Search Results

Search found 3684 results on 148 pages for 'sequence logo'.

Page 109/148 | < Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >

  • How to save an order (permutation) in an sql db

    - by Bendlas
    I have a tree structure in an sql table like so: CREATE TABLE containers ( container_id serial NOT NULL PRIMARY KEY, parent integer REFERENCES containers (container_id)) Now i want to define an ordering between nodes with the same parent. I Have thought of adding a node_index column, to ORDER BY, but that seem suboptimal, since that involves modifying the index of a lot of nodes when modifying the stucture. That could include adding, removing, reordering or moving nodes from some subtree to another. Is there a sql datatype for an ordered sequence, or an efficient way to emulate one? Doesn't need to be fully standard sql, I just need a solution for mssql and hopefully postgresql EDIT To make it clear, the ordering is arbitrary. Actually, the user will be able to drag'n'drop tree nodes in the GUI

    Read the article

  • Adding user groups from a remote domain server to permissions of a remote desktop terminal server fails. why?

    - by doveyg
    I have 3 computers, two of which are servers running Windows Server 2008 and another running Windows 7. One of the servers has the following roles installed; Active Directory, DHCP and DNS. The other server has a Terminal Server role installed. I am trying to log-on to the Terminal Server via Remote Desktop using the Windows 7 machine with credentials from the Active Directory server. Sounds simple enough, right? Well, no. Whenever I try to add users or groups from the Active Directory Domain server to the Terminal Server's permissions for RDP it seems to ignore, or forget, them. Though the various methods I was able to find it either adds a strange sting of numbers after the user group or the logo to the left has a question mark on it, reopening the dialogue box replaces the user group with the name of the Domain. I am confident I have the Domain setup correctly as I am able to log-on to users in the Active Directory from other computers I have put in the Domain, and when I attempt to browse the user objects from the Domain I am prompted with a username/password field and am able to view the structure of Active Directory objects. Please advise.

    Read the article

  • Would vector of vectors be contiguous?

    - by user1150989
    I need to allocate a vector of rows where row contains a vector of rows. I know that a vector would be contiguous. I wanted to know whether a vector of vectors would also be contiguous. Example code is given below vector<long> firstRow; firstRow.push_back(0); firstRow.push_back(1); vector<long> secondRow; secondRow.push_back(0); secondRow.push_back(1); vector< vector < long> > data; data.push_back(firstRow); data.push_back(secondRow); Would the sequence in memory be 0 1 0 1?

    Read the article

  • SQL Full Outer Join

    - by Torment March
    I have a table named 'Logs' with the following values : CheckDate CheckType CheckTime ------------------------------------------- 2011-11-25 IN 14:40:00 2011-11-25 OUT 14:45:00 2011-11-25 IN 14:50:00 2011-11-25 OUT 14:55:00 2011-11-25 IN 15:00:00 2011-11-25 OUT 15:05:00 2011-11-25 IN 15:15:00 2011-11-25 OUT 15:20:00 2011-11-25 IN 15:25:00 2011-11-25 OUT 15:30:00 2011-11-25 OUT 15:40:00 2011-11-25 IN 15:45:00 I want to use the previous table to produce a result of: CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 NULL 15:40:00 2011-11-25 15:45:00 NULL So far I have come up with this result set : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 14:40:00 14:45:00 2011-11-25 14:50:00 14:55:00 2011-11-25 15:00:00 15:05:00 2011-11-25 15:15:00 15:20:00 2011-11-25 15:25:00 15:30:00 2011-11-25 15:45:00 NULL The problem is I cannot generate the log without CheckIns : CheckDate CheckIn CheckOut ----------------------------------------- 2011-11-25 NULL 15:40:00 The sequence of CheckIn - CheckOut pairing and order is in increasing time value.

    Read the article

  • How to Get the Method/Function Call Trace for a Specific Run?

    - by JackWM
    Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • How to encode(represent) an ornament?

    - by Daniyar
    I would like to find a numeric representation of kazakh national ornaments for generating new ones. The ornaments essentially consist of combinations of relatively basic ornaments. Usually the ornaments are symmetrical. Here are few examples of basic elements: (The images are a bit distorted) And this is an example of a more complex ornament: How could I encode an ornament's representation in as few numbers as possible? So that I could write a program that would generate an ornament, given some sequence of numbers Any ideas are appreciated. As I write this, I have thought that generating images of snowlfakes may be somewhat relevant, although it's possibly just a fractal.

    Read the article

  • Multiple Concurrent Changes Using SVN, GIT, and CVS

    - by KlaxSmashing
    At work, we are using SVN, CVS, and GIT because there any many projects that were started at various times. Anyway, a common sequence that occurs is as follows: Working on task A, making changes to project Has new task B, some bug or functionality needs to be done on project, independent of task A but may affect same set of files Check in task B Check in task A Unfortunately, what I do at this time is two maintain 2 working copies of each project. So I can always work on task B from a clean copy. As you can imagine, this is wasteful and also, does not scale well (task C, D, E, etc.) For each of these versioning systems, are there commands that can help me do the following: "Save" task A, reverting working copy to current repository Work on task B, check in changes "Restore" task A changes back to working copy

    Read the article

  • How to transfer large file (File size > Heap Size) over the network?

    - by neo
    How to transfer large file (File size Heap/RAM Size) over the network ? Lets say I have file (size 10GB) I want to transfer it machine a (RAM 512mb) to machine b (RAM 512mb). Want achieve this using java code. First, is it possible ? Any recommendation on framework. If possible, can we speed this up using threading ? Important criteria: file's data sequence needs to be maintained during transfer. Any example will be great help.

    Read the article

  • How to change the text int JLabel under the while or for loop?

    - by guilgamos
    I want to create a simple clock by using java. The code is very simply that i will give an example shown below for(int i=0;i<=60;i++) jLabel11.setText( Integer.toString(i) ); The problem is while I'm running my program the result didn't show the update in sequence. I mean it show only 60 digit immediately. It didn't show the change from 1 to 2 to 3 ... something like this. How can i fix this problem. Thank you in advance.

    Read the article

  • Error occurs while using SPADE method in R

    - by Yuwon Lee
    I'm currently mining sequence patterns using SPADE algorithm in R. SPADE is included in "arulesSequence" package of R. I'm running R on my CentOS 6.3 64bit. For an exercise, I've tried an example presented in http://en.wikibooks.org/wiki/Data_Mining_Algorithms_In_R/Sequence_Mining/SPADE When I tried to do "cspade(x, parameter = list(support = 0.4), control = list(verbose = TRUE))" R says: parameter specification: support : 0.4 maxsize : 10 maxlen : 10 algorithmic control: bfstype : FALSE verbose : TRUE summary : FALSE preprocessing ... 1 partition(s), 0 MB [0.096s] mining transactions ... 0 MB [0.066s] reading sequences ...Error in asMethod(object) : 's' is not an integer vector When I try to run SPADE on my Window 7 32bit, it runs well without any error. Does anybody know why such errors occur?

    Read the article

  • Windows 8 doesn't start up after installation

    - by Raj BD
    I have a DELL INSPIRON n5110 machine running Windows 7 Home Premium 64-bit. It has 6GB of RAM and 500 GB hard disk capable to run any Windows and Linux system. And I recently attempted to install Windows 8 in the machine. Installation goes fine and smooth until the final stage when windows is done installing and GETS DEVICES READY. When GETTNG DEVICES READY reaches about 60%, the screen goes blank with the machine running. After a while it reboots. And after the new Windows Logo with dotted circles are done showing up, the screen goes blank again (when we'd expect login screen to show up). There is not even a cursor. I can see the HARD DISK ACTIVITY LED blinking but nothing shows up in the screen. I've tried CLEAN INSTALL several times. The DVD is fine, it installed and worked well in my friends' laptop PCs. I tried installing both PRO version and ENTERPRISE version and both 32-bit and 64-bit. But the problem was same everytime. Finally, I had to reinstall Windows 7 which installed and ran without any problem. The problem, we can guess, is GRAPHICS perhaps. I have Intel SandyBridge Graphics Mobile Chipset (Intel HD Graphics 3000). But if Windows 7 and Linux distrubutions like Mint and BackTrack can run on the machine, why on earth, would Windows 8 not run?

    Read the article

  • for (Object object : list) [java] construction

    - by EugeneP
    My question, is, whether the sequence of elements picked from a list will always be the same, is this construction behaviour is deterministic for java "List"s - descendants of java.util.List 2) question, if I use for(Object o: list) construction and inside the loop's body increment a variable, will it be the index of list's elements? So, how it goes through list's elements, from 0 to size()-1 or chaotically? List.get(i) will always return this element? 3) question ( I suppose for the 2-nd question the answer will be negative, so:) for (int i=0; i < list.size(); i++) { } is the best way if I need to save the index of an element and later get it back from a list by its id?

    Read the article

  • Creating a file path in C#

    - by Jason
    So I'm trying to create a path in C#. I use Environment.Machinename and store it a variable serverName. Then I create another string variable and have some other path extension in there. Here is my code so far: string serverName = Environment.MachineName; string folderName = "\\AlarmLogger"; No matter what I do I can't seem to obtain only one backslash prior to AlarmLogger. Any ideas how I can specify a path in C#? Edit: I'm wondering if my code doesn't seem to want to paste correctly. Anyways when i paste it I only see one backslash but my code has two. Because of the escape character sequence. But something like string test = @"\" + serverName + folderName doesn't seem to want to work for me.

    Read the article

  • dynamic memory allocation [closed]

    - by gcc
    i wanna write a program that creates (allocating memory) and manipulates (adding elements and increasing memory etc.) integer arrays dynamically according to given input sequences. input sequence which starts with the maximum number of arrays, includes integers to be put into arrays and some one letter characters which are commands to carry out some tasks (activating next array, deleting an array etc). also, i wanna create *c_arrays which is the address of the array whose elements are the actual capacities (How many integer slots are already allocated for an array?) of arrays how should i organize(set up) the algorithm?

    Read the article

  • Faster way of initializing arrays in Delphi

    - by Max
    I'm trying to squeeze every bit of performance in my Delphi application and now I came to a procedure which works with dynamic arrays. The slowest line in it is SetLength(Result, Len); which is used to initialize the dynamic array. When I look at the code for the SetLength procedure I see that it is far from optimal. The call sequence is as follows: _DynArraySetLength - DynArraySetLength DynArraySetLength gets the array length (which is zero for initialization) and then uses ReallocMem which is also unnecessary for initilization. I was doing SetLength to initialize dynamic array all the time. Maybe I'm missing something? Is there a faster way to do this?

    Read the article

  • PHP mail with multiple attachments and message in HTML format [closed]

    - by Jason
    I am new to PHP, so please don't mind if my question is silly. I would to like to make a PHP to send email with numerous attachments and the message of the email will be in HTML format. <html> <body> <form action="mail.php" method="post"> <table> <tr> <td><label>Name:</label></td> <td><input type="text" name="name" /></td> </tr> <tr> <td><label>Your Email:</label></td> <td><input type="text" name="email" /></td> </tr> <tr> <td><label>Attachment:</label></td> <td><input type="file" name="Attach" /></td> </tr> <tr> <td><input type="submit" value="Submit" /></td> </tr> </table> </form> <script language="javascript"> $(document).ready(function() { $("form").submit(function(){ $.ajax({ type: "POST", url: 'mail.php', dataType: 'json', data: { name: $('#name').val(), email: $('#email').val(), Attach: $('#Attach').val(), }, success: function(json){ $(".error, .success").remove(); if (json['error']){ $("form").after(json['error']); } if (json['success']){ $("form").remove(); $(".leftColWrap").append(json['success']); } } }); return false; }); }); </script> </body> </html> This is my HTML for filing in the information. And below is the mail.php <?php session_cache_limiter('nocache'); header('Expires: ' . gmdate('r', 0)); header('Content-type: application/json'); $timeout = time()+60*60*24*30; setcookie(Form, date("F jS - g:i a"), $timeout); $name=$_POST['name']; $email=$_POST['email']; $to="[email protected]"; //*** Uniqid Session ***// $Sid = md5(uniqid(time())); $headers = ""; $headers .= "From: $email \n"; $headers .= "MIME-Version: 1.0\n"; $headers .= "Content-Type: multipart/mixed; boundary=\"".$Sid."\"\n\n"; $headers .= "This is a multi-part message in MIME format.\n"; $headers .= "--".$Sid."\n"; $headers .= "Content-type: text/html; charset=utf-8\n"; $headers .= "Content-Transfer-Encoding: 7bit\n\n"; //*** Attachment ***// if($_FILES["fileAttach"]["name"] != "") { $FilesName = $_FILES["fileAttach"]["name"]; $Content = chunk_split(base64_encode(file_get_contents($_FILES["fileAttach"]["tmp_name"]))); $headers .= "--".$Sid."\n"; $headers .= "Content-Type: application/octet-eam; name=\"".$FilesName."\"\n"; $headers .= "Content-Transfer-Encoding: base64\n"; $headers .= "Content-Disposition: attachment; filename=\"".$FilesName."\"\n\n"; $headers .= $Content."\n\n"; } $message_to=" <html><body> <table class='page-head' align='center' width='100%'> <tr> <td class='left'> <h1>ABC</h1></td> <td class='right' width='63'> <img src='http://xxx/images/logo.png' /></td> </tr> </table><br /><br /> $name ($email) has just sent you an e-mail. </body></html>"; $message_from="<html><body> <table class='page-head' align='center' width='100%'> <tr> <td class='left'> <h1>ABC</h1></td> <td class='right' width='63'> <img src='http://xxx/images/logo.png' /></td> </tr> </table><br /><br /> Thanks for sending the email. </body></html>"; if ($name == "" || $email == "") { $error = "<font color=\"red\">Please fill in all the required fields.</font>"; } elseif (isset($_COOKIE['Form'])) { $error = "You have already sent the email. Please try again later."; } else { mail($to,"A new email from: $name",$message_to,$headers); mail($email,"Thank you for send the email",$message_from,$headers); $success = "Emai sent successfully!"; } $json = array('error' => $error, 'success' => $success); print(json_encode($json)); ?> May someone give some advises on the code? Thanks a lot.

    Read the article

  • Clojure: find repetition

    - by demi
    Let we have a list of integers: 1, 2, 5, 13, 6, 5, 7 and I want to find the first number has a duplicate before it and return a vector of two indices, In my sample, it's 5 at [2, 5]. What I did so far is loop, but can I do it more elegant, short way? (defn get-cycle [xs] (loop [[x & xs_rest] xs, indices {}, i 0] (if (nil? x) [0 i] ; Sequence is over before we found a duplicate. (if-let [x_index (indices x)] [x_index i] (recur xs_rest (assoc indices x i) (inc i)))))) No need to return number itself, because I can get it by index and, second, it may be not always there.

    Read the article

  • How to apply Seq map function?

    - by netmatrix01
    Hello All, I been recently playing with F# . I was wondering instead of using a for loop to generate a sequence to element which are multiplied with every other element in the list how can I use a Seq map function or something similar to generate something like below. So for e.g. I have a list [1..10] I would like to apply a fun which generates a result something like [(1*1); (1*2);(1*3); (1*4); (1*5)......(2*1);(2*2);(2*3).....(3*1);(3*2)...] How can i achieve this ?. Many thanks for all you help.

    Read the article

  • sequencing function calls in javascript - are callbacks the only way?

    - by tim
    I read through various threads like this one for example. But it really escapes me how to accomplish the following: I have 4 functions, and want them happen one after another in sequence. Notice they are in incorrect order, to get my point across. I want the result that will output "1, 2, 3, 4' function firstFunction(){ // some very time consuming asynchronous code... console.log('1'); } function thirdFunction(){ // definitely dont wanna do this until secondFunction is finished console.log('3'); } function secondFunction(){ // waits for firstFunction to be completed console.log('2'); } function fourthFunction(){ // last function, not executed until the other 3 are done. console.log('4'); } I tried to figure out callbacks but am getting lost :( Isn't there some simple way to do this? Like looping through an array...

    Read the article

  • 256 Windows Azure Worker Roles, Windows Kinect and a 90's Text-Based Ray-Tracer

    - by Alan Smith
    For a couple of years I have been demoing a simple render farm hosted in Windows Azure using worker roles and the Azure Storage service. At the start of the presentation I deploy an Azure application that uses 16 worker roles to render a 1,500 frame 3D ray-traced animation. At the end of the presentation, when the animation was complete, I would play the animation delete the Azure deployment. The standing joke with the audience was that it was that it was a “$2 demo”, as the compute charges for running the 16 instances for an hour was $1.92, factor in the bandwidth charges and it’s a couple of dollars. The point of the demo is that it highlights one of the great benefits of cloud computing, you pay for what you use, and if you need massive compute power for a short period of time using Windows Azure can work out very cost effective. The “$2 demo” was great for presenting at user groups and conferences in that it could be deployed to Azure, used to render an animation, and then removed in a one hour session. I have always had the idea of doing something a bit more impressive with the demo, and scaling it from a “$2 demo” to a “$30 demo”. The challenge was to create a visually appealing animation in high definition format and keep the demo time down to one hour.  This article will take a run through how I achieved this. Ray Tracing Ray tracing, a technique for generating high quality photorealistic images, gained popularity in the 90’s with companies like Pixar creating feature length computer animations, and also the emergence of shareware text-based ray tracers that could run on a home PC. In order to render a ray traced image, the ray of light that would pass from the view point must be tracked until it intersects with an object. At the intersection, the color, reflectiveness, transparency, and refractive index of the object are used to calculate if the ray will be reflected or refracted. Each pixel may require thousands of calculations to determine what color it will be in the rendered image. Pin-Board Toys Having very little artistic talent and a basic understanding of maths I decided to focus on an animation that could be modeled fairly easily and would look visually impressive. I’ve always liked the pin-board desktop toys that become popular in the 80’s and when I was working as a 3D animator back in the 90’s I always had the idea of creating a 3D ray-traced animation of a pin-board, but never found the energy to do it. Even if I had a go at it, the render time to produce an animation that would look respectable on a 486 would have been measured in months. PolyRay Back in 1995 I landed my first real job, after spending three years being a beach-ski-climbing-paragliding-bum, and was employed to create 3D ray-traced animations for a CD-ROM that school kids would use to learn physics. I had got into the strange and wonderful world of text-based ray tracing, and was using a shareware ray-tracer called PolyRay. PolyRay takes a text file describing a scene as input and, after a few hours processing on a 486, produced a high quality ray-traced image. The following is an example of a basic PolyRay scene file. background Midnight_Blue   static define matte surface { ambient 0.1 diffuse 0.7 } define matte_white texture { matte { color white } } define matte_black texture { matte { color dark_slate_gray } } define position_cylindrical 3 define lookup_sawtooth 1 define light_wood <0.6, 0.24, 0.1> define median_wood <0.3, 0.12, 0.03> define dark_wood <0.05, 0.01, 0.005>     define wooden texture { noise surface { ambient 0.2  diffuse 0.7  specular white, 0.5 microfacet Reitz 10 position_fn position_cylindrical position_scale 1  lookup_fn lookup_sawtooth octaves 1 turbulence 1 color_map( [0.0, 0.2, light_wood, light_wood] [0.2, 0.3, light_wood, median_wood] [0.3, 0.4, median_wood, light_wood] [0.4, 0.7, light_wood, light_wood] [0.7, 0.8, light_wood, median_wood] [0.8, 0.9, median_wood, light_wood] [0.9, 1.0, light_wood, dark_wood]) } } define glass texture { surface { ambient 0 diffuse 0 specular 0.2 reflection white, 0.1 transmission white, 1, 1.5 }} define shiny surface { ambient 0.1 diffuse 0.6 specular white, 0.6 microfacet Phong 7  } define steely_blue texture { shiny { color black } } define chrome texture { surface { color white ambient 0.0 diffuse 0.2 specular 0.4 microfacet Phong 10 reflection 0.8 } }   viewpoint {     from <4.000, -1.000, 1.000> at <0.000, 0.000, 0.000> up <0, 1, 0> angle 60     resolution 640, 480 aspect 1.6 image_format 0 }       light <-10, 30, 20> light <-10, 30, -20>   object { disc <0, -2, 0>, <0, 1, 0>, 30 wooden }   object { sphere <0.000, 0.000, 0.000>, 1.00 chrome } object { cylinder <0.000, 0.000, 0.000>, <0.000, 0.000, -4.000>, 0.50 chrome }   After setting up the background and defining colors and textures, the viewpoint is specified. The “camera” is located at a point in 3D space, and it looks towards another point. The angle, image resolution, and aspect ratio are specified. Two lights are present in the image at defined coordinates. The three objects in the image are a wooden disc to represent a table top, and a sphere and cylinder that intersect to form a pin that will be used for the pin board toy in the final animation. When the image is rendered, the following image is produced. The pins are modeled with a chrome surface, so they reflect the environment around them. Note that the scale of the pin shaft is not correct, this will be fixed later. Modeling the Pin Board The frame of the pin-board is made up of three boxes, and six cylinders, the front box is modeled using a clear, slightly reflective solid, with the same refractive index of glass. The other shapes are modeled as metal. object { box <-5.5, -1.5, 1>, <5.5, 5.5, 1.2> glass } object { box <-5.5, -1.5, -0.04>, <5.5, 5.5, -0.09> steely_blue } object { box <-5.5, -1.5, -0.52>, <5.5, 5.5, -0.59> steely_blue } object { cylinder <-5.2, -1.2, 1.4>, <-5.2, -1.2, -0.74>, 0.2 steely_blue } object { cylinder <5.2, -1.2, 1.4>, <5.2, -1.2, -0.74>, 0.2 steely_blue } object { cylinder <-5.2, 5.2, 1.4>, <-5.2, 5.2, -0.74>, 0.2 steely_blue } object { cylinder <5.2, 5.2, 1.4>, <5.2, 5.2, -0.74>, 0.2 steely_blue } object { cylinder <0, -1.2, 1.4>, <0, -1.2, -0.74>, 0.2 steely_blue } object { cylinder <0, 5.2, 1.4>, <0, 5.2, -0.74>, 0.2 steely_blue }   In order to create the matrix of pins that make up the pin board I used a basic console application with a few nested loops to create two intersecting matrixes of pins, which models the layout used in the pin boards. The resulting image is shown below. The pin board contains 11,481 pins, with the scene file containing 23,709 lines of code. For the complete animation 2,000 scene files will be created, which is over 47 million lines of code. Each pin in the pin-board will slide out a specific distance when an object is pressed into the back of the board. This is easily modeled by setting the Z coordinate of the pin to a specific value. In order to set all of the pins in the pin-board to the correct position, a bitmap image can be used. The position of the pin can be set based on the color of the pixel at the appropriate position in the image. When the Windows Azure logo is used to set the Z coordinate of the pins, the following image is generated. The challenge now was to make a cool animation. The Azure Logo is fine, but it is static. Using a normal video to animate the pins would not work; the colors in the video would not be the same as the depth of the objects from the camera. In order to simulate the pin board accurately a series of frames from a depth camera could be used. Windows Kinect The Kenect controllers for the X-Box 360 and Windows feature a depth camera. The Kinect SDK for Windows provides a programming interface for Kenect, providing easy access for .NET developers to the Kinect sensors. The Kinect Explorer provided with the Kinect SDK is a great starting point for exploring Kinect from a developers perspective. Both the X-Box 360 Kinect and the Windows Kinect will work with the Kinect SDK, the Windows Kinect is required for commercial applications, but the X-Box Kinect can be used for hobby projects. The Windows Kinect has the advantage of providing a mode to allow depth capture with objects closer to the camera, which makes for a more accurate depth image for setting the pin positions. Creating a Depth Field Animation The depth field animation used to set the positions of the pin in the pin board was created using a modified version of the Kinect Explorer sample application. In order to simulate the pin board accurately, a small section of the depth range from the depth sensor will be used. Any part of the object in front of the depth range will result in a white pixel; anything behind the depth range will be black. Within the depth range the pixels in the image will be set to RGB values from 0,0,0 to 255,255,255. A screen shot of the modified Kinect Explorer application is shown below. The Kinect Explorer sample application was modified to include slider controls that are used to set the depth range that forms the image from the depth stream. This allows the fine tuning of the depth image that is required for simulating the position of the pins in the pin board. The Kinect Explorer was also modified to record a series of images from the depth camera and save them as a sequence JPEG files that will be used to animate the pins in the animation the Start and Stop buttons are used to start and stop the image recording. En example of one of the depth images is shown below. Once a series of 2,000 depth images has been captured, the task of creating the animation can begin. Rendering a Test Frame In order to test the creation of frames and get an approximation of the time required to render each frame a test frame was rendered on-premise using PolyRay. The output of the rendering process is shown below. The test frame contained 23,629 primitive shapes, most of which are the spheres and cylinders that are used for the 11,800 or so pins in the pin board. The 1280x720 image contains 921,600 pixels, but as anti-aliasing was used the number of rays that were calculated was 4,235,777, with 3,478,754,073 object boundaries checked. The test frame of the pin board with the depth field image applied is shown below. The tracing time for the test frame was 4 minutes 27 seconds, which means rendering the2,000 frames in the animation would take over 148 hours, or a little over 6 days. Although this is much faster that an old 486, waiting almost a week to see the results of an animation would make it challenging for animators to create, view, and refine their animations. It would be much better if the animation could be rendered in less than one hour. Windows Azure Worker Roles The cost of creating an on-premise render farm to render animations increases in proportion to the number of servers. The table below shows the cost of servers for creating a render farm, assuming a cost of $500 per server. Number of Servers Cost 1 $500 16 $8,000 256 $128,000   As well as the cost of the servers, there would be additional costs for networking, racks etc. Hosting an environment of 256 servers on-premise would require a server room with cooling, and some pretty hefty power cabling. The Windows Azure compute services provide worker roles, which are ideal for performing processor intensive compute tasks. With the scalability available in Windows Azure a job that takes 256 hours to complete could be perfumed using different numbers of worker roles. The time and cost of using 1, 16 or 256 worker roles is shown below. Number of Worker Roles Render Time Cost 1 256 hours $30.72 16 16 hours $30.72 256 1 hour $30.72   Using worker roles in Windows Azure provides the same cost for the 256 hour job, irrespective of the number of worker roles used. Provided the compute task can be broken down into many small units, and the worker role compute power can be used effectively, it makes sense to scale the application so that the task is completed quickly, making the results available in a timely fashion. The task of rendering 2,000 frames in an animation is one that can easily be broken down into 2,000 individual pieces, which can be performed by a number of worker roles. Creating a Render Farm in Windows Azure The architecture of the render farm is shown in the following diagram. The render farm is a hybrid application with the following components: ·         On-Premise o   Windows Kinect – Used combined with the Kinect Explorer to create a stream of depth images. o   Animation Creator – This application uses the depth images from the Kinect sensor to create scene description files for PolyRay. These files are then uploaded to the jobs blob container, and job messages added to the jobs queue. o   Process Monitor – This application queries the role instance lifecycle table and displays statistics about the render farm environment and render process. o   Image Downloader – This application polls the image queue and downloads the rendered animation files once they are complete. ·         Windows Azure o   Azure Storage – Queues and blobs are used for the scene description files and completed frames. A table is used to store the statistics about the rendering environment.   The architecture of each worker role is shown below.   The worker role is configured to use local storage, which provides file storage on the worker role instance that can be use by the applications to render the image and transform the format of the image. The service definition for the worker role with the local storage configuration highlighted is shown below. <?xml version="1.0" encoding="utf-8"?> <ServiceDefinition name="CloudRay" >   <WorkerRole name="CloudRayWorkerRole" vmsize="Small">     <Imports>     </Imports>     <ConfigurationSettings>       <Setting name="DataConnectionString" />     </ConfigurationSettings>     <LocalResources>       <LocalStorage name="RayFolder" cleanOnRoleRecycle="true" />     </LocalResources>   </WorkerRole> </ServiceDefinition>     The two executable programs, PolyRay.exe and DTA.exe are included in the Azure project, with Copy Always set as the property. PolyRay will take the scene description file and render it to a Truevision TGA file. As the TGA format has not seen much use since the mid 90’s it is converted to a JPG image using Dave's Targa Animator, another shareware application from the 90’s. Each worker roll will use the following process to render the animation frames. 1.       The worker process polls the job queue, if a job is available the scene description file is downloaded from blob storage to local storage. 2.       PolyRay.exe is started in a process with the appropriate command line arguments to render the image as a TGA file. 3.       DTA.exe is started in a process with the appropriate command line arguments convert the TGA file to a JPG file. 4.       The JPG file is uploaded from local storage to the images blob container. 5.       A message is placed on the images queue to indicate a new image is available for download. 6.       The job message is deleted from the job queue. 7.       The role instance lifecycle table is updated with statistics on the number of frames rendered by the worker role instance, and the CPU time used. The code for this is shown below. public override void Run() {     // Set environment variables     string polyRayPath = Path.Combine(Environment.GetEnvironmentVariable("RoleRoot"), PolyRayLocation);     string dtaPath = Path.Combine(Environment.GetEnvironmentVariable("RoleRoot"), DTALocation);       LocalResource rayStorage = RoleEnvironment.GetLocalResource("RayFolder");     string localStorageRootPath = rayStorage.RootPath;       JobQueue jobQueue = new JobQueue("renderjobs");     JobQueue downloadQueue = new JobQueue("renderimagedownloadjobs");     CloudRayBlob sceneBlob = new CloudRayBlob("scenes");     CloudRayBlob imageBlob = new CloudRayBlob("images");     RoleLifecycleDataSource roleLifecycleDataSource = new RoleLifecycleDataSource();       Frames = 0;       while (true)     {         // Get the render job from the queue         CloudQueueMessage jobMsg = jobQueue.Get();           if (jobMsg != null)         {             // Get the file details             string sceneFile = jobMsg.AsString;             string tgaFile = sceneFile.Replace(".pi", ".tga");             string jpgFile = sceneFile.Replace(".pi", ".jpg");               string sceneFilePath = Path.Combine(localStorageRootPath, sceneFile);             string tgaFilePath = Path.Combine(localStorageRootPath, tgaFile);             string jpgFilePath = Path.Combine(localStorageRootPath, jpgFile);               // Copy the scene file to local storage             sceneBlob.DownloadFile(sceneFilePath);               // Run the ray tracer.             string polyrayArguments =                 string.Format("\"{0}\" -o \"{1}\" -a 2", sceneFilePath, tgaFilePath);             Process polyRayProcess = new Process();             polyRayProcess.StartInfo.FileName =                 Path.Combine(Environment.GetEnvironmentVariable("RoleRoot"), polyRayPath);             polyRayProcess.StartInfo.Arguments = polyrayArguments;             polyRayProcess.Start();             polyRayProcess.WaitForExit();               // Convert the image             string dtaArguments =                 string.Format(" {0} /FJ /P{1}", tgaFilePath, Path.GetDirectoryName (jpgFilePath));             Process dtaProcess = new Process();             dtaProcess.StartInfo.FileName =                 Path.Combine(Environment.GetEnvironmentVariable("RoleRoot"), dtaPath);             dtaProcess.StartInfo.Arguments = dtaArguments;             dtaProcess.Start();             dtaProcess.WaitForExit();               // Upload the image to blob storage             imageBlob.UploadFile(jpgFilePath);               // Add a download job.             downloadQueue.Add(jpgFile);               // Delete the render job message             jobQueue.Delete(jobMsg);               Frames++;         }         else         {             Thread.Sleep(1000);         }           // Log the worker role activity.         roleLifecycleDataSource.Alive             ("CloudRayWorker", RoleLifecycleDataSource.RoleLifecycleId, Frames);     } }     Monitoring Worker Role Instance Lifecycle In order to get more accurate statistics about the lifecycle of the worker role instances used to render the animation data was tracked in an Azure storage table. The following class was used to track the worker role lifecycles in Azure storage.   public class RoleLifecycle : TableServiceEntity {     public string ServerName { get; set; }     public string Status { get; set; }     public DateTime StartTime { get; set; }     public DateTime EndTime { get; set; }     public long SecondsRunning { get; set; }     public DateTime LastActiveTime { get; set; }     public int Frames { get; set; }     public string Comment { get; set; }       public RoleLifecycle()     {     }       public RoleLifecycle(string roleName)     {         PartitionKey = roleName;         RowKey = Utils.GetAscendingRowKey();         Status = "Started";         StartTime = DateTime.UtcNow;         LastActiveTime = StartTime;         EndTime = StartTime;         SecondsRunning = 0;         Frames = 0;     } }     A new instance of this class is created and added to the storage table when the role starts. It is then updated each time the worker renders a frame to record the total number of frames rendered and the total processing time. These statistics are used be the monitoring application to determine the effectiveness of use of resources in the render farm. Rendering the Animation The Azure solution was deployed to Windows Azure with the service configuration set to 16 worker role instances. This allows for the application to be tested in the cloud environment, and the performance of the application determined. When I demo the application at conferences and user groups I often start with 16 instances, and then scale up the application to the full 256 instances. The configuration to run 16 instances is shown below. <?xml version="1.0" encoding="utf-8"?> <ServiceConfiguration serviceName="CloudRay" xmlns="http://schemas.microsoft.com/ServiceHosting/2008/10/ServiceConfiguration" osFamily="1" osVersion="*">   <Role name="CloudRayWorkerRole">     <Instances count="16" />     <ConfigurationSettings>       <Setting name="DataConnectionString"         value="DefaultEndpointsProtocol=https;AccountName=cloudraydata;AccountKey=..." />     </ConfigurationSettings>   </Role> </ServiceConfiguration>     About six minutes after deploying the application the first worker roles become active and start to render the first frames of the animation. The CloudRay Monitor application displays an icon for each worker role instance, with a number indicating the number of frames that the worker role has rendered. The statistics on the left show the number of active worker roles and statistics about the render process. The render time is the time since the first worker role became active; the CPU time is the total amount of processing time used by all worker role instances to render the frames.   Five minutes after the first worker role became active the last of the 16 worker roles activated. By this time the first seven worker roles had each rendered one frame of the animation.   With 16 worker roles u and running it can be seen that one hour and 45 minutes CPU time has been used to render 32 frames with a render time of just under 10 minutes.     At this rate it would take over 10 hours to render the 2,000 frames of the full animation. In order to complete the animation in under an hour more processing power will be required. Scaling the render farm from 16 instances to 256 instances is easy using the new management portal. The slider is set to 256 instances, and the configuration saved. We do not need to re-deploy the application, and the 16 instances that are up and running will not be affected. Alternatively, the configuration file for the Azure service could be modified to specify 256 instances.   <?xml version="1.0" encoding="utf-8"?> <ServiceConfiguration serviceName="CloudRay" xmlns="http://schemas.microsoft.com/ServiceHosting/2008/10/ServiceConfiguration" osFamily="1" osVersion="*">   <Role name="CloudRayWorkerRole">     <Instances count="256" />     <ConfigurationSettings>       <Setting name="DataConnectionString"         value="DefaultEndpointsProtocol=https;AccountName=cloudraydata;AccountKey=..." />     </ConfigurationSettings>   </Role> </ServiceConfiguration>     Six minutes after the new configuration has been applied 75 new worker roles have activated and are processing their first frames.   Five minutes later the full configuration of 256 worker roles is up and running. We can see that the average rate of frame rendering has increased from 3 to 12 frames per minute, and that over 17 hours of CPU time has been utilized in 23 minutes. In this test the time to provision 140 worker roles was about 11 minutes, which works out at about one every five seconds.   We are now half way through the rendering, with 1,000 frames complete. This has utilized just under three days of CPU time in a little over 35 minutes.   The animation is now complete, with 2,000 frames rendered in a little over 52 minutes. The CPU time used by the 256 worker roles is 6 days, 7 hours and 22 minutes with an average frame rate of 38 frames per minute. The rendering of the last 1,000 frames took 16 minutes 27 seconds, which works out at a rendering rate of 60 frames per minute. The frame counts in the server instances indicate that the use of a queue to distribute the workload has been very effective in distributing the load across the 256 worker role instances. The first 16 instances that were deployed first have rendered between 11 and 13 frames each, whilst the 240 instances that were added when the application was scaled have rendered between 6 and 9 frames each.   Completed Animation I’ve uploaded the completed animation to YouTube, a low resolution preview is shown below. Pin Board Animation Created using Windows Kinect and 256 Windows Azure Worker Roles   The animation can be viewed in 1280x720 resolution at the following link: http://www.youtube.com/watch?v=n5jy6bvSxWc Effective Use of Resources According to the CloudRay monitor statistics the animation took 6 days, 7 hours and 22 minutes CPU to render, this works out at 152 hours of compute time, rounded up to the nearest hour. As the usage for the worker role instances are billed for the full hour, it may have been possible to render the animation using fewer than 256 worker roles. When deciding the optimal usage of resources, the time required to provision and start the worker roles must also be considered. In the demo I started with 16 worker roles, and then scaled the application to 256 worker roles. It would have been more optimal to start the application with maybe 200 worker roles, and utilized the full hour that I was being billed for. This would, however, have prevented showing the ease of scalability of the application. The new management portal displays the CPU usage across the worker roles in the deployment. The average CPU usage across all instances is 93.27%, with over 99% used when all the instances are up and running. This shows that the worker role resources are being used very effectively. Grid Computing Scenarios Although I am using this scenario for a hobby project, there are many scenarios where a large amount of compute power is required for a short period of time. Windows Azure provides a great platform for developing these types of grid computing applications, and can work out very cost effective. ·         Windows Azure can provide massive compute power, on demand, in a matter of minutes. ·         The use of queues to manage the load balancing of jobs between role instances is a simple and effective solution. ·         Using a cloud-computing platform like Windows Azure allows proof-of-concept scenarios to be tested and evaluated on a very low budget. ·         No charges for inbound data transfer makes the uploading of large data sets to Windows Azure Storage services cost effective. (Transaction charges still apply.) Tips for using Windows Azure for Grid Computing Scenarios I found the implementation of a render farm using Windows Azure a fairly simple scenario to implement. I was impressed by ease of scalability that Azure provides, and by the short time that the application took to scale from 16 to 256 worker role instances. In this case it was around 13 minutes, in other tests it took between 10 and 20 minutes. The following tips may be useful when implementing a grid computing project in Windows Azure. ·         Using an Azure Storage queue to load-balance the units of work across multiple worker roles is simple and very effective. The design I have used in this scenario could easily scale to many thousands of worker role instances. ·         Windows Azure accounts are typically limited to 20 cores. If you need to use more than this, a call to support and a credit card check will be required. ·         Be aware of how the billing model works. You will be charged for worker role instances for the full clock our in which the instance is deployed. Schedule the workload to start just after the clock hour has started. ·         Monitor the utilization of the resources you are provisioning, ensure that you are not paying for worker roles that are idle. ·         If you are deploying third party applications to worker roles, you may well run into licensing issues. Purchasing software licenses on a per-processor basis when using hundreds of processors for a short time period would not be cost effective. ·         Third party software may also require installation onto the worker roles, which can be accomplished using start-up tasks. Bear in mind that adding a startup task and possible re-boot will add to the time required for the worker role instance to start and activate. An alternative may be to use a prepared VM and use VM roles. ·         Consider using the Windows Azure Autoscaling Application Block (WASABi) to autoscale the worker roles in your application. When using a large number of worker roles, the utilization must be carefully monitored, if the scaling algorithms are not optimal it could get very expensive!

    Read the article

  • Why do apache2 upgrades remove and not re-install libapache2-mod-php5?

    - by nutznboltz
    We repeatedly see that when an apache2 update arrives and is installed it causes the libapache2-mod-php5 package to be removed and does not subsequently re-install it automatically. We must subsequently re-install the libapache2-mod-php5 manually in order to restore functionality to our web server. Please see the following github gist, it is a contiguous section of our server's dpkg.log showing the November 14, 2011 update to apache2: https://gist.github.com/1368361 it includes 2011-11-14 11:22:18 remove libapache2-mod-php5 5.3.2-1ubuntu4.10 5.3.2-1ubuntu4.10 Is this a known issue? Do other people see this too? I could not find any launchpad bug reports about it. Platform details: $ lsb_release -ds Ubuntu 10.04.3 LTS $ uname -srvm Linux 2.6.38-12-virtual #51~lucid1-Ubuntu SMP Thu Sep 29 20:27:50 UTC 2011 x86_64 $ dpkg -l | awk '/ii.*apache/ {print $2 " " $3 }' apache2 2.2.14-5ubuntu8.7 apache2-mpm-prefork 2.2.14-5ubuntu8.7 apache2-utils 2.2.14-5ubuntu8.7 apache2.2-bin 2.2.14-5ubuntu8.7 apache2.2-common 2.2.14-5ubuntu8.7 libapache2-mod-authnz-external 3.2.4-2+squeeze1build0.10.04.1 libapache2-mod-php5 5.3.2-1ubuntu4.10 Thanks At a high-level the update process looks like: package package_name do action :upgrade case node[:platform] when 'centos', 'redhat', 'scientific' options '--disableplugin=fastestmirror' when 'ubuntu' options '-o Dpkg::Options::="--force-confdef" -o Dpkg::Options::="--force-confold"' end end But at a lower level def install_package(name, version) run_command_with_systems_locale( :command = "apt-get -q -y#{expand_options(@new_resource.options)} install #{name}=#{version}", :environment = { "DEBIAN_FRONTEND" = "noninteractive" } ) end def upgrade_package(name, version) install_package(name, version) end So Chef is using "install" to do "update". This sort of moves the question around to "how does apt-get safe-upgrade" remember to re-install libapache-mod-php5? The exact sequence of packages that triggered this was: apache2 apache2-mpm-prefork apache2-mpm-worker apache2-utils apache2.2-bin apache2.2-common But the code is attempting to run checks to make sure the packages in that list are installed already before attempting to "upgrade" them. case node[:platform] when 'debian', 'centos', 'fedora', 'redhat', 'scientific', 'ubuntu' # first primitive way is to define the updates in the recipe # data bags will be used later %w/ apache2 apache2-mpm-prefork apache2-mpm-worker apache2-utils apache2.2-bin apache2.2-common /.each{ |package_name| Chef::Log.debug("is #{package_name} among local packages available for changes?") next unless node[:packages][:changes].keys.include?(package_name) Chef::Log.debug("is #{package_name} available for upgrade?") next unless node[:packages][:changes][package_name][:action] == 'upgrade' package package_name do action :upgrade case node[:platform] when 'centos', 'redhat', 'scientific' options '--disableplugin=fastestmirror' when 'ubuntu' options '-o Dpkg::Options::="--force-confdef" -o Dpkg::Options::="--force-confold"' end end tag('upgraded') } # after upgrading everything, run yum cache updater if tagged?('upgraded') # Remove old orphaned dependencies and kernel images and kernel headers etc. # Remove cached deb files. case node[:platform] when 'ubuntu' execute 'apt-get -y autoremove' execute 'apt-get clean' # Re-check what updates are available soon. when 'centos', 'fedora', 'redhat', 'scientific' node[:packages][:last_time_we_looked_at_yum] = 0 end untag('upgraded') end end But it's clear that it fails since the dpkg.log has 2011-11-14 11:22:25 install apache2-mpm-worker 2.2.14-5ubuntu8.7 on a system which does not currently have apache2-mpm-worker. I will have to discuss this with the author, thanks again.

    Read the article

  • A Taxonomy of Numerical Methods v1

    - by JoshReuben
    Numerical Analysis – When, What, (but not how) Once you understand the Math & know C++, Numerical Methods are basically blocks of iterative & conditional math code. I found the real trick was seeing the forest for the trees – knowing which method to use for which situation. Its pretty easy to get lost in the details – so I’ve tried to organize these methods in a way that I can quickly look this up. I’ve included links to detailed explanations and to C++ code examples. I’ve tried to classify Numerical methods in the following broad categories: Solving Systems of Linear Equations Solving Non-Linear Equations Iteratively Interpolation Curve Fitting Optimization Numerical Differentiation & Integration Solving ODEs Boundary Problems Solving EigenValue problems Enjoy – I did ! Solving Systems of Linear Equations Overview Solve sets of algebraic equations with x unknowns The set is commonly in matrix form Gauss-Jordan Elimination http://en.wikipedia.org/wiki/Gauss%E2%80%93Jordan_elimination C++: http://www.codekeep.net/snippets/623f1923-e03c-4636-8c92-c9dc7aa0d3c0.aspx Produces solution of the equations & the coefficient matrix Efficient, stable 2 steps: · Forward Elimination – matrix decomposition: reduce set to triangular form (0s below the diagonal) or row echelon form. If degenerate, then there is no solution · Backward Elimination –write the original matrix as the product of ints inverse matrix & its reduced row-echelon matrix à reduce set to row canonical form & use back-substitution to find the solution to the set Elementary ops for matrix decomposition: · Row multiplication · Row switching · Add multiples of rows to other rows Use pivoting to ensure rows are ordered for achieving triangular form LU Decomposition http://en.wikipedia.org/wiki/LU_decomposition C++: http://ganeshtiwaridotcomdotnp.blogspot.co.il/2009/12/c-c-code-lu-decomposition-for-solving.html Represent the matrix as a product of lower & upper triangular matrices A modified version of GJ Elimination Advantage – can easily apply forward & backward elimination to solve triangular matrices Techniques: · Doolittle Method – sets the L matrix diagonal to unity · Crout Method - sets the U matrix diagonal to unity Note: both the L & U matrices share the same unity diagonal & can be stored compactly in the same matrix Gauss-Seidel Iteration http://en.wikipedia.org/wiki/Gauss%E2%80%93Seidel_method C++: http://www.nr.com/forum/showthread.php?t=722 Transform the linear set of equations into a single equation & then use numerical integration (as integration formulas have Sums, it is implemented iteratively). an optimization of Gauss-Jacobi: 1.5 times faster, requires 0.25 iterations to achieve the same tolerance Solving Non-Linear Equations Iteratively find roots of polynomials – there may be 0, 1 or n solutions for an n order polynomial use iterative techniques Iterative methods · used when there are no known analytical techniques · Requires set functions to be continuous & differentiable · Requires an initial seed value – choice is critical to convergence à conduct multiple runs with different starting points & then select best result · Systematic - iterate until diminishing returns, tolerance or max iteration conditions are met · bracketing techniques will always yield convergent solutions, non-bracketing methods may fail to converge Incremental method if a nonlinear function has opposite signs at 2 ends of a small interval x1 & x2, then there is likely to be a solution in their interval – solutions are detected by evaluating a function over interval steps, for a change in sign, adjusting the step size dynamically. Limitations – can miss closely spaced solutions in large intervals, cannot detect degenerate (coinciding) solutions, limited to functions that cross the x-axis, gives false positives for singularities Fixed point method http://en.wikipedia.org/wiki/Fixed-point_iteration C++: http://books.google.co.il/books?id=weYj75E_t6MC&pg=PA79&lpg=PA79&dq=fixed+point+method++c%2B%2B&source=bl&ots=LQ-5P_taoC&sig=lENUUIYBK53tZtTwNfHLy5PEWDk&hl=en&sa=X&ei=wezDUPW1J5DptQaMsIHQCw&redir_esc=y#v=onepage&q=fixed%20point%20method%20%20c%2B%2B&f=false Algebraically rearrange a solution to isolate a variable then apply incremental method Bisection method http://en.wikipedia.org/wiki/Bisection_method C++: http://numericalcomputing.wordpress.com/category/algorithms/ Bracketed - Select an initial interval, keep bisecting it ad midpoint into sub-intervals and then apply incremental method on smaller & smaller intervals – zoom in Adv: unaffected by function gradient à reliable Disadv: slow convergence False Position Method http://en.wikipedia.org/wiki/False_position_method C++: http://www.dreamincode.net/forums/topic/126100-bisection-and-false-position-methods/ Bracketed - Select an initial interval , & use the relative value of function at interval end points to select next sub-intervals (estimate how far between the end points the solution might be & subdivide based on this) Newton-Raphson method http://en.wikipedia.org/wiki/Newton's_method C++: http://www-users.cselabs.umn.edu/classes/Summer-2012/csci1113/index.php?page=./newt3 Also known as Newton's method Convenient, efficient Not bracketed – only a single initial guess is required to start iteration – requires an analytical expression for the first derivative of the function as input. Evaluates the function & its derivative at each step. Can be extended to the Newton MutiRoot method for solving multiple roots Can be easily applied to an of n-coupled set of non-linear equations – conduct a Taylor Series expansion of a function, dropping terms of order n, rewrite as a Jacobian matrix of PDs & convert to simultaneous linear equations !!! Secant Method http://en.wikipedia.org/wiki/Secant_method C++: http://forum.vcoderz.com/showthread.php?p=205230 Unlike N-R, can estimate first derivative from an initial interval (does not require root to be bracketed) instead of inputting it Since derivative is approximated, may converge slower. Is fast in practice as it does not have to evaluate the derivative at each step. Similar implementation to False Positive method Birge-Vieta Method http://mat.iitm.ac.in/home/sryedida/public_html/caimna/transcendental/polynomial%20methods/bv%20method.html C++: http://books.google.co.il/books?id=cL1boM2uyQwC&pg=SA3-PA51&lpg=SA3-PA51&dq=Birge-Vieta+Method+c%2B%2B&source=bl&ots=QZmnDTK3rC&sig=BPNcHHbpR_DKVoZXrLi4nVXD-gg&hl=en&sa=X&ei=R-_DUK2iNIjzsgbE5ID4Dg&redir_esc=y#v=onepage&q=Birge-Vieta%20Method%20c%2B%2B&f=false combines Horner's method of polynomial evaluation (transforming into lesser degree polynomials that are more computationally efficient to process) with Newton-Raphson to provide a computational speed-up Interpolation Overview Construct new data points for as close as possible fit within range of a discrete set of known points (that were obtained via sampling, experimentation) Use Taylor Series Expansion of a function f(x) around a specific value for x Linear Interpolation http://en.wikipedia.org/wiki/Linear_interpolation C++: http://www.hamaluik.com/?p=289 Straight line between 2 points à concatenate interpolants between each pair of data points Bilinear Interpolation http://en.wikipedia.org/wiki/Bilinear_interpolation C++: http://supercomputingblog.com/graphics/coding-bilinear-interpolation/2/ Extension of the linear function for interpolating functions of 2 variables – perform linear interpolation first in 1 direction, then in another. Used in image processing – e.g. texture mapping filter. Uses 4 vertices to interpolate a value within a unit cell. Lagrange Interpolation http://en.wikipedia.org/wiki/Lagrange_polynomial C++: http://www.codecogs.com/code/maths/approximation/interpolation/lagrange.php For polynomials Requires recomputation for all terms for each distinct x value – can only be applied for small number of nodes Numerically unstable Barycentric Interpolation http://epubs.siam.org/doi/pdf/10.1137/S0036144502417715 C++: http://www.gamedev.net/topic/621445-barycentric-coordinates-c-code-check/ Rearrange the terms in the equation of the Legrange interpolation by defining weight functions that are independent of the interpolated value of x Newton Divided Difference Interpolation http://en.wikipedia.org/wiki/Newton_polynomial C++: http://jee-appy.blogspot.co.il/2011/12/newton-divided-difference-interpolation.html Hermite Divided Differences: Interpolation polynomial approximation for a given set of data points in the NR form - divided differences are used to approximately calculate the various differences. For a given set of 3 data points , fit a quadratic interpolant through the data Bracketed functions allow Newton divided differences to be calculated recursively Difference table Cubic Spline Interpolation http://en.wikipedia.org/wiki/Spline_interpolation C++: https://www.marcusbannerman.co.uk/index.php/home/latestarticles/42-articles/96-cubic-spline-class.html Spline is a piecewise polynomial Provides smoothness – for interpolations with significantly varying data Use weighted coefficients to bend the function to be smooth & its 1st & 2nd derivatives are continuous through the edge points in the interval Curve Fitting A generalization of interpolating whereby given data points may contain noise à the curve does not necessarily pass through all the points Least Squares Fit http://en.wikipedia.org/wiki/Least_squares C++: http://www.ccas.ru/mmes/educat/lab04k/02/least-squares.c Residual – difference between observed value & expected value Model function is often chosen as a linear combination of the specified functions Determines: A) The model instance in which the sum of squared residuals has the least value B) param values for which model best fits data Straight Line Fit Linear correlation between independent variable and dependent variable Linear Regression http://en.wikipedia.org/wiki/Linear_regression C++: http://www.oocities.org/david_swaim/cpp/linregc.htm Special case of statistically exact extrapolation Leverage least squares Given a basis function, the sum of the residuals is determined and the corresponding gradient equation is expressed as a set of normal linear equations in matrix form that can be solved (e.g. using LU Decomposition) Can be weighted - Drop the assumption that all errors have the same significance –-> confidence of accuracy is different for each data point. Fit the function closer to points with higher weights Polynomial Fit - use a polynomial basis function Moving Average http://en.wikipedia.org/wiki/Moving_average C++: http://www.codeproject.com/Articles/17860/A-Simple-Moving-Average-Algorithm Used for smoothing (cancel fluctuations to highlight longer-term trends & cycles), time series data analysis, signal processing filters Replace each data point with average of neighbors. Can be simple (SMA), weighted (WMA), exponential (EMA). Lags behind latest data points – extra weight can be given to more recent data points. Weights can decrease arithmetically or exponentially according to distance from point. Parameters: smoothing factor, period, weight basis Optimization Overview Given function with multiple variables, find Min (or max by minimizing –f(x)) Iterative approach Efficient, but not necessarily reliable Conditions: noisy data, constraints, non-linear models Detection via sign of first derivative - Derivative of saddle points will be 0 Local minima Bisection method Similar method for finding a root for a non-linear equation Start with an interval that contains a minimum Golden Search method http://en.wikipedia.org/wiki/Golden_section_search C++: http://www.codecogs.com/code/maths/optimization/golden.php Bisect intervals according to golden ratio 0.618.. Achieves reduction by evaluating a single function instead of 2 Newton-Raphson Method Brent method http://en.wikipedia.org/wiki/Brent's_method C++: http://people.sc.fsu.edu/~jburkardt/cpp_src/brent/brent.cpp Based on quadratic or parabolic interpolation – if the function is smooth & parabolic near to the minimum, then a parabola fitted through any 3 points should approximate the minima – fails when the 3 points are collinear , in which case the denominator is 0 Simplex Method http://en.wikipedia.org/wiki/Simplex_algorithm C++: http://www.codeguru.com/cpp/article.php/c17505/Simplex-Optimization-Algorithm-and-Implemetation-in-C-Programming.htm Find the global minima of any multi-variable function Direct search – no derivatives required At each step it maintains a non-degenerative simplex – a convex hull of n+1 vertices. Obtains the minimum for a function with n variables by evaluating the function at n-1 points, iteratively replacing the point of worst result with the point of best result, shrinking the multidimensional simplex around the best point. Point replacement involves expanding & contracting the simplex near the worst value point to determine a better replacement point Oscillation can be avoided by choosing the 2nd worst result Restart if it gets stuck Parameters: contraction & expansion factors Simulated Annealing http://en.wikipedia.org/wiki/Simulated_annealing C++: http://code.google.com/p/cppsimulatedannealing/ Analogy to heating & cooling metal to strengthen its structure Stochastic method – apply random permutation search for global minima - Avoid entrapment in local minima via hill climbing Heating schedule - Annealing schedule params: temperature, iterations at each temp, temperature delta Cooling schedule – can be linear, step-wise or exponential Differential Evolution http://en.wikipedia.org/wiki/Differential_evolution C++: http://www.amichel.com/de/doc/html/ More advanced stochastic methods analogous to biological processes: Genetic algorithms, evolution strategies Parallel direct search method against multiple discrete or continuous variables Initial population of variable vectors chosen randomly – if weighted difference vector of 2 vectors yields a lower objective function value then it replaces the comparison vector Many params: #parents, #variables, step size, crossover constant etc Convergence is slow – many more function evaluations than simulated annealing Numerical Differentiation Overview 2 approaches to finite difference methods: · A) approximate function via polynomial interpolation then differentiate · B) Taylor series approximation – additionally provides error estimate Finite Difference methods http://en.wikipedia.org/wiki/Finite_difference_method C++: http://www.wpi.edu/Pubs/ETD/Available/etd-051807-164436/unrestricted/EAMPADU.pdf Find differences between high order derivative values - Approximate differential equations by finite differences at evenly spaced data points Based on forward & backward Taylor series expansion of f(x) about x plus or minus multiples of delta h. Forward / backward difference - the sums of the series contains even derivatives and the difference of the series contains odd derivatives – coupled equations that can be solved. Provide an approximation of the derivative within a O(h^2) accuracy There is also central difference & extended central difference which has a O(h^4) accuracy Richardson Extrapolation http://en.wikipedia.org/wiki/Richardson_extrapolation C++: http://mathscoding.blogspot.co.il/2012/02/introduction-richardson-extrapolation.html A sequence acceleration method applied to finite differences Fast convergence, high accuracy O(h^4) Derivatives via Interpolation Cannot apply Finite Difference method to discrete data points at uneven intervals – so need to approximate the derivative of f(x) using the derivative of the interpolant via 3 point Lagrange Interpolation Note: the higher the order of the derivative, the lower the approximation precision Numerical Integration Estimate finite & infinite integrals of functions More accurate procedure than numerical differentiation Use when it is not possible to obtain an integral of a function analytically or when the function is not given, only the data points are Newton Cotes Methods http://en.wikipedia.org/wiki/Newton%E2%80%93Cotes_formulas C++: http://www.siafoo.net/snippet/324 For equally spaced data points Computationally easy – based on local interpolation of n rectangular strip areas that is piecewise fitted to a polynomial to get the sum total area Evaluate the integrand at n+1 evenly spaced points – approximate definite integral by Sum Weights are derived from Lagrange Basis polynomials Leverage Trapezoidal Rule for default 2nd formulas, Simpson 1/3 Rule for substituting 3 point formulas, Simpson 3/8 Rule for 4 point formulas. For 4 point formulas use Bodes Rule. Higher orders obtain more accurate results Trapezoidal Rule uses simple area, Simpsons Rule replaces the integrand f(x) with a quadratic polynomial p(x) that uses the same values as f(x) for its end points, but adds a midpoint Romberg Integration http://en.wikipedia.org/wiki/Romberg's_method C++: http://code.google.com/p/romberg-integration/downloads/detail?name=romberg.cpp&can=2&q= Combines trapezoidal rule with Richardson Extrapolation Evaluates the integrand at equally spaced points The integrand must have continuous derivatives Each R(n,m) extrapolation uses a higher order integrand polynomial replacement rule (zeroth starts with trapezoidal) à a lower triangular matrix set of equation coefficients where the bottom right term has the most accurate approximation. The process continues until the difference between 2 successive diagonal terms becomes sufficiently small. Gaussian Quadrature http://en.wikipedia.org/wiki/Gaussian_quadrature C++: http://www.alglib.net/integration/gaussianquadratures.php Data points are chosen to yield best possible accuracy – requires fewer evaluations Ability to handle singularities, functions that are difficult to evaluate The integrand can include a weighting function determined by a set of orthogonal polynomials. Points & weights are selected so that the integrand yields the exact integral if f(x) is a polynomial of degree <= 2n+1 Techniques (basically different weighting functions): · Gauss-Legendre Integration w(x)=1 · Gauss-Laguerre Integration w(x)=e^-x · Gauss-Hermite Integration w(x)=e^-x^2 · Gauss-Chebyshev Integration w(x)= 1 / Sqrt(1-x^2) Solving ODEs Use when high order differential equations cannot be solved analytically Evaluated under boundary conditions RK for systems – a high order differential equation can always be transformed into a coupled first order system of equations Euler method http://en.wikipedia.org/wiki/Euler_method C++: http://rosettacode.org/wiki/Euler_method First order Runge–Kutta method. Simple recursive method – given an initial value, calculate derivative deltas. Unstable & not very accurate (O(h) error) – not used in practice A first-order method - the local error (truncation error per step) is proportional to the square of the step size, and the global error (error at a given time) is proportional to the step size In evolving solution between data points xn & xn+1, only evaluates derivatives at beginning of interval xn à asymmetric at boundaries Higher order Runge Kutta http://en.wikipedia.org/wiki/Runge%E2%80%93Kutta_methods C++: http://www.dreamincode.net/code/snippet1441.htm 2nd & 4th order RK - Introduces parameterized midpoints for more symmetric solutions à accuracy at higher computational cost Adaptive RK – RK-Fehlberg – estimate the truncation at each integration step & automatically adjust the step size to keep error within prescribed limits. At each step 2 approximations are compared – if in disagreement to a specific accuracy, the step size is reduced Boundary Value Problems Where solution of differential equations are located at 2 different values of the independent variable x à more difficult, because cannot just start at point of initial value – there may not be enough starting conditions available at the end points to produce a unique solution An n-order equation will require n boundary conditions – need to determine the missing n-1 conditions which cause the given conditions at the other boundary to be satisfied Shooting Method http://en.wikipedia.org/wiki/Shooting_method C++: http://ganeshtiwaridotcomdotnp.blogspot.co.il/2009/12/c-c-code-shooting-method-for-solving.html Iteratively guess the missing values for one end & integrate, then inspect the discrepancy with the boundary values of the other end to adjust the estimate Given the starting boundary values u1 & u2 which contain the root u, solve u given the false position method (solving the differential equation as an initial value problem via 4th order RK), then use u to solve the differential equations. Finite Difference Method For linear & non-linear systems Higher order derivatives require more computational steps – some combinations for boundary conditions may not work though Improve the accuracy by increasing the number of mesh points Solving EigenValue Problems An eigenvalue can substitute a matrix when doing matrix multiplication à convert matrix multiplication into a polynomial EigenValue For a given set of equations in matrix form, determine what are the solution eigenvalue & eigenvectors Similar Matrices - have same eigenvalues. Use orthogonal similarity transforms to reduce a matrix to diagonal form from which eigenvalue(s) & eigenvectors can be computed iteratively Jacobi method http://en.wikipedia.org/wiki/Jacobi_method C++: http://people.sc.fsu.edu/~jburkardt/classes/acs2_2008/openmp/jacobi/jacobi.html Robust but Computationally intense – use for small matrices < 10x10 Power Iteration http://en.wikipedia.org/wiki/Power_iteration For any given real symmetric matrix, generate the largest single eigenvalue & its eigenvectors Simplest method – does not compute matrix decomposition à suitable for large, sparse matrices Inverse Iteration Variation of power iteration method – generates the smallest eigenvalue from the inverse matrix Rayleigh Method http://en.wikipedia.org/wiki/Rayleigh's_method_of_dimensional_analysis Variation of power iteration method Rayleigh Quotient Method Variation of inverse iteration method Matrix Tri-diagonalization Method Use householder algorithm to reduce an NxN symmetric matrix to a tridiagonal real symmetric matrix vua N-2 orthogonal transforms     Whats Next Outside of Numerical Methods there are lots of different types of algorithms that I’ve learned over the decades: Data Mining – (I covered this briefly in a previous post: http://geekswithblogs.net/JoshReuben/archive/2007/12/31/ssas-dm-algorithms.aspx ) Search & Sort Routing Problem Solving Logical Theorem Proving Planning Probabilistic Reasoning Machine Learning Solvers (eg MIP) Bioinformatics (Sequence Alignment, Protein Folding) Quant Finance (I read Wilmott’s books – interesting) Sooner or later, I’ll cover the above topics as well.

    Read the article

  • How to use SharePoint modal dialog box to display Custom Page Part3

    - by ybbest
    In the second part of the series, I showed you how to display and close a custom page in a SharePoint modal dialog using JavaScript and display a message after the modal dialog is closed. In this post, I’d like to show you how to use SPLongOperation with the Modal dialog box. You can download the source code here. 1. Firstly, modify the element file as follow <Elements xmlns="http://schemas.microsoft.com/sharepoint/"> <CustomAction Id="ReportConcern" RegistrationType="ContentType" RegistrationId="0x010100866B1423D33DDA4CA1A4639B54DD4642" Location="EditControlBlock" Sequence="107" Title="Display Custom Page" Description="To Display Custom Page in a modal dialog box on this item"> <UrlAction Url="javascript: function emitStatus(messageToDisplay) { statusId = SP.UI.Status.addStatus(messageToDisplay.message + ' ' +messageToDisplay.location ); SP.UI.Status.setStatusPriColor(statusId, 'Green'); } function portalModalDialogClosedCallback(result, value) { if (value !== null) { emitStatus(value); } } var options = { url: '{SiteUrl}' + '/_layouts/YBBEST/TitleRename.aspx?List={ListId}&amp;ID={ItemId}', title: 'Rename title', allowMaximize: false, showClose: true, width: 500, height: 300, dialogReturnValueCallback: portalModalDialogClosedCallback }; SP.UI.ModalDialog.showModalDialog(options);" /> </CustomAction> </Elements> 2. In your code behind, you can implement a close dialog function as below. This will close your modal dialog box once the button is clicked and display a status bar. Note that you need to use window.frameElement.commonModalDialogClose instead of window.frameElement.commonModalDialogClose protected void SubmitClicked(object sender, EventArgs e) { //Process stuff string message = "You clicked the Submit button"; string newLocation="http://www.google.com"; string information = string.Format("{{'message':'{0}','location':'{1}' }}", message, newLocation); var longOperation = new SPLongOperation(Page); longOperation.LeadingHTML = "Processing the  application"; longOperation.TrailingHTML = "Please wait while the application is being processed."; longOperation.Begin(); Thread.Sleep(5*1000); var closeDialogScript = GetCloseDialogScriptForLongProcess(information); longOperation.EndScript(closeDialogScript); } protected static string GetCloseDialogScriptForLongProcess(string message) { var scriptBuilder = new StringBuilder(); scriptBuilder.Append("window.frameElement.commonModalDialogClose(1,").Append(message).Append(");"); return scriptBuilder.ToString(); }   References: How to: Display a Page as a Modal Dialog Box

    Read the article

  • 403 error after adding javascript to masterpage for sharepoint.

    - by Jeremy
    I am attempting to add highslide-with-html.js from http://highslide.com/ to my masterpage. I am receiving a 403 forbidden error when I use the provided masterpage. I have placed it in C:\Program Files\Common Files\Microsoft Shared\web server extensions\12\TEMPLATE\LAYOUTS\1033. Test javascript files such as pirate.js which consists solely of alert("Arr!"); have loaded from the same directory. I have provided the code for the masterpage. When I do not reference the problem javascript file there is no 403 error. <%@ Master language="C#" %> <!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <%@ Import Namespace="Microsoft.SharePoint" %> <%@ Register Tagprefix="SPSWC" Namespace="Microsoft.SharePoint.Portal.WebControls" Assembly="Microsoft.SharePoint.Portal, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="SharePoint" Namespace="Microsoft.SharePoint.WebControls" Assembly="Microsoft.SharePoint, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="WebPartPages" Namespace="Microsoft.SharePoint.WebPartPages" Assembly="Microsoft.SharePoint, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingWebControls" Namespace="Microsoft.SharePoint.Publishing.WebControls" Assembly="Microsoft.SharePoint.Publishing, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register Tagprefix="PublishingNavigation" Namespace="Microsoft.SharePoint.Publishing.Navigation" Assembly="Microsoft.SharePoint.Publishing, Version=12.0.0.0, Culture=neutral, PublicKeyToken=71e9bce111e9429c" %> <%@ Register TagPrefix="wssuc" TagName="Welcome" src="~/_controltemplates/Welcome.ascx" %> <%@ Register TagPrefix="wssuc" TagName="DesignModeConsole" src="~/_controltemplates/DesignModeConsole.ascx" %> <%@ Register TagPrefix="PublishingVariations" TagName="VariationsLabelMenu" src="~/_controltemplates/VariationsLabelMenu.ascx" %> <%@ Register Tagprefix="PublishingConsole" TagName="Console" src="~/_controltemplates/PublishingConsole.ascx" %> <%@ Register TagPrefix="PublishingSiteAction" TagName="SiteActionMenu" src="~/_controltemplates/PublishingActionMenu.ascx" %> <html dir="<%$Resources:wss, multipages_direction_dir_value %>" runat="server" __expr-val-dir="ltr"> <head runat="server"> <meta name="GENERATOR" content="Microsoft SharePoint"> <meta http-equiv="Content-Type" content="text/html; charset=utf-8"> <meta http-equiv="Expires" content="0"> <SharePoint:RobotsMetaTag runat="server" __designer:Preview="" __designer:Values="&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl00' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <title id="onetidTitle"> <asp:ContentPlaceHolder id="PlaceHolderPageTitle" runat="server"/> </title> <Sharepoint:CssLink runat="server" __designer:Preview="&lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/en-US/Core%20Styles/Band.css&quot;/&gt; &lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/en-US/Core%20Styles/controls.css&quot;/&gt; &lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/zz1_blue.css&quot;/&gt; &lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/_layouts/1033/styles/core.css&quot;/&gt; " __designer:Values="&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl01' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <!--Styles used for positioning, font and spacing definitions--> <SharePoint:CssRegistration name="<% $SPUrl:~SiteCollection/Style Library/~language/Core Styles/Band.css%>" runat="server" __designer:Preview="&lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/en-US/Core%20Styles/Band.css&quot;/&gt; " __designer:Values="&lt;P N='Name' Bound='True' T='SPUrl:~SiteCollection/Style Library/~language/Core Styles/Band.css' /&gt;&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl02' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <SharePoint:CssRegistration name="<% $SPUrl:~sitecollection/Style Library/~language/Core Styles/controls.css %>" runat="server" __designer:Preview="&lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/en-US/Core%20Styles/controls.css&quot;/&gt; " __designer:Values="&lt;P N='Name' Bound='True' T='SPUrl:~sitecollection/Style Library/~language/Core Styles/controls.css' /&gt;&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl03' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <SharePoint:CssRegistration name="<% $SPUrl:~SiteCollection/Style Library/zz1_blue.css%>" runat="server" __designer:Preview="&lt;link rel=&quot;stylesheet&quot; type=&quot;text/css&quot; href=&quot;/Style%20Library/zz1_blue.css&quot;/&gt; " __designer:Values="&lt;P N='Name' Bound='True' T='SPUrl:~SiteCollection/Style Library/zz1_blue.css' /&gt;&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl04' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <SharePoint:ScriptLink name="init.js" runat="server" __designer:Preview="&lt;script src=&quot;/_layouts/1033/init.js?rev=VhAxGc3rkK79RM90tibDzw%3D%3D&quot;&gt;&lt;/script&gt; " __designer:Values="&lt;P N='Name' T='init.js' /&gt;&lt;P N='InDesign' T='False' /&gt;&lt;P N='ID' T='ctl05' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <SharePoint:ScriptLink Name="highslide-with-html.js" runat="server" __designer:Error="Access to the path 'C:\Program Files\Common Files\Microsoft Shared\Web Server Extensions\12\Template\layouts\1033\highslide-with-html.js' is denied."/> <!--Placeholder for additional overrides--> <asp:ContentPlaceHolder id="PlaceHolderAdditionalPageHead" runat="server"/> </head> <body class="body" onload="javascript:_spBodyOnLoadWrapper();"> <WebPartPages:SPWebPartManager runat="server"/> <form runat="server" onsubmit="return _spFormOnSubmitWrapper();"> <table cellpadding="0" cellspacing="0" class="master"> <tr> <td height="100%" class="shadowLeft"> <div class="spacer"> </div> </td> <td valign="top"> <table cellpadding="0" cellspacing="0" width="100%" class="masterContent"> <tr style="height:0px"><td> <wssuc:DesignModeConsole id="IdDesignModeConsole" runat="server" __designer:Preview="&lt;span __designer:NonVisual=&quot;true&quot;&gt;[ DesignModeConsoleContainer &quot;DesignModeContainer&quot; ]&lt;/span&gt; " __designer:Values="&lt;P N='ID' ID='1' T='IdDesignModeConsole' /&gt;&lt;P N='TemplateControl' R='0' /&gt;"/></td></tr> <tr> <td colspan="2" class="authoringRegion"> <span class="siteActionMenu"> <PublishingSiteAction:SiteActionMenu runat="server" __designer:Preview=" &lt;!-- Begin Action Menu Markup --&gt; &lt;table height=100% class=&quot;ms-siteaction&quot; cellpadding=0 cellspacing=0&gt; &lt;tr&gt; &lt;td class=&quot;ms-siteactionsmenu&quot; id=&quot;siteactiontd&quot;&gt; &lt;span style=&quot;display:none&quot;&gt;&lt;menu type='ServerMenu' id=&quot;zz1_SiteActionsMenuMain&quot; largeIconMode=&quot;true&quot;&gt;&lt;ie:menuitem id=&quot;zz2_MenuItem_Create&quot; type=&quot;option&quot; iconSrc=&quot;/_layouts/images/Actionscreate.gif&quot; onMenuClick=&quot;window.location = '/_layouts/create.aspx';&quot; menuGroupId=&quot;100&quot;&gt;&lt;/ie:menuitem&gt;&lt;ie:menuitem id=&quot;zz3_MenuItem_Settings&quot; type=&quot;option&quot; iconSrc=&quot;/_layouts/images/ActionsSettings.gif&quot; onMenuClick=&quot;window.location = '/_layouts/settings.aspx';&quot; menuGroupId=&quot;100&quot;&gt;&lt;/ie:menuitem&gt;&lt;/menu&gt;&lt;/span&gt;&lt;div&gt;&lt;div&gt;&lt;span title=&quot;Open Menu&quot;&gt;&lt;div id=&quot;zz4_SiteActionsMenu_t&quot; class=&quot;&quot; onmouseover=&quot;MMU_PopMenuIfShowing(this);MMU_EcbTableMouseOverOut(this, true)&quot; hoverActive=&quot;ms-siteactionsmenuhover&quot; hoverInactive=&quot;&quot; onclick=&quot; MMU_Open(byid(''), MMU_GetMenuFromClientId('zz4_SiteActionsMenu'),event,false, null, 0);&quot; foa=&quot;MMU_GetMenuFromClientId('zz4_SiteActionsMenu')&quot; oncontextmenu=&quot;this.click(); return false;&quot; nowrap=&quot;nowrap&quot;&gt;&lt;a id=&quot;zz4_SiteActionsMenu&quot; accesskey=&quot;/&quot; href=&quot;#&quot; onclick=&quot;javascript:return false;&quot; style=&quot;cursor:pointer;white-space:nowrap;&quot; onfocus=&quot;MMU_EcbLinkOnFocusBlur(byid(''), this, true);&quot; onkeydown=&quot;MMU_EcbLinkOnKeyDown(byid(''), MMU_GetMenuFromClientId('zz4_SiteActionsMenu'), event);&quot; onclick=&quot; MMU_Open(byid(''), MMU_GetMenuFromClientId('zz4_SiteActionsMenu'),event,false, null, 0);&quot; oncontextmenu=&quot;this.click(); return false;&quot; menuTokenValues=&quot;MENUCLIENTID=zz4_SiteActionsMenu,TEMPLATECLIENTID=zz1_SiteActionsMenuMain&quot; serverclientid=&quot;zz4_SiteActionsMenu&quot;&gt;Site Actions&lt;img src=&quot;/_layouts/images/blank.gif&quot; border=&quot;0&quot; alt=&quot;Use SHIFT+ENTER to open the menu (new window).&quot;/&gt;&lt;/a&gt;&lt;img align=&quot;absbottom&quot; src=&quot;/_layouts/images/whitearrow.gif&quot; alt=&quot;&quot; /&gt;&lt;/div&gt;&lt;/span&gt;&lt;/div&gt;&lt;/div&gt; &lt;/td&gt; &lt;/tr&gt; &lt;/table&gt; &lt;!-- End Action Menu Markup --&gt; " __designer:Values="&lt;P N='TemplateControl' R='0' /&gt;"/> </span> <div class="sharepointLogin"> <!--Authentication for Authors only--> <table cellpadding="0" cellspacing="0" > <tr> <td class="ms-globallinks"> <SharePoint:DelegateControl ControlId="GlobalSiteLink1" Scope="Farm" runat="server" __designer:Preview="&lt;span style='padding-left:3px'&gt;&lt;/span&gt; &lt;a id=&quot;ctl00_ctl09_hlMySite&quot; href=&quot;http://litwaredemo:80/MySite/_layouts/MySite.aspx&quot;&gt;My Site&lt;/a&gt; &lt;span style='padding-left:4px;padding-right:3px'&gt;|&lt;/span&gt; " __designer:Values="&lt;P N='ControlId' T='GlobalSiteLink1' /&gt;&lt;P N='Scope' T='Farm' /&gt;&lt;P N='ID' T='ctl08' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/></td> <td class="ms-globallinks"> <SharePoint:DelegateControl ControlId="GlobalSiteLink2" Scope="Farm" runat="server" __designer:Preview="&lt;span id=&quot;ctl00_ctl11_MyLinksMenu&quot;&gt;&lt;span style=&quot;display:none&quot;&gt;&lt;menu type='ServerMenu' id=&quot;ctl00_ctl11_MyLinksMenuMenuTemplate&quot; largeIconMode=&quot;true&quot;&gt;&lt;/menu&gt;&lt;/span&gt;&lt;span title=&quot;Open Menu&quot;&gt;&lt;span id=&quot;ctl00_ctl11_MyLinksMenuMenu_t&quot; class=&quot;ms-SPLink ms-hovercellinactive&quot; onmouseover=&quot;MMU_PopMenuIfShowing(this);MMU_EcbTableMouseOverOut(this, true)&quot; hoverActive=&quot;ms-SPLink ms-hovercellactive&quot; hoverInactive=&quot;ms-SPLink ms-hovercellinactive&quot; onclick=&quot;javascript:FetchCallbackMenuItems(&amp;#39;ctl00_ctl11_MyLinksMenuMenuTemplate&amp;#39;); MMU_Open(byid('ctl00_ctl11_MyLinksMenuMenuTemplate'), MMU_GetMenuFromClientId('ctl00_ctl11_MyLinksMenuMenu'),event,true, null, 0);&quot; foa=&quot;MMU_GetMenuFromClientId('ctl00_ctl11_MyLinksMenuMenu')&quot; oncontextmenu=&quot;this.click(); return false;&quot; nowrap=&quot;nowrap&quot;&gt;&lt;a id=&quot;ctl00_ctl11_MyLinksMenuMenu&quot; accesskey=&quot;M&quot; href=&quot;#&quot; onclick=&quot;javascript:return false;&quot; style=&quot;cursor:pointer;white-space:nowrap;&quot; onfocus=&quot;MMU_EcbLinkOnFocusBlur(byid('ctl00_ctl11_MyLinksMenuMenuTemplate'), this, true);&quot; onkeydown=&quot;MMU_EcbLinkOnKeyDown(byid('ctl00_ctl11_MyLinksMenuMenuTemplate'), MMU_GetMenuFromClientId('ctl00_ctl11_MyLinksMenuMenu'), event);&quot; onclick=&quot;javascript:FetchCallbackMenuItems(&amp;#39;ctl00_ctl11_MyLinksMenuMenuTemplate&amp;#39;); MMU_Open(byid('ctl00_ctl11_MyLinksMenuMenuTemplate'), MMU_GetMenuFromClientId('ctl00_ctl11_MyLinksMenuMenu'),event,true, null, 0);&quot; oncontextmenu=&quot;this.click(); return false;&quot; menuTokenValues=&quot;MENUCLIENTID=ctl00_ctl11_MyLinksMenuMenu,TEMPLATECLIENTID=ctl00_ctl11_MyLinksMenuMenuTemplate&quot; serverclientid=&quot;ctl00_ctl11_MyLinksMenuMenu&quot;&gt;My Links&lt;img src=&quot;/_layouts/images/blank.gif&quot; border=&quot;0&quot; alt=&quot;Use SHIFT+ENTER to open the menu (new window).