Search Results

Search found 11167 results on 447 pages for 'financial close'.

Page 115/447 | < Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >

  • How should bug tracking and help tickets integrate?

    - by Max Schmeling
    I have a little experience with bug tracking systems such as FogBugz where help tickets are issues are (or can be) bugs, and I have some experience using a bug tracking system internally completely separate from a help center system. My question is, in a company with an existing (home-grown) help center system where replacing it is not an option, how should a bug tracking system (probably Mantis) be integrated into the process? Right now help tickets get put in for issues, questions, etc and they get assigned to the appropriate person (PC Tech, Help Desk staff, or if it's an application issue they can't solve in the help desk it gets assigned to a developer). A user can put a request for small modifications or fixes to an application in a help ticket and the developer it gets assigned to will make the change at some point, apply their time to that ticket, and then close the ticket when it goes to production. We don't currently have a bug tracking system, so I'm looking into the best way to integrate one. Should we just take the help tickets and put it into the bug tracking system if it's a bug (or issue or feature request) and then close the ticket if it's not an emergency fix? We probably don't want to expose the bug tracking system to anyone else as they wouldn't know what to put in the help center system and what to put in the bug tracker... right? Any thoughts? Suggestions? Tips? Advice? To-dos? Not to-dos? etc...

    Read the article

  • Payapl sandbox a/c in Dotnet..IPN Response Invaild

    - by Sam
    Hi, I am Integrating paypal to mysite.. i use sandbox account,One Buyer a/c and one more for seller a/c...and downloaded the below code from paypal site string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } and when add this snippets in pageload event of success page i get the ipn response as INVALID but amount paid successfully but i am getting invalid..any help..Paypal Docs in not Clear. thanks in advance

    Read the article

  • destroy cfwindow in javascript 'is not a function'

    - by Ryan French
    Hi All, Having an issue here that I have tried everything I can think of but cant get it to work. I have a page with a link that creates a cfwindow like so function create_window(ID){ var config = new Object(); config.modal=true; config.center=true; config.height=775; config.width=700; config.resizable=false; config.closable=false; config.draggable=false; config.refreshonshow=true; ColdFusion.Window.create('newWindow','Window Title', '/source/url'+ID, config) The window is created and the URL has the ID parsed to it that is used for displaying the correct item in the window. This all works fine. The problem is when I try and close the window and open a new window with a different item being displayed, the URL is not changed. I realise that this is because the window is being hidden, and not destroyed, and therefore it is the same window being opened. So I have created an onHide event handler to destroy the window like so. function showItemDetails(){ var ID=document.getElementById("sList").value create_window(ID); ColdFusion.Window.onHide('newWindow', refreshList); } function refreshList(){ ColdFusion.bindHandlerCache['sList'].call(); ColdFusion.Window.destroy('newWindow',true); } Now when I close the window Firebug is returning the error "ColdFusion.Window.destroy is not a function" (In IE the error is "Object doesn't support this property or method"). I have made sure we are running the latest version of ColdFusion 8.01 on the server (as I know that .destroy wasnt added until 8.01) and have applied the latest hotfixes to the server as well. Any ideas?

    Read the article

  • MS-Access: What could cause one form with a join query to load right and another not?

    - by Daniel Straight
    Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How can I terminate a system command with alarm in Perl?

    - by rockyurock
    I am running the below code snippet on Windows. The server starts listening continuously after reading from client. I want to terminate this command after a time period. If I use alarm() function call within main.pl, then it terminates the whole Perl program (here main.pl), so I called this system command by placing it in a separate Perl file and calling this Perl file (alarm.pl) in the original Perl File using the system command. But in this way I was unable to take the output of this system() call neither in the original Perl File nor in called one Perl File. Could anybody please let me know the way to terminate a system() call or take the output in that way I used above? main.pl my @output = system("alarm.pl"); print"one iperf completed\n"; open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; alarm.pl alarm 30; my @output_1 = readpipe("adb shell cd /data/app; ./iperf -u -s -p 5001"); open FILE, ">display.txt" or die $!; print FILE @output_1; close FILE; In both ways display.txt is always empty.

    Read the article

  • How does Subsonic handle connections?

