GMT>:[3949]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:58.187 GMT>:[3950]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = INFO, SIZE = 46> <2011-01-12 11:35:58.187 GMT>:[3951]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Sent health to S27700165[LDN-SERVER1:3200] Health=[0x 0000 0007 0000 0000],Mask=[0x 0000 0007 0000 0000],Load=[60]> As you can see, logs not really differs, message is marked as delivered. But my app on device not really gets this message (as it works in mds simulator) Please advice me, what may be wrong? Is there some certificate to install or security settings I should configure to make this push message came to device application? Thank you! same question on bbforums

    Read the article

  • SOA Community Newsletter June 2013

    - by JuergenKress
    Dear SOA partner community member Thanks for showing us your interest to rerun the Fusion Middleware Summer Camps! After knowing your suggestions we are happy to announce the 3rd edition of our advanced Fusion Middleware training. The camps will take place from August 26th - 30th 2013 in Lisbon Portugal. Topics will include Adaptive Case Management (ACM) as part of BPM Suite, b2b, Advanced SOA and SOA Governance. Please make sure you plan and book your seat in advance - (Booking is on the basis of first come first seat!). Thanks for all your efforts to become certified and Specialized. For all the experts who achieved the SOA Suite 11g Essentials or BPM Suite 11g Certified Implementation Specialist, you can download a logo for your blog or business card at the Competence Center. For all the companies who achieved a SOA or BPM specialization you can request a nice Plaques for your office. As part of our Industrial SOA article services we published “Canonizing a Language for Architecture” in the Service Technology Magazine and on Oracle Technology Network. If you write books or a blog - make sure you share it with us! Cloud Computing is the hottest topic in IT, specially as an architect you should be aware of the concepts and technology, therefore I highly recommend you Thomas Erl’s latest book named “Cloud Computing”. In the BPM space, Adaptive Case Management (ACM) is the hottest topic, with BPM PS6 the backend ACM functionality and an ACM sample application are available. You can even combine this hype with Customer Experience. The BPM section in this newsletter reflects the high importance of the topic and includes BPM PS6 video showing process lifecycle,BPM Resource Kit, Functional Testing, Introduction to Web Forms, Customized Workspace Application and Instance Patching Demo. B2B also become more and more popular in the Oracle SOA Suite. If you could not attend the training organized in the month May, we offer you an additional B2B training as a part of the Summer Camps or you can download the B2B training material from our SOA Community Workspace (SOA Community membership required). Thanks to all for sharing the valuable SOA content with our community! Special thanks to ec4u for the new reference of SOA Suite and AIA Foundation Pack at a Swiss insurance company. It is time to submit a SOA and BPM  reference request today! In this edition of the newsletter you will see Guido and Ronald's second part of OSB article series and Kathiravan Udayakumar's published an exclusive article on SOA Suite best practice. If you want to submit your content for the next edition of the Newsletter then please feel free to submit it to myself. The A-Team is an excellent contributor to the best practice - make sure you visit the new A-Team page and read their articles such as Getting to know Maven. Also on the SOA side, we have published many new articles from the community Oracle SOA Suite for the Busy IT Professional by Frank Munz, SOA Suite Knowledge - Polyglot Service Implementation with Groovy by Alexander Suchier, QA82 Analyzer - Automated Quality Assurance for Oracle SOA Suite Projects, Verifying the Target by Anthony Reynolds and a new book called Oracle SOA Governance 11g Implementation book by Luis Augusto Weir. Two new SOA on-demand training courses NEW - Oracle Business Rules Self-Study Course & Introduction Human Workflow online course are available now! Make use of the Summer Time and get trained - hope to see you in Lisbon for the Summer Camps! Jürgen Kress Oracle SOA & BPM Partner Adoption EMEA To read the newsletter please visit http://tinyurl.com/soanewsJune2013 (OPN Account required) To become a member of the SOA Partner Community please register at http://www.oracle.com/goto/emea/soa (OPN account required) If you need support with your account please contact the Oracle Partner Business Center. Blog Twitter LinkedIn Mix Forum Technorati Tags: SOA Community newsletter,SOA Community,Oracle,OPN,Jürgen Kress,SOA,BPM

    Read the article

  • General logging won't work in MySQL

    - by leonstr
    I saw on SF that there's an option in MySQL to log all queries. So, in my version (mysql-server-5.0.45-7.el5 on CentOS 5.2) this appears to be a case of enabling the 'log' option, so I edited /etc/my.cnf to add this: [mysqld] datadir=/var/lib/mysql socket=/var/lib/mysql/mysql.sock user=mysql old_passwords= log=/var/log/mysql-general.log [mysqld_safe] log-error=/var/log/mysqld.log pid-file=/var/run/mysqld/mysqld.pid I then created the file and set permissions: # touch /var/log/mysql-general.log # chown mysql. /var/log/mysql-general.log # ls -l /var/log/mysql-general.log -rw-r--r-- 1 mysql mysql 0 Jan 18 15:22 /var/log/mysql-general.log But when I start mysqld I get: 120118 15:24:18 mysqld started ^G/usr/libexec/mysqld: File '/var/log/mysql-general.log' not found (Errcode: 13) 120118 15:24:18 [ERROR] Could not use /var/log/mysql-general.log for logging (error 13). Turning logging off for the whole duration of the MySQL server process. To turn it on again: fix the cause, shutdown the MySQL server and restart it. 120118 15:24:18 InnoDB: Started; log sequence number 0 182917764 120118 15:24:18 [Note] /usr/libexec/mysqld: ready for connections. Can anyone suggest why this isn't working?

    Read the article

  • F5 Networks iRule/Tcl - Escaping UNICODE 6-character escape sequences so they are processed as and r

    - by openid.malcolmgin.com
    We are trying to get an F5 BIG-IP LTM iRule working properly with SharePoint 2007 in an SSL termination role. This architecture offloads all of the SSL processing to the F5 and the F5 forwards interactive requests/responses to the SharePoint front end servers via HTTP only (over a secure network). For the purposes of this discussion, iRules are parsed by a Tcl interpretation engine on the F5 Networks BIG-IP device. As such, the F5 does two things to traffic passing through it: Redirects any request to port 80 (HTTP) to port 443 (HTTPS) through HTTP 302 redirects and URL rewriting. Rewrites any response to the browser to selectively rewrite URLs embedded within the HTML so that they go to port 443 (HTTPS). This prevents the 302 redirects from breaking DHTML generated by SharePoint. We've got part 1 working fine. The main problem with part 2 is that in the response rewrite because of XML namespaces and other similar issues, not ALL matches for "http:" can be changed to "https:". Some have to remain "http:". Additionally, some of the "http:" URLs are difficult in that they live in SharePoint-generated JavaScript and their slashes (i.e. "/") are actually represented in the HTML by the UNICODE 6-character string, "\u002f". For example, in the case of these tricky ones, the literal string in the outgoing HTML is: http:\u002f\u002fservername.company.com\u002f And should be changed to: https:\u002f\u002fservername.company.com\u002f Currently we can't even figure out how to get a match in a search/replace expression on these UNICODE sequence string literals. It seems that no matter how we slice it, the Tcl interpreter is interpreting the "\u002f" string into the "/" translation before it does anything else. We've tried various combinations of Tcl escaping methods we know about (mainly double-quotes and using an extra "\" to escape the "\" in the UNICODE string) but are looking for more methods, preferably ones that work. Does anyone have any ideas or any pointers to where we can effectively self-educate about this? Thanks very much in advance.

    Read the article

  • Boot loop that I cannot bypass

    - by lonewaft
    Recently, on a laptop that I've used for a while, I had a strange issue where OS files were corrupted (device manager) and Windows 8 was hung after the login screen, so I reinstalled Windows 7 over the existing Windows 8 installation, and it worked for a couple days. Today, when I tried to use my laptop, it was stuck on a boot loop. Right after the BIOS screen, it would show a flashing underscore, then restart the computer, again and again until I removed the battery. I tried booting to a windows 7 install CD, but the same flashing underscore - reboot sequence happened when I tried. I tried moving the boot priority around (HDD first, CD/DVD first, even USB first) but nothing changed. After about an hour of tinkering with it, I listened to the HDD sounds, and it sounded like the HDD was trying to spin up, but failing (whining noise increasing in frequency that stopped and started in sync with the system restarting). I am planning to replace the HDD, but I'm still confused as to why a faulty HDD would stop the laptop from booting to my install DVD (tried it on a different computer, it booted from that CD fine). Anybody here have any idea why this might be happening?