&quot;/&gt;&lt;/a&gt;&lt;img align=&quot;absbottom&quot; src=&quot;/_layouts/images/menudark.gif&quot; alt=&quot;&quot; /&gt;&lt;/span&gt;&lt;/span&gt;&lt;/span&gt;|" __designer:Values="&lt;P N='ControlId' T='GlobalSiteLink2' /&gt;&lt;P N='Scope' T='Farm' /&gt;&lt;P N='ID' T='ctl10' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/></td> <td class="ms-globallinks"> <wssuc:Welcome id="explitLogout" runat="server" __designer:Preview=" &lt;span style=&quot;display:none&quot;&gt;&lt;menu type='ServerMenu' id=&quot;zz5_ID_PersonalActionMenu&quot; largeIconMode=&quot;true&quot;&gt;&lt;ie:menuitem id=&quot;zz6_ID_PersonalInformation&quot; type=&quot;option&quot; iconSrc=&quot;/_layouts/images/menuprofile.gif&quot; onMenuClick=&quot;javascript:GoToPage('\u002f_layouts\u002fuserdisp.aspx?Force=True\u0026ID=' + _spUserId);return false;&quot; menuGroupId=&quot;100&quot;&gt;&lt;/ie:menuitem&gt;&lt;ie:menuitem id=&quot;zz7_ID_LoginAsDifferentUser&quot; type=&quot;option&quot; onMenuClick=&quot;javascript:LoginAsAnother('\u002f_layouts\u002fAccessDenied.aspx?loginasanotheruser=true', 0)&quot; menuGroupId=&quot;200&quot;&gt;&lt;/ie:menuitem&gt;&lt;ie:menuitem id=&quot;zz8_ID_RequestAccess&quot; type=&quot;option&quot; onMenuClick=&quot;window.location = '/_layouts/reqacc.aspx?type=list&amp;amp;name=%7B36F0105B%2D0F8E%2D4A22%2DBE90%2D716A51E97B5D%7D';&quot; menuGroupId=&quot;200&quot;&gt;&lt;/ie:menuitem&gt;&lt;ie:menuitem id=&quot;zz9_ID_Logout&quot; type=&quot;option&quot; onMenuClick=&quot;window.location = '/_layouts/SignOut.aspx';&quot; menuGroupId=&quot;200&quot;&gt;&lt;/ie:menuitem&gt;&lt;/menu&gt;&lt;/span&gt;&lt;span title=&quot;Open Menu&quot;&gt;&lt;div id=&quot;zz10_Menu_t&quot; class=&quot;ms-SPLink ms-SpLinkButtonInActive&quot; onmouseover=&quot;MMU_PopMenuIfShowing(this);MMU_EcbTableMouseOverOut(this, true)&quot; hoverActive=&quot;ms-SPLink ms-SpLinkButtonActive&quot; hoverInactive=&quot;ms-SPLink ms-SpLinkButtonInActive&quot; onclick=&quot; MMU_Open(byid(''), MMU_GetMenuFromClientId('zz10_Menu'),event,false, null, 0);&quot; foa=&quot;MMU_GetMenuFromClientId('zz10_Menu')&quot; oncontextmenu=&quot;this.click(); return false;&quot; nowrap=&quot;nowrap&quot;&gt;&lt;a id=&quot;zz10_Menu&quot; accesskey=&quot;L&quot; href=&quot;#&quot; onclick=&quot;javascript:return false;&quot; style=&quot;cursor:pointer;white-space:nowrap;&quot; onfocus=&quot;MMU_EcbLinkOnFocusBlur(byid(''), this, true);&quot; onkeydown=&quot;MMU_EcbLinkOnKeyDown(byid(''), MMU_GetMenuFromClientId('zz10_Menu'), event);&quot; onclick=&quot; MMU_Open(byid(''), MMU_GetMenuFromClientId('zz10_Menu'),event,false, null, 0);&quot; oncontextmenu=&quot;this.click(); return false;&quot; menuTokenValues=&quot;MENUCLIENTID=zz10_Menu,TEMPLATECLIENTID=zz5_ID_PersonalActionMenu&quot; serverclientid=&quot;zz10_Menu&quot;&gt;Welcome LitwareInc Administrator&lt;img src=&quot;/_layouts/images/blank.gif&quot; border=&quot;0&quot; alt=&quot;Use SHIFT+ENTER to open the menu (new window).&quot;/&gt;&lt;/a&gt;&lt;img align=&quot;absbottom&quot; src=&quot;/_layouts/images/menudark.gif&quot; alt=&quot;&quot; /&gt;&lt;/div&gt;&lt;/span&gt;&lt;script type=&quot;text/javascript&quot; language=&quot;javascript&quot;&gt;var _spUserId=1;&lt;/script&gt; &lt;a id=&quot;explitLogout_ExplicitLogin&quot; Href=&quot;_controltemplates/http://litwaredemo/_layouts/Authenticate.aspx&quot; style=&quot;display:none&quot;&gt;Sign In&lt;/a&gt; " __designer:Values="&lt;P N='ID' ID='1' T='explitLogout' /&gt;&lt;P N='TemplateControl' R='0' /&gt;"/></td> </tr> </table> </div> <div class="console"> <PublishingConsole:Console runat="server" __designer:Preview=" &lt;!-- Console --&gt; &lt;span id=&quot;ctl00_publishingContext1&quot;&gt;&lt;/span&gt; &lt;script type=&quot;text/javascript&quot; language=&quot;javascript&quot;&gt;if (document.getElementById('mpdmconsole')) { ShowConsoleBlockPaddingWithOverhang('mpLeftBackPadding', 'mpRightBackPadding', 'masterPageLeftOverhang', 'masterPageRightOverhang'); } &lt;/script&gt; &lt;!-- Console --&gt; " __designer:Values="&lt;P N='TemplateControl' R='0' /&gt;"/> </div> </td> </tr> <tr> <td colspan="2" > <table cellpadding="0" cellspacing="0" width="100%"> <tr> <td colspan="4" class="topArea"> <SharePoint:AspMenu ID="logoLinkId" runat="server" DataSourceID="SiteMapDataSourceRoot" StaticDisplayLevels="1" MaximumDynamicDisplayLevels="0" AccessKey="1" CssClass="logo" __designer:Preview="&lt;table id=&quot;zz12_logoLinkId&quot; class=&quot;logo&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot;&gt; &lt;tr id=&quot;zz12_logoLinkIdn0&quot;&gt; &lt;td&gt;&lt;table cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;width:100%;&quot;&gt;&lt;a Href=&quot;/Pages/Default.aspx&quot; accesskey=&quot;1&quot; style=&quot;text-decoration:none;&quot;&gt;Home&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;" __designer:Values="&lt;P N='ID' T='logoLinkId' /&gt;&lt;P N='MaximumDynamicDisplayLevels' T='0' /&gt;&lt;P N='DataSourceID' T='SiteMapDataSourceRoot' /&gt;&lt;P N='AccessKey' T='1' /&gt;&lt;P N='ControlStyle'&gt;&lt;P N='CssClass' ID='1' T='logo' /&gt;&lt;P N='Font' ID='2' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='CssClass' R='1' /&gt;&lt;P N='Font' R='2' /&gt;&lt;P N='Page' ID='3' /&gt;&lt;P N='TemplateControl' ID='4' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;" __designer:Templates="&lt;Group Name=&quot;Item Templates&quot;&gt;&lt;Template Name=&quot;StaticItemTemplate&quot; Flags=&quot;D&quot; Content=&quot;&quot; /&gt;&lt;Template Name=&quot;DynamicItemTemplate&quot; Flags=&quot;D&quot; Content=&quot;&quot; /&gt;&lt;/Group&gt;"/> <PublishingNavigation:PortalSiteMapDataSource ID="SiteMapDataSourceRoot" Runat="server" SiteMapProvider="CombinedNavSiteMapProvider" EnableViewState="true" StartFromCurrentNode="true" StartingNodeOffset="0" ShowStartingNode="true" __designer:Preview="&lt;table cellpadding=4 cellspacing=0 style=&quot;font:messagebox;color:buttontext;background-color:buttonface;border: solid 1px;border-top-color:buttonhighlight;border-left-color:buttonhighlight;border-bottom-color:buttonshadow;border-right-color:buttonshadow&quot;&gt; &lt;tr&gt;&lt;td nowrap&gt;&lt;span style=&quot;font-weight:bold&quot;&gt;PortalSiteMapDataSource&lt;/span&gt; - SiteMapDataSourceRoot&lt;/td&gt;&lt;/tr&gt; &lt;tr&gt;&lt;td&gt;&lt;/td&gt;&lt;/tr&gt; &lt;/table&gt;" __designer:Values="&lt;P N='ID' T='SiteMapDataSourceRoot' /&gt;&lt;P N='SiteMapProvider' T='CombinedNavSiteMapProvider' /&gt;&lt;P N='StartFromCurrentNode' T='True' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> <div class="topLinkBar"> <div class="topLink"> <PublishingVariations:VariationsLabelMenu id="labelmenu1" runat="server" __designer:Preview="&lt;span __designer:NonVisual=&quot;true&quot;&gt;&lt;table cellpadding=4 cellspacing=0 style=&quot;font:messagebox;color:buttontext;background-color:buttonface;border: solid 1px;border-top-color:buttonhighlight;border-left-color:buttonhighlight;border-bottom-color:buttonshadow;border-right-color:buttonshadow&quot;&gt; &lt;tr&gt;&lt;td nowrap&gt;&lt;span style=&quot;font-weight:bold&quot;&gt;VariationDataSource&lt;/span&gt; - LabelMenuDataSource&lt;/td&gt;&lt;/tr&gt; &lt;tr&gt;&lt;td&gt;&lt;/td&gt;&lt;/tr&gt; &lt;/table&gt;&lt;/span&gt; " __designer:Values="&lt;P N='ID' ID='1' T='labelmenu1' /&gt;&lt;P N='TemplateControl' R='0' /&gt;"/> </div> </div> </td> </tr> <tr class="topNavContainer"> <td class="topNavRoundLeft"> <div class="glassSpacerLeft" /> </td> <td valign="top" width="100%"> <SharePoint:AspMenu ID="GlobalNav" Runat="server" DataSourceID="SiteMapDataSource1" Orientation="Horizontal" StaticDisplayLevels="1" MaximumDynamicDisplayLevels="1" StaticSubMenuIndent="0" DynamicHorizontalOffset="0" DynamicVerticalOffset="-8" StaticEnableDefaultPopOutImage="false" ItemWrap="false" SkipLinkText="<%$Resources:cms,masterpages_skiplinktext%>" CssClass="topNav" __designer:Preview="&lt;table id=&quot;zz13_GlobalNav&quot; class=&quot;topNav&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot;&gt; &lt;tr&gt; &lt;td title=&quot;Document Center site&quot; id=&quot;zz13_GlobalNavn0&quot;&gt;&lt;table class=&quot;topNavItem&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;&quot;&gt;&lt;a class=&quot;topNavItem&quot; Href=&quot;/Docs&quot; style=&quot;text-decoration:none;border-style:none;&quot;&gt;Document Center&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td title=&quot;Company News Home&quot; id=&quot;zz13_GlobalNavn1&quot;&gt;&lt;table class=&quot;topNavItem&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;&quot;&gt;&lt;a class=&quot;topNavItem&quot; Href=&quot;/News/Pages/Default.aspx&quot; style=&quot;text-decoration:none;border-style:none;&quot;&gt;News&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td title=&quot;Report Center&quot; id=&quot;zz13_GlobalNavn2&quot;&gt;&lt;table class=&quot;topNavItem&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;&quot;&gt;&lt;a class=&quot;topNavItem&quot; Href=&quot;/Reports/Pages/Default.aspx&quot; style=&quot;text-decoration:none;border-style:none;&quot;&gt;Reports&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td title=&quot;The Search Center displays search results&quot; id=&quot;zz13_GlobalNavn3&quot;&gt;&lt;table class=&quot;topNavItem&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;&quot;&gt;&lt;a class=&quot;topNavItem&quot; Href=&quot;/SearchCenter/Pages/default.aspx&quot; style=&quot;text-decoration:none;border-style:none;&quot;&gt;Search&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt;&lt;td title=&quot;Site Directory web&quot; id=&quot;zz13_GlobalNavn4&quot;&gt;&lt;table class=&quot;topNavItem&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; border=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td style=&quot;white-space:nowrap;&quot;&gt;&lt;a class=&quot;topNavItem&quot; Href=&quot;/SiteDirectory/Pages/category.aspx&quot; style=&quot;text-decoration:none;border-style:none;&quot;&gt;Sites&lt;/a&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;&lt;/td&gt;&lt;td style=&quot;width:0px;&quot;&gt;&lt;/td&gt; &lt;/tr&gt; &lt;/table&gt;" __designer:Values="&lt;P N='ID' T='GlobalNav' /&gt;&lt;P N='DynamicHoverStyle'&gt;&lt;P N='CssClass' T='topNavFlyOutsHover' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='DynamicMenuItemStyle'&gt;&lt;P N='CssClass' T='topNavFlyOutsItem' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='DynamicMenuStyle'&gt;&lt;P N='CssClass' T='topNavFlyOuts' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='DynamicVerticalOffset' T='-8' /&gt;&lt;P N='MaximumDynamicDisplayLevels' T='1' /&gt;&lt;P N='Orientation' E='0' /&gt;&lt;P N='SkipLinkText' Bound='True' T='Resources:cms,masterpages_skiplinktext' /&gt;&lt;P N='StaticEnableDefaultPopOutImage' T='False' /&gt;&lt;P N='StaticHoverStyle'&gt;&lt;P N='CssClass' T='topNavHover' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='StaticMenuItemStyle'&gt;&lt;P N='CssClass' T='topNavItem' /&gt;&lt;P N='ItemSpacing' T='0px' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='StaticSelectedStyle'&gt;&lt;P N='CssClass' T='topNavSelected' /&gt;&lt;P N='ItemSpacing' T='0px' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='StaticSubMenuIndent' T='0px' /&gt;&lt;P N='DataSourceID' T='SiteMapDataSource1' /&gt;&lt;P N='ControlStyle'&gt;&lt;P N='CssClass' ID='1' T='topNav' /&gt;&lt;P N='Font' ID='2' /&gt;&lt;P N='IsEmpty' T='False' /&gt;&lt;/P&gt;&lt;P N='CssClass' R='1' /&gt;&lt;P N='Font' R='2' /&gt;&lt;P N='Page' ID='3' /&gt;&lt;P N='TemplateControl' ID='4' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;" __designer:Templates="&lt;Group Name=&quot;Item Templates&quot;&gt;&lt;Template Name=&quot;StaticItemTemplate&quot; Flags=&quot;D&quot; Content=&quot;&quot; /&gt;&lt;Template Name=&quot;DynamicItemTemplate&quot; Flags=&quot;D&quot; Content=&quot;&quot; /&gt;&lt;/Group&gt;"> <StaticMenuItemStyle CssClass="topNavItem" ItemSpacing="0"/> <StaticSelectedStyle CssClass="topNavSelected" ItemSpacing="0"/> <StaticHoverStyle CssClass="topNavHover"/> <DynamicMenuStyle CssClass="topNavFlyOuts" /> <DynamicMenuItemStyle CssClass="topNavFlyOutsItem" /> <DynamicHoverStyle CssClass="topNavFlyOutsHover"/> </SharePoint:AspMenu> <PublishingNavigation:PortalSiteMapDataSource ID="siteMapDataSource1" Runat="server" SiteMapProvider="CombinedNavSiteMapProvider" EnableViewState="true" StartFromCurrentNode="true" StartingNodeOffset="0" ShowStartingNode="false" TreatStartingNodeAsCurrent="true" TrimNonCurrentTypes="Heading" __designer:Preview="&lt;table cellpadding=4 cellspacing=0 style=&quot;font:messagebox;color:buttontext;background-color:buttonface;border: solid 1px;border-top-color:buttonhighlight;border-left-color:buttonhighlight;border-bottom-color:buttonshadow;border-right-color:buttonshadow&quot;&gt; &lt;tr&gt;&lt;td nowrap&gt;&lt;span style=&quot;font-weight:bold&quot;&gt;PortalSiteMapDataSource&lt;/span&gt; - siteMapDataSource1&lt;/td&gt;&lt;/tr&gt; &lt;tr&gt;&lt;td&gt;&lt;/td&gt;&lt;/tr&gt; &lt;/table&gt;" __designer:Values="&lt;P N='ID' T='siteMapDataSource1' /&gt;&lt;P N='SiteMapProvider' T='CombinedNavSiteMapProvider' /&gt;&lt;P N='StartFromCurrentNode' T='True' /&gt;&lt;P N='ShowStartingNode' T='False' /&gt;&lt;P N='TreatStartingNodeAsCurrent' T='True' /&gt;&lt;P N='TrimNonCurrentTypes' E='32' /&gt;&lt;P N='Page' ID='1' /&gt;&lt;P N='TemplateControl' ID='2' /&gt;&lt;P N='AppRelativeTemplateSourceDirectory' R='-1' /&gt;"/> </td> <td> <div class="search"> <asp:ContentPlaceHolder id="PlaceHolderSearchArea" runat="server"> <SPSWC:SearchBoxEx id="SearchBox" RegisterStyles="false" TextBeforeDropDown="" TextBeforeTextBox="<%$Resources:cms,masterpages_searchbox_label%>" TextBoxWidth="100" GoImageUrl="<% $SPUrl:~sitecollection/Style Library/Images/Search_Arrow.jpg %>" GoImageUrlRTL="<% $SPUrl:~sitecollection/Style Library/Images/Search_Arrow_RTL.jpg %>" UseSiteDefaults="true" DropDownMode = "HideScopeDD" SuppressWebPartChrome="true" runat="server" WebPart="true" __WebPartId="{7DECDCCA-FDA0-4739-8F0E-7B8DE48F0E0D}" __Preview="&lt;table TOPLEVEL border=&quot;0&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr&gt; &lt;td&gt;&lt;table border=&quot;0&quot; cellpadding=&quot;0&quot; cellspacing=&quot;0&quot; width=&quot;100%&quot;&gt; &lt;tr class=&quot;ms-WPHeader&quot;&gt; &lt;td title=&quot;&quot; id=&quot;WebPart

    Read the article

< Previous Page | 105 106 107 108 109 110 111 112 113 114 115 116  | Next Page >