Search Results

Search found 9417 results on 377 pages for 'auth module'.

Page 117/377 | < Previous Page | 113 114 115 116 117 118 119 120 121 122 123 124  | Next Page >

  • Use symfony 1.4 without changing apache configuration

    - by aRagnis
    Is it possible to set the /web directory as webroot whithout changing apache configuration file? I tried using the following .htaccess code, but if i go to localhost/module/, it displays 404 error. But if i go to localhost/web/module/ then everything works. <IfModule mod_rewrite.c> RewriteEngine on RewriteRule sf/(.*) lib/vendor/symfony/data/web/sf/$1 [L] RewriteRule ^$ web/ [L] RewriteRule (.*) web/$1 [L] </IfModule>

    Read the article

  • DotNetOpenAuth for previously authorized site

    - by Burke Holland
    I've had great luck with DotNetOpenAuth to do 3 legged authorization. Currently, I am connecting and pulling in some Google data. My question is that apparently, if you have already auth'd my web application to your Google account, when I call var accessTokenResponse = google.ProcessUserAuthorization(); It basically does nothing. How do I get the token for an account that has already auth'd my application? I see no callback of any kind. I'm chocking this up to my ignorance about OAuth in general.

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • How to write a custom (odd) authentication plugins for Wordpress, Joomla and MediaWiki

    - by Bart van Heukelom
    On our network (a group of related websites - not a LAN) we have a common authentication system which works like this: On a network site ("consumer") the user clicks on a login link This redirects the user to a login page on our auth system ("RAS"). Upon successful login the user is directed back to the consumer site. Extra data is passed in the query string. This extra data does not include any information about the user yet. The consumer site's backend contacts RAS to get the information about the logged in user. So as you can see, the consumer site knows nothing about the authentication method. It doesn't know if it's by username/password, fingerprint, smartcard, or winning a game of poker. This is the main problem I'm encountering when trying to find out how I could write custom authentication plugins for these packages, acting as consumer sites: Wordpress Joomla MediaWiki For example Joomla offers a pretty simple auth plugin system, but it depends on a username/password entered on the Joomla site. Any hints on where to start?

    Read the article

  • Cannot resolve view when view is in subdirectory

    - by devzero
    We have a MVC 2.0 / c# 4.0 application that we develop visual studio. We have a part of the site (admin) that we have put in it's own sub directory and with its own routing rules: routes.Add("DomainRoute", new DomainRoute( ConfigurationManager.AppSettings["adminDomain"], // Domain with parameters "{controller}/{action}/{id}", // URL with parameters new { controller = "AdminPage", action = "Admin", id = "", isAdmin = true } We have all the views for the admin site inside an admin sub folder so that you get paths like: \views\admin\auth\login.aspx In the \controllers\admin\authController.aspx file I have a function called login: public ActionResult Login() { return View(); } This works just as it should, ie if i go admin.localhost\auth\login I go to the login page. But if I do a right click in visual studio and "go to view" i get an error "unable to go to matching view". Is there anyway to solve this?

    Read the article

  • django + xmppy: send a message to two recipients

    - by Agrajag
    I'm trying to use xmpppy for sending jabber-messages from a django-website. This works entirely fine. However, the message only gets sent to the -first- of the recipients in the list. This happens when I run the following function from django, and also if I run it from an interactive python-shell. The weird part though, is that if I extract the -body- of the function and run that interactively, then all the recipients (there's just 2 at the moment) get the message. Also, I do know that the inner for-loop gets run the correct count times (2), because the print-statement does run twice, and return two different message-ids. The function looks like this: def hello_jabber(request, text): jid=xmpp.protocol.JID(settings.JABBER_ID) cl=xmpp.Client(jid.getDomain(),debug=[]) con=cl.connect() auth=cl.auth(jid.getNode(),settings.JABBER_PW,resource=jid.getResource()) for friend in settings.JABBER_FRIENDS: id=cl.send(xmpp.protocol.Message(friend,friend + ' is awesome:' + text)) print 'sent message with id ' + str(id) cl.disconnect() return render_to_response('jabber/sent.htm', locals())

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • Porting WebSphere code to get remote credentials to Tomcat

    - by Glenn Lawrence
    I have been asked to look into porting some code from a web app under IBM WAS 7 so that it will run under Tomcat 7. This is part of a larger SPNEGO/Kerberos SSO system but for purposes of discussion I have distilled the code down to the following that shows the dependencies on the two WebSphere classes AccessController and WSSubject: GSSCredential clientCreds = (GSSCredential) com.ibm.ws.security.util.AccessController.doPrivileged(new java.security.PrivilegedAction() { public Object run() { javax.security.auth.Subject subject = com.ibm.websphere.security.auth.WSSubject.getCallerSubject(); GSSCredential clientCreds = (GSSCredential) subject.getPrivateCredentials(GSSCredential.class).iterator().next(); return clientCreds; } }); I'd like to be able to do this in Tomcat.

    Read the article

  • Omniauth + Pow Issue

    - by neon
    I am having a strange issue with Pow and Omniauth. Omniauth (Facebook Login) works fine when using localhost:3000, but when using Pow (appname.dev) things get fishy. Users are taken through the redirect and properly created if they don't exist in the database, as they should be. After this, however, they are redirected to the root_path and not signed in. Their record is saved in the database as expected, but sign in does not occur. Again, this is only happening on Pow (and lvh.me), and not on localhost. Any ideas? I am using the Devise/Omniauth approach for sign-in, and the controller code looks like this: def facebook @user = User.find_for_facebook_oauth(request.env["omniauth.auth"], current_user) if @user.persisted? flash[:notice] = I18n.t "devise.omniauth_callbacks.success", :kind => "Facebook" sign_in_and_redirect @user, :event => :authentication else session["devise.facebook_data"] = request.env["omniauth.auth"] redirect_to new_user_registration_url end end Again, the user is persisted but there is no flash notice or sign_in that occurs when using POW.

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • Is it possible to expose an API for my own WebSite ... but use oAuth for the api authentication?

    - by Pure.Krome
    Hi Folks, currently I expose an api for my website. Works great .. and i use Basic Authentication to authenticate users to get access to the data. eg. http://www.MyWebSite.com <-- main site. http://api.MyWebSite.com <-- my api website. sample api RESTful url http://user1:[email protected]/games?type=battlefield2 (yes yes i know browsers stop people from putting in user1:pass1 (Basic Auth) into the url directly .. cause of security . but it's to highlight that we're using Basic Auth)). So .. how can i do this with oAuth?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • ActionController::RoutingError (No route matches {:action=>"show", :controller=>"users", :id=>nil}):

    - by Matt Bishop
    I have been trying to fix this routing error for a long time. I would appreciate any assistance! This error is preventing me from being able to authenticate. Here is what I am getting in my Heroku logs. app/controllers/authentications_controller.rb:12:in `create' ActionController::RoutingError (No route matches {:action=>"show", :controller=>"users", :id=>nil}) Here is the routes.rb file: Company::Application.routes.draw do resources :profile_individual resources :careers match 'careers' => 'careers#index' match 'about' => 'about#index' constraints(:subdomain => /^$|www/) do devise_for :users resources :authentications, :identities #, :beta_invitations resources :users do resources :invitations, :controller => 'UserInvitation' do post :upload, :on => :collection get :email_template, :on => :collection get :plaintext_template, :on => :collection get :facebook_invitation, :on => :collection end member do get :summary get :recruits get :friends_events get :events_near_me get :recent_activity get :impact get :campaigns end end resources :password_resets do get 'password_reset' => 'password_resets#show', :as => 'password_reset' end resources :events, :only => [:new, :index, :create] resources :organizations, :only => [:index, :create] resources :orders do post :ipn, :on => :member resource :payment do member do post :relay_response get :receipt end end resource :paypal_integration do member do get :authorize get :cancel post :finalize end end end match '/users/:id/impact/money/:d' => 'users#impact_money_graph', :constraints => {:d => /\d+{4}_\d+{2}-\d+{2}/}, :as => :user_impact_money match '/users/:id/impact/money' => 'users#impact_money_graph', :as => :user_impact_money match '/users/:id/impact/recruits/:d' => 'users#impact_recruits_graph', :constraints => {:d => /\d+{4}_\d+{2}-\d+{2}/}, :as => :user_impact_recruits match '/users/:id/impact/recruits' => 'users#impact_recruits_graph', :as => :user_impact_recruits match '/auth/failure' => 'authentications#failure' match '/auth/:provider/callback' => 'authentications#create' match '/auth/:provider/callback' => 'authentications#show', :controller => 'users', :as => :login match '/logout' => 'authentications#destroy', :as => :logout match '/login' => 'authentications#new', :as => :login match "/join_team/:id" => "team_members#join", :as => :join_team match "/rsvp/:id" => "rsvps#show", :as => :rsvp match "/signup" => 'authentications#signup', :as => :signup match "/beacon/:id.gif" => "email_beacons#show", :as => :email_beacon root :to => "homes#show" match '/corporate_giving' => "homes#corporate_giving" end constraints(Subdomain) do resource :organization, :path => "/", :only => [:edit, :update] do member do get :org_photos_videos get :org_recent_activity end end resources :events, :except => [:index] do post :publish, :on => :member resource :supporter_invite resource :team_management do post :mailer, :on => :member end resource :team_member do post :invite, :on => :member end resource :rsvp do put :make_order, :on => :collection get :make_order, :on => :collection end resources :invites do post :upload, :on => :collection end resources :ticket_tiers, :team_members end match "/events" => redirect("/") root :to => "organizations#show" end namespace :admin do resources :stats resources :organizations resources :campaigns do resources :rewards resources :contents put :header, :action => 'header_update' end resources :users do member do post :grant_access post :revoke_access end end resources :nonprofits do member do put :approve put :revoke end end end resources :campaigns do get :find_charities, :on => :collection get :how_many_charities, :on => :collection member do post :join get :join post :header, :action => 'header_creation' put :header, :action => 'header_update' end resources :rewards resources :contents resource :donations do resource :paypal_integration, :controller => 'donations' do member do get :authorize get :cancel post :finalize end end end end match '/campaigns/:id/graph/:d' => 'campaigns#graph', :constraints => {:d => /\d+{4}_\d+ {2}-\d+{2}/}, :as => :graph_campaign match '/campaigns/:id/graph' => 'campaigns#graph', :as => :graph_campaign resources :business_campaigns, :controller => 'campaigns' resources :businesses do put :logo, :on => :collection, :action => 'upload_logo' member do get :summary get :recruits get :friends_events get :events_near_me get :recent_activity get :impact get :campaigns end end resources :nonprofit_campaigns, :controller => 'campaigns' resources :nonprofits do put :logo, :on => :collection, :action => 'upload_logo' member do get :summary get :recruits get :friends_events get :events_near_me get :recent_activity get :impact get :campaigns get :supporting_campaigns end end resources :publicities match '/campaigns/:campaign_id/rewards/:id' => 'campaigns#reward', :via => :get match "/robots.txt" => "application#robots_txt" match "/beta_invitations" => redirect('/') resource :sitemap resources :referrals end Here is my authentications_controller.rb file class AuthenticationsController < ApplicationController skip_before_filter :require_beta_access before_filter :redirect_to_profile_if_logged_in, :only => [:create, :new] layout :resolve_layout def create omniauth = request.env["omniauth.auth"] authentication = Authentication.find_by_provider_and_uid(omniauth['provider'], omniauth['uid']) if authentication && authentication.user.present? sign_in(:user, authentication.user) redirect_to session[:redirect_to] || user_path(current_user, :subdomain => nil) elsif current_user current_user.authentications.create!(:provider => omniauth['provider'], :uid => omniauth['uid']) redirect_to session[:redirect_to] || user_path(current_user, :subdomain => nil) else user = User.new user.apply_omniauth(omniauth) logger.debug "=======================auth=============================" logger.debug session[:referrer_token] logger.debug "========================================================" if session[:referrer_token] publicity = Publicity.find_by_token(session[:referrer_token]) user.invited_by = publicity user.recruited_by = publicity end if user.save sign_in(user) unless session[:redirect_to] session[:referrer_token] = nil end redirect_to session[:redirect_to] || user_path(current_user, :subdomain => nil) #redirect_to session[:redirect_to] || campaigns_url(:tc => request.env['omniauth.params']['tc']) #tc is for AB testing else session[:omniauth] = omniauth.except('extra') redirect_to signup_path end end end def failure flash[:error] = "Please check your email and password and try again" redirect_to login_path end def destroy reset_session redirect_to root_path end def signup # end private def redirect_to_profile_if_logged_in redirect_to user_path(current_user.permalink) if current_user end def resolve_layout case action_name when "new", "signup" "authentication" else "selfcontained" end end end I am adding my appplication_controller.rb too: class ApplicationController < ActionController::Base #Wrote by George for beta users -before_filter :require_beta_access before_filter :save_referrer_token protect_from_forgery helper_method :organization_admin?, :team_member?, :profile_url, :current_profile def set_headers # Set our headers here end def save_referrer_token #session.delete(:referrer_token) if params[:ref] publicity = Publicity.find_by_token(params[:ref]) logger.debug "========================================================" logger.debug current_profile.nil? logger.debug publicity.creator logger.debug current_profile logger.debug current_profile != publicity.creator session[:referrer_token] = params[:ref] if current_profile.nil? or publicity.creator != current_profile logger.debug session[:referrer_token] logger.debug "========================================================" end end def robots_txt robots = File.read(Rails.root + "public/robots.#{Rails.env}.txt") render :text => robots, :layout => false, :content_type => "text/plain" end def load_organization @organization = Organization.find_by_permalink(request.subdomain) raise ActiveRecord::RecordNotFound if @organization.nil? end def require_user unless current_user session[:redirect_to] = request.url redirect_to login_url(:host => request.domain) end end def require_beta_access if !current_user redirect_to root_url(:host => request.domain) elsif !current_user.beta_access? redirect_to new_beta_invitation_url(:host => request.domain) end end def require_organization_admin unless organization_admin? redirect_to root_url(:subdomain => @organization.permalink) end end def team_member? if current_user && @event.team_memberships.where(:user_id => current_user.id).count != 0 true end end def organization_admin? if current_user && current_user.beta_access? && @organization && @organization.memberships.where(:user_id => current_user.id, :role => 'admin').count != 0 true end end def profile_url(profile, opt = nil) if profile == current_user user_url(profile, :host => opt[:host]) elsif profile.is_a? BusinessProfile business_url(profile) elsif profile.is_a? NonprofitProfile nonprofit_url(profile) end end def set_current_profile(profile) session[:current_profile] = profile end def current_user @current_user ||= User.find_by_auth_token!(cookies[:auth_token]) if cookies[:auth_token] end def current_profile #if session session[:current_profile] || current_user #else # nil #end end IGIVEMORE_HTML5_OPTIOINS = { :style => 'z-index: 0;',:width => '290', :height => '200', :frameborder => '0', :url_params => {:wmode=>"opaque"} } def campaign_header_body(camp, opt = IGIVEMORE_HTML5_OPTIOINS) if camp.header_type == Campaign::HEADER_YOUTUBE youtube_html5(camp.header_url, opt).html_safe elsif camp.header_type == Campaign::HEADER_IMAGE "<img src=\"#{camp.header_url}\" width=\"#{opt[:width]}\" height=\"#{opt[:height]}\"/>'".html_safe else "Unsupported Type!!" end end def youtube_html5(url, opt) begin video = YouTubeIt::Client.new.video_by(url) video.embed_html5(opt).gsub(/http:\/\//,"https://") rescue => e "<div style='color:red; width:290px; height:100px; padding-top:100px'>Given Video URL has problem.</div>" end end end

    Read the article

  • Commenting out protect_from_forgery

    - by Andy
    Hi, I was trying to use active record store but I kept getting an invalid authenticity token. Someone told me to remove my protect_from_forgery from application controller. I know that this would remove all auth tokens but I'm not sure if this is a good idea. Does active record store not need auth tokens? By the way, all I need is a way to dynamically calculate the number of users online and their session variables. If there is a better way than using active record store it would be nice to know.

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • Relogging a user in with different Spring Security Authorities programmatically

    - by user1331982
    PreReq: User logs in and is given roles got from the database using a custom implementation of userService. i.e. authentication-provider user-service-ref="securityPolicyService" The implemented method loadUserByUsername gets called and the roles are load for the user for the particular club they are logging into, Default one is loaded first time in. The user then click on a different club from the UI and I call a method on a service that gets the new list of authorities for this club. I then perform the following: Object principle = SecurityContextHolder.getContext().getAuthentication().getPrincipal(); SecureMember sm = (SecureMember) principle; Authentication auth = new UsernamePasswordAuthenticationToken(sm, null, newAuthories); <br><br> SecurityContextHolder.getContext().setAuthentication(auth);<br> request.getSession(false).invalidate(); SecureMember extends User from SpringFramework. The problem is the SecureMember authorities are never updated with the new ones. thanks Gary

    Read the article

  • Update Facebook Page's status using pyfacebook

    - by thornomad
    I am attempting to add functionality to my Django app: when a new post is approved, I want to update the corresponding Facebook Page's status with a message and a link to the post automatically. Basic status update. I have downloaded and installed pyfacebook - and I have read through the tutorial from Facebook. I have also seen this suggestion here on SO: import facebook fb = facebook.Facebook('YOUR_API_KEY', 'YOUR_SECRET_KEY') fb.auth.createToken() fb.login() # THIS IS AS FAR AS I CAN GET fb.auth.getSession() fb.set_status('Checking out StackOverFlow.com') When I get to the login() call, however, pyfacebook tries to open lynx so I can login to Facebook 'via the web' -- this is, obviously, not going to work for me because the system is supposed to be automated ... I've been looking, but can't find out how I can keep this all working with the script and not having to login via a web browser. Any ideas?

    Read the article

< Previous Page | 113 114 115 116 117 118 119 120 121 122 123 124  | Next Page >