    - by Quintin Par
    In Nhibernate you start a session by creating it during a BeginRequest and close at EndRequest public class Global: System.Web.HttpApplication { public static ISessionFactory SessionFactory = CreateSessionFactory(); protected static ISessionFactory CreateSessionFactory() { return new Configuration() .Configure(Path.Combine(AppDomain.CurrentDomain.BaseDirectory, "hibernate.cfg.xml")) .BuildSessionFactory(); } public static ISession CurrentSession { get{ return (ISession)HttpContext.Current.Items["current.session"]; } set { HttpContext.Current.Items["current.session"] = value; } } protected void Global() { BeginRequest += delegate { CurrentSession = SessionFactory.OpenSession(); }; EndRequest += delegate { if(CurrentSession != null) CurrentSession.Dispose(); }; } } What’s the equivalent in Subsonic? The way I understand, Nhibernate will close all the connections at endrequest. Reason: While trouble shooting some legacy code in a Subsonic project I get a lot of MySQL timeouts,suggesting that the code is not closing the connections MySql.Data.MySqlClient.MySqlException: error connecting: Timeout expired. The timeout period elapsed prior to obtaining a connection from the pool. This may have occurred because all pooled connections were in use and max pool size was reached. Generated: Tue, 11 Aug 2009 05:26:05 GMT System.Web.HttpUnhandledException: Exception of type 'System.Web.HttpUnhandledException' was thrown. --- MySql.Data.MySqlClient.MySqlException: error connecting: Timeout expired. The timeout period elapsed prior to obtaining a connection from the pool. This may have occurred because all pooled connections were in use and max pool size was reached. at MySql.Data.MySqlClient.MySqlPool.GetConnection() at MySql.Data.MySqlClient.MySqlConnection.Open() at SubSonic.MySqlDataProvider.CreateConnection(String newConnectionString) at SubSonic.MySqlDataProvider.CreateConnection() at SubSonic.AutomaticConnectionScope..ctor(DataProvider provider) at SubSonic.MySqlDataProvider.GetReader(QueryCommand qry) at SubSonic.DataService.GetReader(QueryCommand cmd) at SubSonic.ReadOnlyRecord`1.LoadByParam(String columnName, Object paramValue) My connection string is as follows <connectionStrings> <add name="xx" connectionString="Data Source=xx.net; Port=3306; Database=db; UID=dbuid; PWD=xx;Pooling=true;Max Pool Size=12;Min Pool Size=2;Connection Lifetime=60" /> </connectionStrings>

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

  • Paypal sandbox account in dotnet: "IPN Response invalid"

    - by Sam
    I am integrating Paypal with my website. I use a sandbox account, one buyer account and one seller account. I downloaded the code below from Paypal: string strSandbox = "https://www.sandbox.paypal.com/cgi-bin/webscr"; HttpWebRequest req = (HttpWebRequest)WebRequest.Create(strSandbox); //Set values for the request back req.Method = "POST"; req.ContentType = "application/x-www-form-urlencoded"; byte[] param = Request.BinaryRead(HttpContext.Current.Request.ContentLength); string strRequest = Encoding.ASCII.GetString(param); strRequest += "&cmd=_notify-validate"; req.ContentLength = strRequest.Length; //for proxy //WebProxy proxy = new WebProxy(new Uri("http://url:port#")); //req.Proxy = proxy; //Send the request to PayPal and get the response StreamWriter streamOut = new StreamWriter(req.GetRequestStream(), System.Text.Encoding.ASCII); streamOut.Write(strRequest); streamOut.Close(); StreamReader streamIn = new StreamReader(req.GetResponse().GetResponseStream()); string strResponse = streamIn.ReadToEnd(); streamIn.Close(); if (strResponse == "VERIFIED") { //check the payment_status is Completed //check that txn_id has not been previously processed //check that receiver_email is your Primary PayPal email //check that payment_amount/payment_currency are correct //process payment } else if (strResponse == "INVALID") { //log for manual investigation } else { //log response/ipn data for manual investigation } When I add this snippet in my pageload event of my success page, I show the IPN response as INVALID, but amount is paid successfully. Why is this? Paypal's docs are not clear.

    Read the article

  • Implementing IDisposable on a subclass when the parent also implements IDisposable

    - by Tanzelax
    I have a parent and child class that both need to implement IDisposable. Where should virtual (and base.Dispose()?) calls come into play? When I just override the Dispose(bool disposing) call, it feels really strange stating that I implement IDisposable without having an explicit Dispose() function (just utilizing the inherited one), but having everything else. What I had been doing (trivialized quite a bit): internal class FooBase : IDisposable { Socket baseSocket; private void SendNormalShutdown() { } public void Dispose() { Dispose(true); GC.SuppressFinalize(this); } private bool _disposed = false; protected virtual void Dispose(bool disposing) { if (!_disposed) { if (disposing) { SendNormalShutdown(); } baseSocket.Close(); } } ~FooBase() { Dispose(false); } } internal class Foo : FooBase, IDisposable { Socket extraSocket; private bool _disposed = false; protected override void Dispose(bool disposing) { if (!_disposed) { extraSocket.Close(); } base.Dispose(disposing); } ~Foo() { Dispose(false); } }

    Read the article

  • record output sound in python

    - by aaronstacy
    i want to programatically record sound coming out of my laptop in python. i found PyAudio and came up with the following program that accomplishes the task: import pyaudio, wave, sys chunk = 1024 FORMAT = pyaudio.paInt16 CHANNELS = 1 RATE = 44100 RECORD_SECONDS = 5 WAVE_OUTPUT_FILENAME = sys.argv[1] p = pyaudio.PyAudio() channel_map = (0, 1) stream_info = pyaudio.PaMacCoreStreamInfo( flags = pyaudio.PaMacCoreStreamInfo.paMacCorePlayNice, channel_map = channel_map) stream = p.open(format = FORMAT, rate = RATE, input = True, input_host_api_specific_stream_info = stream_info, channels = CHANNELS) all = [] for i in range(0, RATE / chunk * RECORD_SECONDS): data = stream.read(chunk) all.append(data) stream.close() p.terminate() data = ''.join(all) wf = wave.open(WAVE_OUTPUT_FILENAME, 'wb') wf.setnchannels(CHANNELS) wf.setsampwidth(p.get_sample_size(FORMAT)) wf.setframerate(RATE) wf.writeframes(data) wf.close() the problem is i have to connect the headphone jack to the microphone jack. i tried replacing these lines: input = True, input_host_api_specific_stream_info = stream_info, with these: output = True, output_host_api_specific_stream_info = stream_info, but then i get this error: Traceback (most recent call last): File "./test.py", line 25, in data = stream.read(chunk) File "/Library/Python/2.5/site-packages/pyaudio.py", line 562, in read paCanNotReadFromAnOutputOnlyStream) IOError: [Errno Not input stream] -9975 is there a way to instantiate the PyAudio stream so that it inputs from the computer's output and i don't have to connect the headphone jack to the microphone? is there a better way to go about this? i'd prefer to stick w/ a python app and avoid cocoa.

    Read the article

  • Writing to a new window with javascript... get access denied

    - by Søren
    Hello gurus :) I have been struggling with this for a while now, and decided it was time to ask for help. I am trying to create a print function on an aspx page, and I am using javascript to do this: function PrintContentCell() { var display_setting = "toolbar=yes, location=no, directories=yes, menubar=yes,"; display_setting += "scrollbars=yes, width=750, height=600, left=100, top=25"; var content_innerhtml = document.getElementById("testTable").innerHTML; var document_print = window.open("Loading.htm", "", display_setting); document_print.document.open(); document_print.document.write('<html><head><title>Print</title></head>'); document_print.document.write('<body style="font-family:verdana; font-size:12px;" onLoad="self.print();self.close();" >'); document_print.document.write(content_innerhtml); document_print.document.write('</body></html>'); document_print.print(); document_print.document.close(); return false; } I get "Access Denied" when the script tries to write to the new window. The Loading.htm file is just a very slim html document writing out the text "Loading...". I had hoped this would work after reading this thread: http://stackoverflow.com/questions/735136/ie-6-7-access-denied-trying-to-access-a-popup-window-document Anybody can help?

    Read the article

  • How can I control the action of onbeforeunload in IE?

    - by SpawnCxy
    Hi all I've got a problem about onbeforeunload recently that I need to pop up a voting page if the user try closes their IE browser.And I did it by using <body onbeforeunload="makevote()"> And the main structure of makevote() in javascript as follows: function makevote() { comet.distruct(); if(csid != null && isvote == null) { window.event.returnValue = false window.event.returnValue='press “cancel” to vote please!' showComDiv(popvote,"popiframe",400,120,'your vote here','dovote()'); } } For last three months this voting function performed so ugly that I got only less than 8,000 votes from more than 4,50,000 vistors.I think the problem is, when the users try to close their browsers,the onbeforeunload property pops up a comfirm box which covered my voting box while most users click the OK button,which means close comfirming is done,as a habit.So my question is how can I control the comfirming box made by onbeforeunload myself? So far I can only define the message it shows.For example if I click the "OK" ,I'll go to the voting box instead of closing my IE.And if there's any other better way to do this?Help would be greatly appreciated! Regards

    Read the article

  • Isolated storage misunderstand

    - by Costa
    Hi this is a discussion between me and me to understand isolated storage issue. can you help me to convince me about isolated storage!! This is a code written in windows form app (reader) that read the isolated storage of another win form app (writer) which is signed. where is the security if the reader can read the writer's file, I thought only signed code can access the file! If all .Net applications born equal and have all permissions to access Isolated storage, where is the security then? If I can install and run Exe from isolated storage, why I don't install a virus and run it, I am trusted to access this area. but the virus or what ever will not be trusted to access the rest of file system, it only can access the memory, and this is dangerous enough. I cannot see any difference between using app data folder to save the state and using isolated storage except a long nasty path!! I want to try give low trust to Reader code and retest, but they said "Isolated storage is actually created for giving low trusted application the right to save its state". Reader code: private void button1_Click(object sender, EventArgs e) { String path = @"C:\Documents and Settings\All Users\Application Data\IsolatedStorage\efv5cmbz.ewt\2ehuny0c.qvv\StrongName.5v3airc2lkv0onfrhsm2h3uiio35oarw\AssemFiles\toto12\ABC.txt"; StreamReader reader = new StreamReader(path); var test = reader.ReadLine(); reader.Close(); } Writer: private void button1_Click(object sender, EventArgs e) { IsolatedStorageFile isolatedFile = IsolatedStorageFile.GetMachineStoreForAssembly(); isolatedFile.CreateDirectory("toto12"); IsolatedStorageFileStream isolatedStorage = new IsolatedStorageFileStream(@"toto12\ABC.txt", System.IO.FileMode.Create, isolatedFile); StreamWriter writer = new StreamWriter(isolatedStorage); writer.WriteLine("Ana 2akol we ashrab kai a3eesh wa akbora"); writer.Close(); writer.Dispose(); }

    Read the article

  • ibatis problem using <isNull> whilst iterating over a List

    - by onoma
    Hi, I'm new to iBatis and I'm struggling with the and elements. I want to iterate over a List of Book instances (say) that are passed in as a HashMap: MyParameters. The list will be called listOfBooks. The clause of the overall SQL statement will therefore look like this: <iterate prepend="AND" property="MyParameters.listOfBooks" conjunction="AND" open="(" close=")"> ... </iterate> I also need to produce different SQL within the iterate elements depending on whether a property of each Book instance in the 'listOfBooks' List is null, or not. So, I need a statement something like this: <iterate prepend="AND" property="MyParameters.listOfBooks" conjunction="AND" open="(" close=")"> <isNull property="MyParameter.listOfBooks.title"> <!-- SQL clause #1 here --> </isNull> <isNotNull property="MyParameter.listOfBooks.title"> <!-- SQL clause #2 here --> </isNotNull> When I do this I get an error message stating that there is no "READABLE" property named 'title' in my Book class. However, each Book instance does contain a title property, so I'm confused! I can only assuem that I have managled the syntax in trying to pinpoint the title of particular Book instance in listOfBooks. I'm struggling to find the correct technique for trying to achieve this. If anyone can advise a way forward I'd be grateful. Thanks

    Read the article

  • Perl program - Dynamic Bootstrapping code

    - by mgj
    Hi.. I need to understand the working of this particular program, It seems to be quite complicated, could you please see if you could help me understanding what this program in Perl does, I am a beginner so I hardly can understand whats happening in the code given on the following link below, Any kind of guidance or insights wrt this program is highly appreciated. Thank you...:) This program is called premove.pl.c Its associated with one more program premove.pl, Its code looks like this: #!perl open (newdata,">newdata.txt") || die("cant create new file\n");#create passwd file $linedata = ""; while($line=<>){ chomp($line); #chop($line); print newdata $line."\n"; } close(newdata); close(olddata); __END__ I am even not sure how to run the two programs mentioned here. I wonder also what does the extension of the first program signify as it has "pl.c" extension, please let me know if you know what it could mean. I need to understand it asap thats why I am posting this question, I am kind of short of time else I would try to figure it out myself, This seems to be a complex program for a beginner like me, hope you understand. Thank you again for your time.

    Read the article

  • display sqlite datatable in a jtable

    - by tuxou
    Hi I'm trying to display an sqlite data table in a jtable but i have an error " sqlite is type forward only" how could I display it in a jtable try { long start = System.currentTimeMillis(); Statement state = ConnectionBd.getInstance().createStatement( ResultSet.TYPE_SCROLL_INSENSITIVE, ResultSet.CONCUR_READ_ONLY ); ResultSet res = state.executeQuery("SELECT * FROM data"); ResultSetMetaData meta = res.getMetaData(); Object[] column = new Object[meta.getColumnCount()]; for(int i = 1 ; i <= meta.getColumnCount(); i++){ column[i-1] = meta.getColumnName(i); } res.last(); int rowCount = res.getRow(); Object[][] data = new Object[res.getRow()][meta.getColumnCount()]; res.beforeFirst(); int j = 1; while(res.next()){ for(int i = 1 ; i <= meta.getColumnCount(); i++) data[j-1][i-1] = res.getObject(i); j++; } res.close(); state.close(); long totalTime = System.currentTimeMillis() - start; result.removeAll(); result.add(new JScrollPane(new JTable(data, column)), BorderLayout.CENTER); result.add(new JLabel("execute in " + totalTime + " ms and has " + rowCount + " ligne(s)"), BorderLayout.SOUTH); result.revalidate(); } catch (SQLException e) { result.removeAll(); result.add(new JScrollPane(new JTable()), BorderLayout.CENTER); result.revalidate(); JOptionPane.showMessageDialog(null, e.getMessage(), "ERREUR ! ", JOptionPane.ERROR_MESSAGE); } thank you

    Read the article

  • In Java, send commands to another command-line program

    - by bradvido
    I am using Java on Windows XP and want to be able to send commands to another program such as telnet. I do not want to simply execute another program. I want to execute it, and then send it a sequence of commands once it's running. Here's my code of what I want to do, but it does not work: (If you uncomment and change the command to "cmd" it works as expected. Please help.) try { Runtime rt = Runtime.getRuntime(); String command = "telnet"; //command = "cmd"; Process pr = rt.exec(command); BufferedReader processOutput = new BufferedReader(new InputStreamReader(pr.getInputStream())); BufferedWriter processInput = new BufferedWriter(new OutputStreamWriter(pr.getOutputStream())); String commandToSend = "open localhost\n"; //commandToSend = "dir\n" + "exit\n"; processInput.write(commandToSend); processInput.flush(); int lineCounter = 0; while(true) { String line = processOutput.readLine(); if(line == null) break; System.out.println(++lineCounter + ": " + line); } processInput.close(); processOutput.close(); pr.waitFor(); } catch(Exception x) { x.printStackTrace(); }

    Read the article

  • how can load images from plist in to UITableView ?

    - by srikanth rongali
    I have stored the videos and the thumbnail images of the videos in Documents folder. And I have given the path in plist. In plist I took an array and I added directories to the array. And in the dictionary I stored the image path /Users/srikanth/Library/Application Support/iPhone Simulator/User/Applications/9E6E8B22-C946-4442-9209-75BB0E924434/Documents/image1 for key imagePath. for video /Users/srikanth/Library/Application Support/iPhone Simulator/User/Applications/9E6E8B22-C946-4442-9209-75BB0E924434/Documents/video1.mp4 for key filePath. I used following code but it is not working. I am trying only for images. I need the images to be loaded in the table in each cell. - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:CellIdentifier] autorelease]; [cell setAccessoryType:UITableViewCellAccessoryDetailDisclosureButton]; UIImageView *image2 = [[UIImageView alloc]init]; image2.frame = CGRectMake(0.0f, 0.0f, 80.0f, 80.0f); image2.backgroundColor = [UIColor clearColor]; //image2.image = [UIImage imageNamed:@"snook.png"]; image2.tag = tag7; } NSDictionary *dictOfplist = [cells objectAtIndex:indexPath.row]; [(UIImageView *)[cell viewWithTag:tag7] setImage:[dictOfplist objectForKey:@"imagePath"]]; return cell; } - (void)viewDidLoad { [super viewDidLoad]; self.title = @"Library"; self.navigationItem.rightBarButtonItem = [[UIBarButtonItem alloc] initWithTitle:@"Close" style:UIBarButtonItemStyleBordered target:self action:@selector(close:)]; NSString* plistPath = [[NSBundle mainBundle] pathForResource:@"details" ofType:@"plist"]; contentArray = [NSArray arrayWithContentsOfFile:plistPath]; cells = [[NSMutableArray alloc]initWithCapacity:[contentArray count]]; for(dCount = 0; dCount < [contentArray count]; dCount++) [cells addObject:[contentArray objectAtIndex:dCount]]; } How can I make this work. Thank you.

    Read the article

  • add new option to dropdownlist after jquery dialog and post

    - by RememberME
    I have a form to enter subcontracts. On this form I have a dropdownlist of all companies in the system. Next to it is a button "Create Company". This button opens a jquery dialog which allows the user to create a new company. Once the dialog closes, the new company needs to be added to the dropdownlist and selected. If I refresh, it's there, but I need to do it without refreshing the form b/c I don't want the user to loose everything that they've entered into the other fields. I'm not sure how to do this b/c I don't have the guid of the new company. My jquery dialog: $('#popupCreateCompany').dialog( { autoOpen: false, modal: true, buttons: { 'Add': function() { var dialog = $(this); var form = dialog.find('input:text, select'); $.post('/company/create', $(form).serialize(), function() { dialog.dialog('close'); }) }, 'Cancel': function() { $(this).dialog('close'); } } }); $("#create-company").click(function() { $('#popupCreateCompany').dialog('open'); }); Company field: <label for="company">Company:</label> <%= Html.DropDownList("company", Model.SelectCompanies, "** Select Company **") %> <%= Html.ValidationMessage("Company", "*") %> <button type="button" id="create-company" >Create Company</button>

    Read the article

  • C# Error reading two dates from a binary file

    - by Jamie
    Hi all, When reading two dates from a binary file I'm seeing the error below: "The output char buffer is too small to contain the decoded characters, encoding 'Unicode (UTF-8)' fallback 'System.Text.DecoderReplacementFallback'. Parameter name: chars" My code is below: static DateTime[] ReadDates() { System.IO.FileStream appData = new System.IO.FileStream( appDataFile, System.IO.FileMode.Open, System.IO.FileAccess.Read); List<DateTime> result = new List<DateTime>(); using (System.IO.BinaryReader br = new System.IO.BinaryReader(appData)) { while (br.PeekChar() > 0) { result.Add(new DateTime(br.ReadInt64())); } br.Close(); } return result.ToArray(); } static void WriteDates(IEnumerable<DateTime> dates) { System.IO.FileStream appData = new System.IO.FileStream( appDataFile, System.IO.FileMode.Create, System.IO.FileAccess.Write); List<DateTime> result = new List<DateTime>(); using (System.IO.BinaryWriter bw = new System.IO.BinaryWriter(appData)) { foreach (DateTime date in dates) bw.Write(date.Ticks); bw.Close(); } } What could be the cause? Thanks

    Read the article

  • Issue with CAAnimation and CALayer Transforms

    - by Brian
    I have a CALayer that I want to animate across the screen. I have created two methods: one slide open the layer and one to slide close. These both work by assigning a property to the layer's transform property. Now I want to use a CAKeyFrameAnimation to slide open the layer. I got this working so the layer slides open, but now I can't slide the layer close using my old method. I am trying to figure out why this is. Any help would be great. Code: - (id)init { if( self = [super init] ) { bIsOpen = NO; closeTransform = self.transform; openTransform = CATransform3DMakeTranslation(-235.0, 0.0, 0.0); } return self; } - (void)closeMenu { if( bIsOpen ) { self.transform = closeTransform; bIsOpen = !bIsOpen; } } - (void)openMenu { if( !bIsOpen ) { CAKeyframeAnimation *closeAnimation = [CAKeyframeAnimation animationWithKeyPath:@"transform"]; closeAnimation.duration = 1.0; closeAnimation.removedOnCompletion = NO; closeAnimation.fillMode = kCAFillModeForwards; closeAnimation.values = [NSArray arrayWithObjects:[NSValue valueWithCATransform3D:closeTransform],[NSValue valueWithCATransform3D:openTransform],nil]; closeAnimation.timingFunctions = [NSArray arrayWithObject:[CAMediaTimingFunction functionWithName:kCAMediaTimingFunctionLinear]]; [self addAnimation:closeAnimation forKey:@"transform"]; bIsOpen = !bIsOpen; } }

    Read the article

  • Excel Reader ASP.NET

    - by user304429
    I declared a DataGrid in a ASP.NET View and I'd like to generate some C# code to populate said DataGrid with an Excel spreadsheet (.xlsx). Here's the code I have: <asp:DataGrid id="DataGrid1" runat="server"/> <script language="C#" runat="server"> protected void Page_Load(object sender, EventArgs e) { string connString = @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=c:\FileName.xlsx;Extended Properties=""Excel 12.0;HDR=YES;"""; // Create the connection object OleDbConnection oledbConn = new OleDbConnection(connString); try { // Open connection oledbConn.Open(); // Create OleDbCommand object and select data from worksheet Sheet1 OleDbCommand cmd = new OleDbCommand("SELECT * FROM [sheetname$]", oledbConn); // Create new OleDbDataAdapter OleDbDataAdapter oleda = new OleDbDataAdapter(); oleda.SelectCommand = cmd; // Create a DataSet which will hold the data extracted from the worksheet. DataSet ds = new DataSet(); // Fill the DataSet from the data extracted from the worksheet. oleda.Fill(ds, "Something"); // Bind the data to the GridView DataGrid1.DataSource = ds.Tables[0].DefaultView; DataGrid1.DataBind(); } catch { } finally { // Close connection oledbConn.Close(); } } </script> When I run the website, nothing really happens. What gives?

    Read the article

  • Java - Save video stream from Socket to File

    - by Alex
    I use my Android application for streaming video from phone camera to my PC Server and need to save them into file on HDD. So, file created and stream successfully saved, but the resulting file can not play with any video player (GOM, KMP, Windows Media Player, VLC etc.) - no picture, no sound, only playback errors. I tested my Android application into phone and may say that in this instance captured video successfully stored on phone SD card and after transfer it to PC played witout errors, so, my code is correct. In the end, I realized that the problem in the video container: data streamed from phone in MP4 format and stored in *.mp4 files on PC, and in this case, file may be incorrect for playback with video players. Can anyone suggest how to correctly save streaming video to a file? There is my code that process and store stream data (without errors handling to simplify): // getOutputMediaFile() returns a new File object DataInputStream in = new DataInputStream (server.getInputStream()); FileOutputStream videoFile = new FileOutputStream(getOutputMediaFile()); int len; byte buffer[] = new byte[8192]; while((len = in.read(buffer)) != -1) { videoFile.write(buffer, 0, len); } videoFile.close(); server.close(); Also, I would appreciate if someone will talk about the possible "pitfalls" in dealing with the conservation of media streams. Thank you, I hope for your help! Alex.

    Read the article

  • C#,coding with AES

    - by lolalola
    Hi, why i can coding only 128 bytes text? Work: string plainText = "1234567890123456"; Don't work: string plainText = "12345678901234561"; Don't work: string plainText = "123456789012345"; string plainText = "1234567890123456"; byte[] plainTextBytes = Encoding.UTF8.GetBytes(plainText); byte[] keyBytes = System.Text.Encoding.UTF8.GetBytes("1234567890123456"); byte[] initVectorBytes = System.Text.Encoding.UTF8.GetBytes("1234567890123456"); RijndaelManaged symmetricKey = new RijndaelManaged(); symmetricKey.Mode = CipherMode.CBC; symmetricKey.Padding = PaddingMode.Zeros; ICryptoTransform encryptor = symmetricKey.CreateDecryptor(keyBytes, initVectorBytes); MemoryStream memoryStream = new MemoryStream(); CryptoStream cryptoStream = new CryptoStream(memoryStream, encryptor, CryptoStreamMode.Write); cryptoStream.Write(plainTextBytes, 0, plainTextBytes.Length); cryptoStream.FlushFinalBlock(); byte[] cipherTextBytes = memoryStream.ToArray(); memoryStream.Close(); cryptoStream.Close(); string cipherText = Convert.ToBase64String(cipherTextBytes); Console.ReadLine();

    Read the article

< Previous Page | 111 112 113 114 115 116 117 118 119 120 121 122  | Next Page >