Search Results

Search found 9282 results on 372 pages for 'complete'.

Page 116/372 | < Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >

  • Same keyword for two purposes in java? [closed]

    - by gurukulki
    Possible Duplicates: Same keyword for two purposes in java? Same keyword for two purposes in java? As we use "default" keyword as a access specifier, and it can be used in switch statements as well with complete different purpose, So i was curious that is there any other keywords in java which can be used in more then one purposes

    Read the article

  • How to keep iPhone app out of iPad store?

    - by Eric
    I have an iPhone app that I have started to turn into a universal app, however the process is not complete and I want to release an update to the iPhone version. I know that you can specify device capabilities in the Info.plist file to restrict your app to certain devices, but how can I do this to prevent the unfinished universal version from appearing in the iPad store? Is checking the LSRequiresiPhoneOS BOOL entry (in the Info.plist file) enough? Thanks!

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Exploded (unpacked) EAR vs. Packaged EAR file?

    - by Adam
    In my office we use exploded EAR's (and inside them exploded WAR directories) for our test environments, and then a packaged one for production. I've yet to find a good explanation of the reason behind this though. I understand it's easier from a deployment perspective to push out a single file during builds, but it prevents us from doing things like property file changes without doing complete rebuilds (we could skip the compiles, but our environment currently binds the compile and jar processes together). What are the major advantages / disadvantages between these two configurations?

    Read the article

  • How to apply css locally on any online page?

    - by metal-gear-solid
    For testing I don't want to upload css to FTP on each change till site complete , but site and content is online. (i'm not talking about saving page locally then apply css) Can i just apply css locally to any online page. it would be easier to edit and see changes locally till css work end. and i want to see applied effect on FF and IE. How to do that? Is it possible.

    Read the article

  • Unique_ptr compiler errors

    - by Godric Seer
    I am designing and entity-component system for a project, and C++ memory management is giving me a few issues. I just want to make sure my design is legitimate. So to start I have an Entity class which stores a vector of Components: class Entity { private: std::vector<std::unique_ptr<Component> > components; public: Entity() { }; void AddComponent(Component* component) { this -> components.push_back(std::unique_ptr<Component>(component)); } ~Entity(); }; Which if I am not mistaken means that when the destructor is called (even the default, compiler created one), the destructor for the Entity, will call ~components, which will call ~std::unique_ptr for each element in the vector, and lead to the destruction of each Component, which is what I want. The component class has virtual methods, but the important part is its constructor: Component::Component(Entity parent) { parent.addComponent(this) // I am not sure if this would work like I expect // Other things here } As long as passing this to the method works, this also does what I want. My confusion is in the factory. What I want to do is something along the lines of: std::shared_ptr<Entity> createEntity() { std::shared_ptr<Entity> entityPtr(new Entity()); new Component(*parent); // Initialize more, and other types of Components return entityPtr; } Now, I believe that this setup will leave the ownership of the Component in the hands of its Parent Entity, which is what I want. First a small question, do I need to pass the entity into the Component constructor by reference or pointer or something? If I understand C++, it would pass by value, which means it gets copied, and the copied entity would die at the end of the constructor. The second, and main question is that code based on this sample will not compile. The complete error is too large to print here, however I think I know somewhat of what is going on. The compiler's error says I can't delete an incomplete type. My Component class has a purely virtual destructor with an implementation: inline Component::~Component() { }; at the end of the header. However since the whole point is that Component is actually an interface. I know from here that a complete type is required for unique_ptr destruction. The question is, how do I work around this? For reference I am using gcc 4.4.6.

    Read the article

  • rails backgroundjob running jobs in parallel?

    - by Damir Horvat
    I'm very happy with By so far, only I have this one issue: When one process takes 1 or 2 hours to complete, all other jobs in the queue seem to wait for that one job to finish. Worse still is when uploading to a server which time's out regularly. My question: is Bj running jobs in parallel or one after another? Thank you, Damir

    Read the article

  • SQLAlchemy - select for update example

    - by Mark
    I'm looking for a complete example of using select for update in SQLAlchemy, but haven't found one googling. I need to lock a single row and update a column, the following code doesn't work (blocks forever): s = table.select(table.c.user=="test",for_update=True) u = table.update().where(table.c.user=="test") u.execute(email="foo") Do I need a commit? How do I do that? As far as I know you need to: begin transaction select ... for update update commit

    Read the article

  • Code Contracts Vs. Object Initializers (.net 4.0)

    - by Mystagogue
    At face value, it would seem that object initializers present a problem for .net 4.0 "code contracts", where normally the invariant should be established by the time the object constructor is finished. Presumably, however, object-initializers require properties to be set after construction is complete. My question is if the invariants of "code contracts" are able to handle object initializers, "as if" the properties were set before the constructor completes? That would be very nice indeed!!