    Read the article

  • Are web service handler chains possible under IIS / ASP.NET

    - by Mike
    I'm working with a client who wants me to implement a particular design in an IIS/ASP.NET environment. This design was already implemented in Java, but I am not sure it is possible using Microsoft technologies. In a Tomcat/Java environment one can create so call Handler Chains. In essence a handler runs on the server on which the web service is running and it intercepts the SOAP message coming to the web service. The handler can perform a number of tasks before passing control to the web service. Some of these tasks may refer to authentication and authorization. Moreover, one can create handler chains, such that the handlers can run in a particular sequence before passing control to the web service. This is a very elegant solution, as certain aspects of authentication and authorization can be automatically performed, without the developer of the client application and of the web service having to invest anything in it. The code for the client application and the web service is not affected. You may find a number of articles on internet on this subject by searching on Google for "web service handler chain". I performed searches for web service handlers in IIS or ASP.NET. I get some hits, but apparently handlers in IIS have another meaning than that described above. My question therefor is: Can handler chains (as available in Java and Tomcat) be created in IIS? If so, how (any article, book, forum...)? Either a negative or a positive answer will be greatly appreciated. Mike

    Read the article

  • Silverlight Cream for June 16, 2011 -- #1108

    - by Dave Campbell
    In this Issue: René Schulte, Rajat Jaiswal(-2-), Peter Kuhn, Colin Eberhardt, Kunal Chowdhury(-2-), Beth Massi, Michael Crump, Daniel Vaughan, Chris Rouw, WindowsPhoneGeek, and Jesse Liberty. Above the Fold: Silverlight: "Cubelicious - Silverlight 5 + Balder + Physics + SLARToolkit Augmented Reality = Triple Win!" René Schulte WP7: "Binding the WP7 ProgressIndicator in XAML" Daniel Vaughan LightSwitch: "Adding Static Images and Text on a LightSwitch Screen" Beth Massi Shoutouts: Laurent Bugnion is Proposing a new RelayCommand snippet for MVVM Light V4... read about it and give him some feedback From SilverlightCream.com: Cubelicious - Silverlight 5 + Balder + Physics + SLARToolkit Augmented Reality = Triple Win! René Schulte has a post up about using the SLARToolkit for Silverlight 5 Beta in conjuncion with Balder and Physics ... dang this is cool, check out the video! PSD TO XAML in few easy steps using Expression Blend I'm not a Photoshop person, but apparently Rajat Jaiswal is, and he's demonstrating using Expression Blend to get your PSD file into XAML Its really great feature Silverlight realtime augment toolkit This is a fun post from Rajat Jaiswal... fun to see someone other than René Schulteposting about René's SLARToolkit :) Getting ready for the Windows Phone 7 Exam 70-599 (Part 2) Peter Kuhn has part 2 of his series up on getting ready for the Windows Phone 7 Exam at SilverlightShow Metro In Motion Part #7 – Panorama Prettiness and Opacity Colin Eberhardt has another Metro in Motion up... this one concentrates on the opacity effect when the user slides from item-to-item in Panorama contents Windows Phone 7 (Mango) Tutorial - 13 - What is Tombstoning? Kunal Chowdhury has a couple of posts up... first up is this one on Tombstoning... and if you're just starting with WP7.1, it got easier Windows Phone 7 Tip: Showing and Hiding onscreen keyboard in Emulator Kunal Chowdhury's latest is a great hint if you haven't found it already... how to show/hide the onscreen keyboard in the emulator Adding Static Images and Text on a LightSwitch Screen Beth Massi's latest post is on showing how to display an image or static text such as a logo in a LightSwitch app Displaying PDF Files in Windows Phone 7 Mango Michael Crump responds to reader's questions about displaying a PDF file in WP7.1 with this post using ComponentOne's Studio for Windows Phone CTP Binding the WP7 ProgressIndicator in XAML Daniel Vaughan has a solution to the problem of having to bind the ProgressIndicator in WP7.1 in code-behind... he wrote a ProgressIndicatorProxy and shares it with us!<>/dd> Storing Files in SQL Server using WCF RIA Services and Silverlight – Part 2 Chris Rouw has Part 2 of his Storing Files in SQL Servier using WCF RIA Services and Silverlight up... this one is on uploading and saving files to the database from Silvelright by the user dropping them onto your app. Using SqlMetal to generate Windows Phone Mango Local Database classes OK I'm not too proud to admit I'd never heard of SQLMetal... if you haven't, or even if you have, this post by WindowsPhoneGeek is a good discussion of using it to generate your WP7.1 database classes. Obtaining Email, Address or Phone Number Jesse Liberty's latest is another in his 'Mango From Scratch' series discussing the new tasks to obtain more info from the contact list. Stay in the 'Light! Twitter SilverlightNews | Twitter WynApse | WynApse.com | Tagged Posts | SilverlightCream Join me @ SilverlightCream | Phoenix Silverlight User Group Technorati Tags: Silverlight    Silverlight 3    Silverlight 4    Windows Phone MIX10

    Read the article

  • How do I fix a corrupt calendar cache?

    - by Blacklight Shining
    I was tailing /var/log/system.log and noticed a sudden wall of text. Looking closer, I saw it was an error CalendarAgent got while trying to save something: Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: CoreData: error: (11) Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: Core Data: annotation: -executeRequest: encountered exception = Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' with userInfo = { NSFilePath = "/Users/blackl/Library/Calendars/Calendar Cache"; NSSQLiteErrorDomain = 11; } 2 messages repeated several times Nov 18 11:42:49 rainbow-dash.local CalendarAgent[12321]: [com.apple.calendar.store.log.subscription] [WARNING: CalSubscriptionSession :: persistError :: save failed] This entire sequence is repeated many times throughout the log. file said the file in question was a SQLite 3.x database, so I did a bit of searching and came up with a way to check those. blackl% cp -i ~/Library/Calendars/Calendar\ Cache /tmp blackl% sqlite3 /tmp/Calendar\ Cache SQLite version 3.7.12 2012-04-03 19:43:07 Enter ".help" for instructions Enter SQL statements terminated with a ";" sqlite> pragma integrity_check ; *** in database main *** Main freelist: Bad ptr map entry key=863 expected=(2,0) got=(5,21) On page 21 at right child: 2nd reference to page 863 This is followed by a few dozen lines like these: rowid <number> missing from index <name> and then: wrong # of entries in index <name> I'm at a bit of a loss as to what to do now—I couldn't find anything on how to fix the errors that I found. Also, it would probably be a good idea to disable Calendar Agent so it doesn't try to use the database while it's being fixed (that's why I copied it to /tmp before running sqlite3 on it.) How do I disable CalendarAgent and fix its cache?

    Read the article

  • New monitor connected to HDMI adaptor doesn't show output after booting

    - by Paul
    Hello out there in the multiple monitors’ world. I am a very old newbie in your world and need help. I just purchased a new Asus VH236H monitor and hooked it up the HDMI port of an ATI Radeon HD4300 / 4500 Series display adaptor. I left the old Princeton LCD19 (TMDS) hooked up to the DVI port of the same display adaptor. Both monitors displayed the boot sequence, after I fired good old Sarastro2 (Asus P5Q Pro Turbo – Dual Core E5300 – 2.60 GHz) up. The Asus lacked one half of a second behind the Princeton until the Windows 7 Ultimate SP 1 boot up was complete. Then the Asus displayed “HDMI NO SIGNAL” and went into hibernation. The Princeton stayed lit up as before. Both monitors are displayed on the “Screen Resolution Setup Display” and I plaid around with them for a while. The only thing I accomplished was to shove the desktop icons from the Princeton to the still hibernating Asus. The “Multiple displays:” is set to “Extend these displays”, the Orientation is “Landscape” and the Resolutions are set on both to the “recommended” one. Both monitors show that they work properly in the advanced Properties display. What am I doing wrong, what am I missing? Never mind the opinions about the different resolutions of the two monitors. I always can unhook the Princeton and give it to a Goodwill Store if I do not like the setup. I just would like to make it work. Any constructive help is very much appreciated, Thank you.

    Read the article

  • Give back full control to a user on a disk from another computer

    - by Foghorn
    I have my friend's hard drive mounted externally. After messing with the permissions with TAKEOWN so I could fix some viruses, I have full control over their drive. The problem is, now it's stuck in a "autochk not found" reboot sequence. I think the problem is that the boot sector is invisible to the drive now. So my question is, How can I use icacls to give back the full ownership, when the user I am giving it to is not on my machine? I ran the TAKEOWN command from my windows 7 laptop, their machine is a windows xp Professional with three partitions, I only altered the one that has the boot sector. Here is the permissions that icacls shows: (Where my computer is %System% my username is ME, and the drive is E:\ C:\Users\ME icacls E:\* E:\$RECYCLE.BIN %System%\ME:(OI)(CI)(F) Mandatory Label\Low Mandatory Level:(OI)(CI)(IO)(NW) E:\ALLDATAW %System%\ME:(I)(OI)(CI)(F) E:\alrt_200.data %System%\ME:(OI)(CI)(F) E:\AUTOEXEC.BAT %System%\ME:(OI)(CI)(F) E:\AZ Commercial %System%\ME:(I)(OI)(CI)(F) E:\boot.ini %System%\ME:(OI)(CI)(F) E:\Config.Msi %System%\ME:(I)(OI)(CI)(F) E:\CONFIG.SYS %System%\ME:(OI)(CI)(F) E:\Documents and Settings %System%\ME:(I)(OI)(CI)(F) E:\IO.SYS %System%\ME:(OI)(CI)(F) E:\Mitchell1 %System%\ME:(I)(OI)(CI)(F) E:\MSDOS.SYS %System%\ME:(OI)(CI)(F) E:\MSOCache %System%\ME:(I)(OI)(CI)(F) E:\NTDClient.log %System%\ME:(OI)(CI)(F) E:\NTDETECT.COM %System%\ME:(OI)(CI)(F) E:\ntldr %System%\ME:(OI)(CI)(F) E:\pagefile.sys %System%\ME:(OI)(CI)(F) E:\Program Files %System%\ME:(I)(OI)(CI)(F) E:\RECYCLER %System%\ME:(I)(OI)(CI)(F) E:\RHDSetup.log %System%\ME:(OI)(CI)(F) E:\System Volume Information %System%\ME:(I)(OI)(CI)(F) E:\WINDOWS %System%\ME:(I)(OI)(CI)(F) Successfully processed 22 files; Failed processing 0 files C:\Users\ME

    Read the article

  • How to bypass resume from hibernate [closed]

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • SSD, AHCI and write performance

    - by Dan
    We've started to deploy SSD drives to our developers workstations. At this moment we're having the unpleasant surprise that the systems using the new SSDs often freeze, with the HDD activity led blinking or being continuously on. Benchmarks shows read speeds around 180 MB/s, but write speeds around 5 MB/s. All developers are using Windows 7 Enterprise, 64 bit, SP1. One of our developers suggested (based on his experience) the following sequence: backup the workstation use a tool to completely erase the SSD make sure AHCI is enabled in BIOS install Windows restore from backup So far, this procedure seems to work (we're still testing, but write speed seems to be 120 MB/s). There are some questions in this context: why do we have to completely reinstall Windows? Is it possible to clean the SSD without reinstalling Windows? Is there a reliable tool? If AHCI was disabled when Windows was installed and we enable it, shouldn't this be enough to correct the write performance issue? If we have to completely erase the SSDs, does this mean the SSDs we've received were used before (SH)? I'm wondering this because the package I've got was open (I didn't think about it at that time, as I considered one of my coworkers simply took a peek inside the package). Has anyone seen a similar problem before?

    Read the article

  • How can I disable the CTRL-ALT-DEL key combination completely on XP/Vista/7?

    - by Travesty3
    I have been googling extensively to figure this out, and nobody seems to be able to give a direct answer. Let me start by saying that I'm NOT talking about requiring CTRL-ALT-DEL to enter logon information. I'm working on a golf simulator program which is used at golf centers. I need the ability to completely disable the CTRL-ALT-DEL key sequence so that the golf center customers can't get out of the program and access the computer at all. I realize there are other key combinations that need to be handled as well, we already have this entire feature working in XP, but we're going to be switching to Windows 7 soon, and CTRL-ALT-DEL is the only one that doesn't seem to work in Win7. I'd really like an all-around solution if at all possible. This same program may also be installed on a client's personal computer for an in-home golf simulator, but the computers that really need this feature (golf center computers) are provided to the golf center by us, so would the best option be to write a new shell? I don't know anything about that at all, other than others that suggest writing a new shell for kiosk mode. I'd really like a simpler option, like modifying the registry in some way. I have heard that you can remove some buttons from the menu screen that pops up, but unless I can remove pretty much all of them (including the shutdown/restart button in the bottom-right corner), this won't be enough of a solution for me. Thanks for taking the time to read this and thanks again for any help you could provide! -Travis

    Read the article

< Previous Page | 108 109 110 111 112 113 114 115 116 117 118 119  | Next Page >