Search Results

Search found 10921 results on 437 pages for 'latex environment'.

Page 12/437 | < Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >

• How do you change the image of a bullet point in LaTeX Beamer

  - by cheshirekow

  When I use the itemize environment, i.e. \begin{itemize} \item one \item two \item three \end{itemize} The bullet points are ugly bitmap graphics that have harsh (aliased) edges. I'd like it to be a nice, clean font character or vector graphic

  Read the article

• LaTex: how does the include-command work?

  - by HH

  I supposed the include-command copy-pastes code in the compilation, it is wrong because the code stopped working. Please, see the middle part in the code. I only copy-pasted the code to the file and added the include-command. $ cat results/frames.tex 10.31 & 8.50 & 7.40 \\ 10.34 & 8.53 & 7.81 \\ 8.22 & 8.62 & 7.78 \\ 10.16 & 8.53 & 7.44 \\ 10.41 & 8.38 & 7.63 \\ 10.38 & 8.57 & 8.03 \\ 10.13 & 8.66 & 7.41 \\ 8.50 & 8.60 & 7.15 \\ 10.41 & 8.63 & 7.21 \\ 8.53 & 8.53 & 7.12 \\ Latex code \begin{table} \begin{tabular}{ | l | m | r |} \hline $t$ / s & $d_{1}$ / s & $d_{2}$ / s \\ $\Delta h = 0,01 s$ & $\Delta d = 0,01 s$ & $\Delta d = 0,01 s$ \\ \hline % I JUST COPIED THE CODE from here to the file, included. % It stopped working, why? \include{results/frames.tex} \hline $\pi (\frac{d_{1}}{2} - \frac{d_{2}}{2})$ & $2 \pi R h$ & $2 \pi r h$ \\ \hline \end{tabular} \end{table}

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• latex computer output segments

  - by Flavius

  I have a verbatim environment containing computer output as text. This text is sematically made of two sections, each section being separated from the other by an empty line. The number of sections and their content is known, so I don't need to parse the text, but the line between the sections is very important (as it gives semantics to the "text"). Each segment is made of multiple lines. How could I write (1) and (2) on the left handside at the centre of each segment?

  Read the article

• Latex: vertical line in lstlistings

  - by Helltone

  I want to have a vertical line for indentation in the lstlisting environment, similar to what one can get in algorithm2e. I tried doing something like the code below, but the the |'s are not contiguous and the result is ugly. \lstset{ ... showtabs=true, tabsize=3, tab=\hfill$|$\hfill, ... }

  Read the article

• LaTeX lstlisting underlined

  - by Gernot

  Hi, Is there an easy way to have the complete code in a lstlisting environment underlined? My current solution looks like this, but I'm not really happy with it. \begin{lstlisting}[mathescape] $\ul{if(gt(x1, 0)) then} $ ... \end{lstlisting} Thx for any tips.

  Read the article

• Getting the error "Missing $ inserted" in LaTeX

  - by Espenhh

  Hey, I try to write the following in latex: \begin{itemize} \item \textbf{insert(element|text)} inserts the element or text passed at the start of the selection. \item \textbf{insert_after(element|text)} inserts the element or text passed at the end of the selection. \item \textbf{replace(element|text)} replaces the selection with the passed text/element. \item \textbf{delete()} deletes the selected text. \item \textbf{annotate(name,value)} annotates the selected text with the passed name and value-pair. This can either be a hidden meta-data about the selection, or can alter the visible appearance. \item \textbf{clear_annotation()} removes any annotation for this specific selection. \item \textbf{update_element(value)} performs an update of the element at the selection with the passed value. \end{itemize} For some reason, I get a bunch of errors. I think there is something with the use of the word "insert". I get errors like "Missing $ inserted", so it seems like the parses tries to fix some "errors" on my parts. Do I need to escape words like "insert", how do I do that?

  Read the article

• Lifting a math symbol in LaTeX

  - by Chris Conway

  I'm using the symbol \otimes as a unary operator and it's vertical alignment doesn't seem right to me. It wants to sit a bit below the baseline: and I tried using \raisebox to fix this, e.g., \raisebox{1pt}{$\otimes$}: But \raisebox doesn't seem to be sensitive to subscripts. The operator stays the same size while everything around it shrinks: The problem, I think, is that \raisebox creates its own LR box, which doesn't inherit the settings in the surrounding math environment. Is there a version of \raisebox that "respects math"?

  Read the article

• What packages do I need to compile .tex documents using XeLaTeX?

  - by maria

  Hi I'm aware of the existence of similar threads on this forum. But any of replies mach to my problem. I'm using Ubuntu 10.4 and I hadn't problems with fonts till I've decided to use XeLaTeX instead of LaTeX (cf http://tex.stackexchange.com/questions/12347/typesetting-a-document-using-arabic-script/12358#12358). The problem is that I'm not able to compile any .tex document using XeLaTeX, as well as properly display XeLaTeX documentation. As I've learn thanks to mentioned thread, XeLaTeX uses the fonts availables in general in the system. I was trying yo read fontspec documentation, but it opens in pdf with a lot of white gaps and terminal output (quite long) consist mostly of errors. This are just few lines of it: Error: Missing language pack for 'Adobe-Japan1' mapping Error: Unknown font tag 'F5.1' Error (24124): No font in show Error: Unknown font tag 'F5.1' I was trying to compile simple XeLaTeX file: \documentclass{article} \usepackage{fontspec} \setmainfont{Linux Libertine O} \begin{document} Hello World! \end{document} without succes. This is terminal output of compilation: This is XeTeX, Version 3.1415926-2.2-0.9995.2 (TeX Live 2009/Debian) restricted \write18 enabled. entering extended mode (./ex.tex LaTeX2e <2009/09/24> Babel <v3.8l> and hyphenation patterns for english, usenglishmax, dumylang, noh yphenation, polish, loaded. (/usr/share/texmf-texlive/tex/latex/base/article.cls Document Class: article 2007/10/19 v1.4h Standard LaTeX document class (/usr/share/texmf-texlive/tex/latex/base/size10.clo)) (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.sty (/usr/share/texmf-texlive/tex/generic/ifxetex/ifxetex.sty) (/usr/share/texmf-texlive/tex/latex/tools/calc.sty) (/usr/share/texmf-texlive/tex/latex/xkeyval/xkeyval.sty (/usr/share/texmf-texlive/tex/generic/xkeyval/xkeyval.tex (/usr/share/texmf-texlive/tex/generic/xkeyval/keyval.tex))) (/usr/share/texmf-texlive/tex/latex/base/fontenc.sty (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1enc.def) (/usr/share/texmf-texlive/tex/xelatex/euenc/eu1lmr.fd)) fontspec.cfg loaded. (/usr/share/texmf-texlive/tex/xelatex/fontspec/fontspec.cfg))kpathsea: Invalid fontname `Linux Libertine O', contains ' ' ! Font \zf@basefont="Linux Libertine O" at 10.0pt not loadable: Metric (TFM) fi le or installed font not found. \zf@fontspec ...ntname \zf@suffix " at \f@size pt \unless \ifzf@icu \zf@set@... l.3 \setmainfont{Linux Libertine O} ? I can't find Linux Libertine O. Searching for otf- by aptitude gives as result: maria@maria-laptop:/etc/fonts$ aptitude search otf p emdebian-rootfs - emdebian root filesystem support p libotf-bin - A Library for handling OpenType Font - utilities p libotf-dev - A Library for handling OpenType Font - development i libotf0 - A Library for handling OpenType Font - runtime p libotf0-dbg - The libotf libraries and debugging symbols p libpam-dotfile - A PAM module which allows users to have more than one password p livecd-rootfs - construction script for the livecd rootfs p makebootfat - Utility to create a bootable FAT filesystem p otf-ipaexfont - Japanese OpenType font, IPAexFont (IPAexGothic/Mincho) p otf-ipaexfont-gothic - Japanese OpenType font, IPAexFont (IPAexGothic) p otf-ipaexfont-mincho - Japanese OpenType font, IPAexFont (IPAexMincho) p otf-ipafont - Japanese OpenType font set, IPAfont p otf-ipafont-gothic - Japanese OpenType font set, IPA Gothic font p otf-ipafont-mincho - Japanese OpenType font set, IPA Mincho font p otf-stix - the Scientific and Technical Information eXchange fonts p otf-thai-tlwg - Thai fonts in OpenType format p otf-yozvox-yozfont - Japanese proportional Handwriting OpenType font p otf2bdf - generate BDF bitmap fonts from OpenType outline fonts p robotfindskitten - Zen Simulation of robot finding kitten So font in question is not just uninstalled, but not available, if I'm not wrong. Does it mean that I lack some repositoires? I was trying also to apply solution from the thread How do I reinstall default fonts?, but the result is: maria@maria-laptop:~$ sudo apt-get install msttcorefonts [sudo] password for maria: Reading package lists... Done Building dependency tree Reading state information... Done Note, selecting ttf-mscorefonts-installer instead of msttcorefonts ttf-mscorefonts-installer is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. maria@maria-laptop:~$ It seems that is not a usual problem for use of XeLaTeX; nobody in the mentioned thread suggested instalation of anything else than TeX Live. Thanks in advance

  Read the article

• pdflatex reads .eps files saved in OS/X, but not in Ubuntu

  - by David B Borenstein

  Sorry if this is a stupid question; I'm a newbie. I am preparing a manuscript in LaTeX. The journal (Physical Biology, an IOP publication) requires that figures be saved in .eps format, so I am trying to do that. However, I cannot get my LaTeX file to build when I have generated the .eps files on my Ubuntu computer. If I save the images on my Mac, the file build just fine. So far, I have tried saving images in ImageJ, FIJI and Inkscape. The same problem occurs in all three. When using kile, I get the following error: /usr/share/texmf-texlive/tex/latex/oberdiek/epstopdf-base.sty:0: Shell escape feature is not enabled. In TexWorks, the error is different, but still there: Package pdftex.def Error: File `./figures4/figure4a-eps-converted-to.pdf' not found. Now, if I fire up Inkscape, FIJI or ImageJ on OS/X, everything works fine. The Mac also can't build with the Ubuntu-saved images. The images generated on the Ubuntu machine open fine using Document Viewer. I am building the same LaTeX file on both computers, with the exact same results. The header of my LaTeX file is: \documentclass[12pt]{iopart} \usepackage{graphicx} \usepackage{epstopdf} \usepackage{parskip} \usepackage{color} \usepackage{iopams} And then the code for the figure is: \begin{figure} \center{\includegraphics[width=4in] {./figures4/figure4a.eps}} \footnotesize{\caption{ \label{fig:4a} (4a) lorem ipsum dolor sic amet.}} \end{figure} I'd be happy to send an example of both .eps files. Again, sorry if this is a dumb question. I tried everything I could think of before posting here. Thanks, David

  Read the article

• PowerShell: can't modify environment variables

  - by IttayD

  I have an environment variable set via "system properties - advanced - Environment Variables". I modified the variable's value. In cmd, I see the new value. In PowerShell, the value is still the old value. Trying to set it with [Environment]::SetEnvironmentVariable doesn't have any effect.

  Read the article

• How do you use environment variables, such as %CommonProgramFiles%, in the PATH and have them recogn

  - by Brad Knowles

  I'm trying to add C:\Program Files\Common Files\xxx\xxx to the system PATH environment variable by appending %CommonProgramFiles%\xxx\xxx to the existing path. After rebooting, I open a command prompt and check the PATH. It expands correctly. However, when using Process Explorer from Sysinternals to view the Environment variables on services.exe, it shows the unexpanded version. Coincidentally, the paths using %SystemRoot% expand and are recognized just fine. I've tried altering the PATH through the Environment Variables window from System Properties and through direct Registry manipulation, neither seems to work. Is it possible to use other environment variables, besides %SystemRoot% in PATH and have services.exe understand it?

  Read the article

• Caching of path environment variable on windows?

  - by jwir3

  I'm assisting one of our testers in troubleshooting a configuration problem on a Windows XP SP3 system. Our application uses an environment variable, called APP_HOME, to refer to the directory where our application is installed. When the application is installed, we utilize the following environment variables: APP_HOME = C:\application\ PATH = %PATH%;%APP_HOME%bin Now, the problem comes in that she's working with multiple versions of the same application. So, in order to switch between version 7.0 and 8.1, for example, she might use: APP_HOME = C:\application_7.0\ (for 7.0) and then change it to: APP_HOME = C:\application_8.1\ (for 8.1) The problem is that once this change is made, the PATH environment variable apparently still is looking at the old expansion of the APP_HOME variable. So, for example, after she has changed APP_HOME, PATH still refers to the 7.0 bin directory. Any thoughts on why this might be happening? It looks to me like the PATH variable is caching the expansion of the APP_HOME environment variable. Is there any way to turn this behavior off?

  Read the article

• ! Extra }, or forgotten \endgroup. latex

  - by gzou

  hey, I met these latex format problem, anyone can offer some help? the .tex file: \begin{table}{} \renewcommand{\arraystretch}{1.1} \caption{Cambridge Flow feature definition and description} \label{cambridge-feature}} \centering \begin{tabular}{|c|c|} \hline\bfseries Abbreviation &\bfseries Description\\ \hline serv-port & Server port\\ \hline clnt-port & Client port\\ \hline push-pkts-serv & count of all packets with\\ & push bit set in TCP header (server to client)\\ \hline init-win-bytes-clnt & the total number of bytes \\ & sent in initial window (client to server)\\ \hline init-win-bytes-serv & the total number of bytes sent\\ & in initial window (server to client)\\ \hline avg-seg-size-clnt & average segment size: \\ & data bytes devided by number of packets\\ \hline IP-bytes-med-clnt & median of total bytes in IP packet\\ \hline act-data-pkt-serv & count of packet with at least one byte \\ & of TCP data playload (server to client)\\ \hline data-bytes-var-clnt & variance of total \\ & bytes in packets (client to server)\\ \hline min-seg-size-serv & minimum segment size \\ & observed (server to client)\\ \hline RTT-samples-serv & total number of RTT samples\\ & found (server to client),\\ & {\bf see also \cite{Moore05discriminators}}\\ \hline push-pkts-clnt & count of all packets with push bit set \\ & in TCP header (server to client)\\ \hline \end{tabular} \end{table} and the error message: ! Extra }, or forgotten \endgroup. \@endfloatbox ...pagefalse \outer@nobreak \egroup \color@endbox l.892 \end{table} I've deleted a group-closing symbol because it seems to be spurious, as in $x}$'. But perhaps the } is legitimate and you forgot something else, as in\hbox{$x}'. In such cases the way to recover is to insert both the forgotten and the deleted material, e.g., by typing `I$}'. there is no $ in my table, also this { are matching with the }, and also after I comment the citation, the error remains. anyone can offer help? really appreciate all the comments! ! Extra }, or forgotten \endgroup.

  Read the article

• No norwegian characters in LaTeX

  - by DreamCodeR

  Hi, I have translated a document from English to Norwegian in the LaTeX format, and while using norwegian special characters, I get an error using \usepackage[utf8x]{inputenc} to try and display the norwegian (scandinavian) special characters in PostScript/PDF/DVI format, saying Package utf8x Error: MalformedUTF-8sequence. So while that didn't work, I tried out another possible solution: \usepackage{ucs} \usepackage[norsk]babel And when I tried to save that in Emacs I get this message: These default coding systems were tried to encode text in the buffer `lol.tex': (utf-8-unix (905 . 4194277) (916 . 4194245) (945 . 4194278) (950 . 4194277) (954 . 4194296) (990 . 4194277) (1010 . 4194277) (1013 . 4194278) (1051 . 4194277) (1078 . 4194296) (1105 . 4194296)) However, each of them encountered characters it couldn't encode: utf-8-unix cannot encode these: \345 \305 \346 \345 \370 \345 \345 \346 \345 \370 ... Thanks to Emacs I have the possibility to check out the properties of those characters and the first one tells me: character: \345 (4194277, #o17777745, #x3fffe5) preferred charset: eight-bit (Raw bytes 128-255) code point: 0xE5 syntax: w which means: word buffer code: #xE5 file code: not encodable by coding system utf-8-unix display: not encodable for terminal Which doesn't tell me much. When I try to build this with texi2dvi --dvipdf filename.text I get a perfectly fine PDF, all without the special norwegian characters. When I am about to save Emacs also ask me: "Select coding system (default raw-text):" And I type in utf-8 to choose its coding system. I have also tried to choose default raw-text to see if I get some different result. But nothing. At last I tried \lstset{inputencoding=utf8x, extendedchars=\true} ... a code I came over while trying to google the solution to this problem. Which gives me this error: Undefined control sequence. So basically, I have tried every encoding option I have been able to find and nothing works. I am desperately trying to make this work since the norwegian translation must be published before the deadline. As an additional information I may add that I found out later on that I only had the en_US.UTF-8 in my locale, so I added nb_NO.UTF-8 and nb_NO.ISO-8859-15 and ran locale-gen + reboot without any changes. I hope I provided enough information to get some assistance, the characters in question is æ ø å.

  Read the article

• How to Remove Header in LaTex

  - by Tim

  Hi, I would like to not show the name of each chapter on the header of its each page. I also like to have nothing in the headers for abstract, acknowledgement, table of content, list of figures and list of tables. But currently I have header on each page, for example: Here is my code when specifying these parts in my tex file \begin{abstract} ... \end{abstract} \begin{acknowledgement} ... \end{acknowledgement} % generate table of contents \tableofcontents % generate list of tables \listoftables % generate list of figures \listoffigures \chapter{Introduction} \label{chp1} %% REFERENCES \appendix \input{appendiximages.tex} \bibliographystyle{plain} %%\bibliographystyle{abbrvnat} \bibliography{thesis} Here is what I believe to be the definition of the commands. More details can be found in these two files jhu12.clo and thesis.cls. % \chapter: \def\chaptername{Chapter} % ABSTRACT % MODIFIED to include section name in headers \def\abstract{ \newpage \dsp \chapter*{\abstractname\@mkboth{\uppercase{\abstractname}}{\uppercase{\abstractname}}} \fmfont \vspace{8pt} \addcontentsline{toc}{chapter}{\abstractname} } \def\endabstract{\par\vfil\null} % DEDICATION % Modified to make dedication its own section %\newenvironment{dedication} %{\begin{alwayssingle}} %{\end{alwayssingle}} \def\dedication{ \newpage \dsp \chapter*{Dedication\@mkboth{DEDICATION}{DEDICATION}} \fmfont} \def\endacknowledgement{\par\vfil\null} % ACKNOWLEDGEMENTS % MODIFIED to include section name in headers \def\acknowledgement{ \newpage \dsp \chapter*{\acknowledgename\@mkboth{\uppercase{\acknowledgename}}{\uppercase{\acknowledgename}}} \fmfont \addcontentsline{toc}{chapter}{\acknowledgename} } \def\endacknowledgement{\par\vfil\null} \def\thechapter {\arabic{chapter}} % \@chapapp is initially defined to be '\chaptername'. The \appendix % command redefines it to be '\appendixname'. % \def\@chapapp{\chaptername} \def\chapter{ \clearpage \thispagestyle{plain} \if@twocolumn % IF two-column style \onecolumn % THEN \onecolumn \@tempswatrue % @tempswa := true \else \@tempswafalse % ELSE @tempswa := false \fi \dsp % double spacing \secdef\@chapter\@schapter} % TABLEOFCONTENTS % In ucthesis style, \tableofcontents, \listoffigures, etc. are always % set in single-column style. @restonecol \def\tableofcontents{\@restonecolfalse \if@twocolumn\@restonecoltrue\onecolumn\fi %%%%% take care of getting page number in right spot %%%%% \clearpage % starts new page \thispagestyle{botcenter} % Page style of frontmatter is botcenter \global\@topnum\z@ % Prevents figures from going at top of page %%%%% \@schapter{\contentsname \@mkboth{\uppercase{\contentsname}}{\uppercase{\contentsname}}}% {\ssp\@starttoc{toc}}\if@restonecol\twocolumn\fi} \def\l@part#1#2{\addpenalty{-\@highpenalty}% \addvspace{2.25em plus\p@}% space above part line \begingroup \@tempdima 3em % width of box holding part number, used by \parindent \z@ \rightskip \@pnumwidth %% \numberline \parfillskip -\@pnumwidth {\large \bfseries % set line in \large boldface \leavevmode % TeX command to enter horizontal mode. #1\hfil \hbox to\@pnumwidth{\hss #2}}\par \nobreak % Never break after part entry \global\@nobreaktrue %% Added 24 May 89 as \everypar{\global\@nobreakfalse\everypar{}}%% suggested by %% Jerry Leichter \endgroup} % LIST OF FIGURES % % Single-space list of figures, add it to the table of contents. \def\listoffigures{\@restonecolfalse \if@twocolumn\@restonecoltrue\onecolumn\fi %%%%% take care of getting page number in right spot %%%%% \clearpage \thispagestyle{botcenter} % Page style of frontmatter is botcenter \global\@topnum\z@ % Prevents figures from going at top of page. \@schapter{\listfigurename\@mkboth{\uppercase{\listfigurename}}% {\uppercase{\listfigurename}}} \addcontentsline{toc}{chapter}{\listfigurename} {\ssp\@starttoc{lof}}\if@restonecol\twocolumn\fi} \def\l@figure{\@dottedtocline{1}{1.5em}{2.3em}} % bibliography \def\thebibliography#1{\chapter*{\bibname\@mkboth {\uppercase{\bibname}}{\uppercase{\bibname}}} \addcontentsline{toc}{chapter}{\bibname} \list{\@biblabel{\arabic{enumiv}}}{\settowidth\labelwidth{\@biblabel{#1}}% \leftmargin\labelwidth \advance\leftmargin\labelsep \usecounter{enumiv}% \let\p@enumiv\@empty \def\theenumiv{\arabic{enumiv}}}% \def\newblock{\hskip .11em plus.33em minus.07em}% \sloppy\clubpenalty4000\widowpenalty4000 \sfcode`\.=\@m} Thanks and regards! EDIT: I just replaced \thispagestyle{botcenter} with \thispagestyle{plain}. The latter is said to clear the header (http://en.wikibooks.org/wiki/LaTeX/Page_Layout), but it does not. How shall I do? Thanks!

  Read the article

• Typing math formulas in LaTex and getting them in MathType format?

  - by Tim

  I am asked to type some math formulas that can work in Microsoft Office and MathType equation editor. But I only have access to Ubuntu 12.04 near me, there is LibreOffice available under Ubuntu as well, but I am used to type math formulas in LaTex. So I wonder how to provide math formulas that will work in Microsoft Office and MathType, if I work under Ubuntu, preferably with LaTex but LibreOffice being also acceptable since it is still under Ubuntu? Thanks and regards!

  Read the article

• Which is more important in a web application code promotion hierarchy? production environment to repo equivalence or unidirectional propagation?

  - by ghbarratt

  Lets say you have a code promotion hierarchy consisting of several environments, (the polar end) two of which are development (dev) and production (prod). Lets say you also have a web application where important (but not developer controlled) files are created (and perhaps altered) in the production environment. Lets say that you (or someone above you) decided that the files which are controlled/created/altered/deleted in the production environment needed to go into the repository. Which of the following two sets of practice / approaches do you find best: Committing these non-developed file modifications made in the production environment so that the repository reflects the production environment as closely and as often as possible. Generally ignoring the non-developed production environment alterations, placing confidence in backups to restore the production environment should it be harmed, and keeping a resolution to avoid pushing developments through the promotion hierarchy in the reverse direction (avoiding pushing from prod to dev), only committing the files found in the production environment if they were absolutely necessary in other environments for development. So, 1 or 2, and why? PS - I am currently slightly biased toward maintaining production environment to repository equivalence (option 1), but I keep an open mind and would accept an answer supporting either.

  Read the article

• Have upstart read environment from /etc/environment for a service

  - by Nikratio

  What is the best way to provide the environment variables defined in /etc/environment to an upstart service? I think simply sourcing them with . in a script section does not work, because the scripts are executed by sh which would need an additional "export" in front of every definition...

  Read the article

• Resize matrix in latex beamer

  - by John Jiang

  Hi I was wondering how to resize matrices in a beamer environment. Currently I am writing the following code: \begin{align*} \left( \begin{array}{ccccccc} 0 & 1 & & & & & \\ -1 & 0 & & & & & \\ & & 0 & 1 & & & \\ & & -1 & 0 & & & \\ & & & & \ddots & & \\ & & & & & 0 & 1 \\ & & & & & -1 & 0 \end{array} \right) \end{align*} and the matrix takes up almost a whole page. I would like it to be about half a page in height.

  Read the article

• Exporting Environment Variables in Ubuntu Linux

  - by stanigator

  I know many people have asked about environment variables before, but I am having a hard time dealing with these paths while ensuring I don't mess around with the original settings. How would you go about executing these commands in Ubuntu in terms of environment variables? Thanks in advance! Please put /home/stanley/Downloads/ns-allinone-2.34/bin:/home/stanley/Downloads/ns-allinone-2.34/tcl8.4.18/unix:/home/stanley/Downloads/ns-allinone-2.34/tk8.4.18/unix into your PATH environment; so that you'll be able to run itm/tclsh/wish/xgraph. IMPORTANT NOTICES: (1) You MUST put /home/stanley/Downloads/ns-allinone-2.34/otcl-1.13, /home/stanley/Downloads/ns-allinone-2.34/lib, into your LD_LIBRARY_PATH environment variable. If it complains about X libraries, add path to your X libraries into LD_LIBRARY_PATH. If you are using csh, you can set it like: setenv LD_LIBRARY_PATH If you are using sh, you can set it like: export LD_LIBRARY_PATH= (2) You MUST put /home/stanley/Downloads/ns-allinone-2.34/tcl8.4.18/library into your TCL_LIBRARY environmental variable. Otherwise ns/nam will complain during startup.

  Read the article

• Environment variables in Weblogic Managed Server with SSL nodemanager

  - by Eric Darchis

  We have a C legacy application start with JNI that requires environment variables. Not java -Djava.library.path -Dvar=foo as these are purely java. I need real environment variables. When we setup our domains, we usually use the SSH method to start the node managers. This works fine and the env variables are set properly. Recently the sysadmin has decided for a few reasons to use the SSL mode for nodemanagers. The servers start but the environment variables are not set. I checked with "pargs -e" (this is a Solaris machine) that the env variable was indeed not present from the nodemanager and for the managed server. Is SSL starting the managed server without running the .sh scripts or I am missing a parameter somewhere ?

  Read the article

• overload environment

  - by Richo

  I've recently switched across to nesting my home directory across all my machines in an svn repo, meaning that my utility scripts, configuration (irssi, vim, zsh, screen etc) as well as my .profile and so forth are easier to keep up to date across all the places I login. I use a set of sourced .local files to override them on a per site basis as required. As it stands, many of my scripts inherit some form of configuration, and for the most part I've been setting an environment variable in .profile, and then if needed on a per site basis overriding it in .profile.local This works great, but are there pitfalls in having a stack of environment variables? If I take my default environment from within an X session before any of my personal configuration I have not even increased it by 50% but some of the machines I work on are low resource, am I bloating my system unneccessarily, or being needlessly paranoid? Should I start moving this config into seperate flatfiles that are loaded as needed? This means extra infrastructure, or alternately writing a single module for storing config that all of my utilities can inherit.

  Read the article

• HOSTNAME environment variable on Linux

  - by infogrind

  On my Linux box (Gentoo Linux 2.6.31 to be specific) I have noticed that the HOSTNAME environment variable is available in my shell, but not in scripts. For example, $ echo $HOSTNAME returns xxxxxxxx.com, but $ ruby -e 'puts ENV["HOSTNAME"]' returns nil On the other hand, the USER environment variable, for instance, is available both in the shell and in scripts. I have noticed that USER appears in the list of environment variables that appears when I type export i.e., declare -x USER="infogrind" but HOSTNAME doesn't. I suspect the issue has something to do with that. My questions: 1) how can I make HOSTNAME available in scripts, and 2) for my better understanding, where is this variable initially set, and why is it not "exported"?

  Read the article

• Problem with adding Appendix in Latex

  - by Andrew

  Hi all, I tried the first time to add an appendix to my thesis, here are the commands that I used. \appendix \chapter{Appendices} \input{appendix} The output looks than as follows: Appendix A Appendices A.1 My first appendix ..... It does not look to bad, but what is irritating is the Appendices entry after Appendix A. Is there any possibilty I could get rid of it? If I try the following commands: \appendix \input{appendix} The output looks than as follows: .1 My first appendix ... Also not how it is intended. Ideally, it would look like this here: Appendix A A.1 My first appendix ..... Any idea how to do that? Andrew

  Read the article

< Previous Page | 8 9 10 11 12 13 14 15 16 17 18 19  | Next Page >