    Read the article

  • Is it possible to download a .zip file into iPhone when user clicks a link inside UIWebView?

    - by Horace Ho
    In a new app, I plan to let users download their own files and stored them inside iPhone. The process is typically: iPhone present a web page by UIWebView, in which there are several links to .zip files the user browser the page and click on one of the .zip file link iPhone downloads the file into the iPhone document folder, closes WebView, acknowledges the user when download is complete How can that be done? Thanks

    Read the article

  • Where can I find a good software implementation plan template?

    - by Corpsekicker
    This is not "programming" related as much as it is "software engineering" related. I am required to produce an implementation for additional functionality to a complete system. All I am armed with is knowledge of the existing architecture and a functional spec with visual requirements, user stories and use cases. Is there a standardised way to go about this? I suck at documentation.

    Read the article

  • How to add django modules to pydiction dictionary?

    - by speck
    I'm trying to use pydiction to autocomplete Python/Django statements in VIM Editor. When I try to add django modules to complete-dic using this: python pydiction.py /usr/lib/pymodules/python2.6/django or: python pydiction.py /usr/lib/pymodules/python2.6/django/__init__.py I receive this error: Couldn't import: (...). Import by filename is not supported. Thanks! Pydiction: http://www.vim.org/scripts/script.php?script_id=850

    Read the article

  • Auto-Completion in Unix VI editor

    - by IllustratedInsomnia
    Hey guys, after using graphical IDE's like Visual Studio, I'm used to pressing CTRL+Space to auto-complete a variable or function name. Now, I know such a thing isn't completely possible in VI, but I heard there was a list of commands that could be mapped that allowed automatic completion of variables and functions in the current file opened. Does anyone know what this sequence is? Thanks in advance.

    Read the article

  • Consuming and Provide webservice to client

    - by Jason
    Hi, I got a requirement to implement a website in java which will utilize another web service. Here is the scenario I am providing the product compare results to client and assume i am using amazon and other web services. Initially client invoke our web service and then we fetch results from merchants. I don't want complete solution just look for consuming and create web service in java example. I searched on google but couldn't found relevant example. I prefer if example is using eclipse :) Thanks

    Read the article

  • Restoring older firmware through XCode?

    - by Moshe
    I'm trying to restore iPhone OS 3.1.3 to a 3GS that has been upgraded to iOS 4. iTunes refuses to complete the install. What needs to be done? I am currently using the GM XCode. Should I be using the latest public stable version instead? Update: XCode reports that "The baseband cannot be rolled back".

    Read the article

  • linking c++ sources in iPhone project

    - by Steve918
    I have a single cpp file added to my iPhone project with a .cpp extension, but I'm seeing errors when linking like: operator new[](unsigned long)", referenced from: ___gxx_personality_sj0", referenced from: I thought as long as I named the cpp files with .cpp or .mm it would do the right thing, do I need to add some linker flags? Update: Complete Build log: http://dpaste.org/tXAy/ The C++ code: unzip.h unzip.cpp

    Read the article

  • Free version control services?

    - by thr
    What free version control service would you recommend? I'm not looking for a complete project management service like Sourceforge, just something so I don't have to run a SVN/GIT server myself.

    Read the article

  • Best editor for CodeIgniter?

    - by Rismo
    I'm learning CodeIgniter and I come from Microsoft Visual Studio so I'm used to the auto complete feature. I've been using notepad++ so far but I wonder if anyone knows an editor that works better with CodeIgniter. I would love to see features like: Right-click - Add new model Right-click - Add new view Autocomplete with CodeIgniter helpers and libraries

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • Python urllib.urlopen() call doesn't work with a URL that a browser accepts

    - by Charles Anderson
    If I point Firefox at http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes, I get a page of HTML. But if I try this in Python: import urllib site = 'http://bitbucket.org/tortoisehg/stable/wiki/Home/ReleaseNotes' req = urllib.urlopen(site) text = req.read() I get the following: 500 Internal Server Error The server encountered an internal error or misconfiguration and was unable to complete your request. What am I doing wrong?

    Read the article

< Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >