Search Results

Search found 3518 results on 141 pages for 'arguments'.

Page 120/141 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • creating an object within a function of a program

    - by user1066524
    could someone please tell me what I need to do in order to create an object in a function. I will try to explain by making up some sort of example... Let's say I have a program named TimeScheduler.cpp that implements the class Schedule.h (and I have the implementation in a separate file Schedule.cpp where we define the methods). In the declaration file we have declared two constructors Schedule(); //the default and Schedule(int, int, int);//accepts three arguments to get to the point--let's say in the main program file TimeScheduler.cpp we created our own functions in this program apart from the functions inherited from the class Schedule. so we have our prototypes listed at the top. /*prototypes*/ void makeSomeTime(); etc..... we have main(){ //etc etc... } we then define these program functions void makeSomeTime(){ //process } let's say that inside the function makeSomeTime(), we would like to create an array of Schedule objects like this Schedule ob[]={ summer(5,14, 49), fall(9,25,50) }; what do I have to do to the function makeSomeTime() in order for it to allow me to create this array of objects. The reason I ask is currently i'm having difficulty with my own program in that it WILL allow me to create this array of objects in main()....but NOT in a function like I just gave an example of. The strange thing is it will allow me to create a dynamic array of objects in the function..... like Schedule *ob = new Schedule[n+1]; ob[2]= Schedule(x,y,z); Why would it let me assign to a non-dynamic array in main(), but not let me do that in the function?

    Read the article

  • DBD::CSV: Problem with userdefined functions

    - by sid_com
    From the SQL::Statement::Functions documentation: Creating User-Defined Functions ... More complex functions can make use of a number of arguments always passed to functions automatically. Functions always receive these values in @_: sub FOO { my( $self, $sth, $rowhash, @params ); } #!/usr/bin/env perl use 5.012; use warnings; use strict; use DBI; my $dbh = DBI->connect( "DBI:CSV:", undef, undef, { RaiseError => 1, } ); my $table = 'wages'; my $array_ref = [ [ 'id', 'number' ], [ 0, 6900 ], [ 1, 3200 ], [ 2, 1800 ], ]; $dbh->do( "CREATE TEMP TABLE $table AS import( ? )", {}, $array_ref ); sub routine { my $self = shift; my $sth = shift; my $rowhash = shift; # return $_[0] / 30; }; $dbh->do( "CREATE FUNCTION routine" ); my $sth = $dbh->prepare( "SELECT id, routine( number ) AS result FROM $table" ); $sth->execute(); $sth->dump_results(); When I try this I get an error-message: DBD::CSV::st execute failed: Use of uninitialized value $_[0] in division (/) at ./so.pl line 27. [for Statement "SELECT id, routine( number ) AS result FROM "wages""] at ./so.pl line 34. When I comment out the third argument I works as expected ( because it looks as if the third argument is missing ): #!/usr/bin/env perl ... sub routine { my $self = shift; my $sth = shift; #my $rowhash = shift; return $_[0] / 30; }; ... 0, 230 1, 106.667 2, 60 3 rows Is this a bug?

    Read the article

  • Sharing rails fragments between formats

    - by Julian
    Hi I'm toying with mobile_fu and want to share some fragments between the different views. E.g. views/ item/ view.html.erb view.mobile.rb shared/ _common.erb In both view.html.erb and view.mobile.erb I want to share the same fragment '_common.erb' without having to specify the format (should you ever have to specify the format inside a fragment? It doesn't seem like The Rails Way?). Let's say for arguments's sake it's because it's in a helper or whatever -- the point is that I need to share fragments in a 'well-defined and Railsy way' across formats. Let's take this fairly innocuous snippet <% render :fragment => 'shared/common' %> I've tried 3 file name conventions: _common.html.erb only works for html /item/view/xx fails with 'shared/_common.erb not found') however _common.erb fails for html and works for mobile (maybe mobile_fu is doing something wacky?) -- same error as for .html.erb version above _common.rhtml does work for both I'm thinking that: that rhtml works for both is a legacy hack and I'm loathe to rename all the shared fragments .rhtml to get the behaviour I want. Any feedback gratefully welcome! Including 'you fundamentally don't understand how Rails works please RTFM here: http://....' :)

    Read the article

  • Thread mutex behaviour

    - by Alberteddu
    Hi there, I'm learning C. I'm writing an application with multiple threads; I know that when a variable is shared between two or more threads, it is better to lock/unlock using a mutex to avoid deadlock and inconsistency of variables. This is very clear when I want to change or view one variable. int i = 0; /** Global */ static pthread_mutex_t mutex = PTHREAD_MUTEX_INITIALIZER; /** Thread 1. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); /** Thread 2. */ pthread_mutex_lock(&mutex); i++; pthread_mutex_unlock(&mutex); This is correct, I think. The variable i, at the end of the executions, contains the integer 2. Anyway, there are some situations in which I don't know exactly where to put the two function calls. For example, suppose you have a function obtain(), which returns a global variable. I need to call that function from within the two threads. I have also two other threads that call the function set(), defined with a few arguments; this function will set the same global variable. The two functions are necessary when you need to do something before getting/setting the var. /** (0) */ /** Thread 1, or 2, or 3... */ if(obtain() == something) { if(obtain() == somethingElse) { // Do this, sometimes obtain() and sometimes set(random number) (1) } else { // Do that, just obtain(). (2) } } else { // Do this and do that (3) // If # of thread * 3 > 10, then set(3*10) For example. (4) } /** (5) */ Where I have to lock, and where I have to unlock? The situation can be, I think, even more complex. I will appreciate an exhaustive answer. Thank you in advance. —Alberto

    Read the article

  • Android : start intent in setOnClickListener

    - by Derek
    I have a button, and this button is going to get the values from EditText, then using this value to start a new Intent protected void onCreate(Bundle savedInstanceState) { textDay = (EditText) findViewById(R.id.textDay); textMonth = (EditText) findViewById(R.id.textMonth); textYear = (EditText) findViewById(R.id.textYear); gen = (Button) findViewById(R.id.getGraph); gen.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { getthisIntent(); } public Intent getthisIntent(Context context) { day = textDay.getText(); month = textMonth.getText(); year = textYear.getText(); date = day + "/" + month + "/" + year; . .// Plot graph using AchartEngine, then return an Intent // . } } }); but i get the error "The method getthisIntent(Context) in the type new View.OnClickListener(){} is not applicable for the arguments ()" Can i get some help? or do i have another alternative solution, when i click the button, then the button pass the values to the new intent, and start it without having a new xxx.java file? Edit This is basically what I am doing now, i need to get the things inserted by user, and plot a graph, the only way i know how to plot graph using AchartEngine is create a new activity with define this public Intent getthisIntent(Context context) To be honest, i dont really know what the hell I am doing, please correct me...

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Haskell quiz: a simple function

    - by levy
    I'm not a Haskell programmer, but I'm curious about the following questions. Informal function specification: Let MapProduct be a function that takes a function called F and multiple lists. It returns a list containing the results of calling F with one argument from each list in each possible combination. Example: Call MapProduct with F being a function that simply returns a list of its arguments, and two lists. One of the lists contains the integers 1 and 2, the other one contains the strings "a" and "b". It should return a list that contains the lists: 1 and "a", 1 and "b", 2 and "a", 2 and "b". Questions: How is MapProduct implemented? What is the function's type? What is F's type? Can one guess what the function does just by looking at its type? Can you handle inhomogeneous lists as input? (e.g. 1 and "a" in one of the input lists) What extra limitation (if any) do you need to introduce to implement MapProduct?

    Read the article

  • Troubleshooting multiple GET variables In PHP

    - by V413HAV
    This may be a very simple question but I don't what's the wrong thing am doing here... To explain you clearly, I've set a real simple example below: <ul> <li><a href="test.php?link1=true">Link 1</a></li> <li><a href="test.php?link2=true">Link 2</a></li> <li><a href="test.php?link3=true">Link 3</a></li> </ul> <?php if(isset($_GET['link1'])) { if(($_GET['link1']) == 'true') { echo 'This Is Link 1'; } } if(isset($_GET['link2'])) { if(($_GET['link2']) == 'true') { echo 'This Is Link 2'; } } if(isset($_GET['link3'])) { if(($_GET['link3']) == 'true') { echo 'This Is Link 3'; } } ?> This is a test.php page, here I've set 3 different arguments for $_GET, and show contents accordingly, now everything works perfect, the only thing am not understanding is how to block this kind of url say if user clicks on link 1 the url will be : http://localhost/test.php?link1=true And the Output of this url is This is Link 1 Now if I change this url to : http://localhost/test.php?link3=true&link2=true&link1=true And the Output what I get is This Is Link 1This Is Link 2This Is Link 3 Now this is ok here, but it's very annoying if someone types this and see's forms one below the other, any way I can stop this tampering?

    Read the article

  • Adding text read from a file to an array list in java

    - by user1824856
    I am having trouble putting text read from a file into an array list. My text looks like this: 438;MIA;JFK;10:55;1092;447 638;JFK;MIA;19:45;1092;447 689;ATL;DFW;12:50;732;448 etc... My code looks like this: package filesexample; import java.io.*; import java.io.FileNotFoundException; import java.util.Scanner; import java.util.ArrayList; /** * * @author */ public class FilesExample { /** * @param args the command line arguments */ public static void main(String[] args) throws IOException { File file = new File ("/Schedule.txt"); try { Scanner scanner= new Scanner(file);; while (scanner.hasNextLine()) { String line = scanner.nextLine(); Scanner lineScanner= new Scanner(line); lineScanner.useDelimiter(";"); while(lineScanner.hasNext()){ String part = lineScanner.next(); System.out.print(part + " "); } System.out.println(); } }catch (FileNotFoundException e){ e.printStackTrace(); } } } Some help on getting started would be much appreciated thank you!

    Read the article

  • Change Sequence to Choice

    - by Gordon
    In my Schema File I defined a Group with a Sequence of possible Elements. <group name="argumentGroup"> <sequence> <element name="foo" type="double" /> <element name="bar" type="string" /> <element name="baz" type="integer" /> </sequence> </group> I then reference this Group like this: <element name="arguments"> <complexType> <group ref="my:argumentGroup"/> </complexType> </element> Is it possible to reference the Group at some other point but restrict it so it's a Choice instead of a Sequence. The position where I want to reuse it would only allow one of the Elements within. <element name="argument" minOccurs="0" maxOccurs="1"> <complexType> <group name="my:argumentGroup"> <! -- Somehow change argumentGroup sequence to choice here --> </group> <complexType> </element>

    Read the article

  • How to throw meaningful data in exceptions ?

    - by ZeroCool
    I would like to throw exceptions with meaningful explanation ! I thought of using variable arguments worked fine but lately I figured out it's impossible to extend the class in order to implement other exception types. So I figured out using an std::ostreamstring as a an internal buffer to deal with formatting ... but doesn't compile! I guess it has something to deal with copy constructors. Anyhow here is my piece of code: class Exception: public std::exception { public: Exception(const char *fmt, ...); Exception(const char *fname, const char *funcname, int line, const char *fmt, ...); //std::ostringstream &Get() { return os_ ; } ~Exception() throw(); virtual const char *what() const throw(); protected: char err_msg_[ERRBUFSIZ]; //std::ostringstream os_; }; The variable argumens constructor can't be inherited from! this is why I thought of std::ostringstream! Any advice on how to implement such approach ?

    Read the article

  • Compile C++ in Visual Studio

    - by Kasun
    Hi All.. I use this method to compile C++ file in VS. But even i provide the correct file it returns false. Can any one help me... This is class called CL class CL { private const string clexe = @"cl.exe"; private const string exe = "Test.exe", file = "test.cpp"; private string args; public CL(String[] args) { this.args = String.Join(" ", args); this.args += (args.Length > 0 ? " " : "") + "/Fe" + exe + " " + file; } public Boolean Compile(String content, ref string errors) { if (File.Exists(exe)) File.Delete(exe); if (File.Exists(file)) File.Delete(file); File.WriteAllText(file, content); Process proc = new Process(); proc.StartInfo.UseShellExecute = false; proc.StartInfo.RedirectStandardOutput = true; proc.StartInfo.RedirectStandardError = true; proc.StartInfo.FileName = clexe; proc.StartInfo.Arguments = this.args; proc.StartInfo.CreateNoWindow = true; proc.Start(); //errors += proc.StandardError.ReadToEnd(); errors += proc.StandardOutput.ReadToEnd(); proc.WaitForExit(); bool success = File.Exists(exe); return success; } } This is my button click event private void button1_Click(object sender, EventArgs e) { string content = "#include <stdio.h>\nmain(){\nprintf(\"Hello world\");\n}\n"; string errors = ""; CL k = new CL(new string[] { }); if (k.Compile(content, ref errors)) Console.WriteLine("Success!"); else MessageBox.Show("Errors are : ", errors); }

    Read the article

  • How to detect the root recursive call?

    - by ahmadabdolkader
    Say we're writing a simple recursive function fib(n) that calculates the nth Fibonacci number. Now, we want the function to print that nth number. As the same function is being called repeatedly, there has to be a condition that allows only the root call to print. The question is: how to write this condition without passing any additional arguments, or using global/static variables. So, we're dealing with something like this: int fib(int n) { if(n <= 0) return 0; int fn = 1; if(n > 2) fn = fib(n-2) + fib(n-1); if(???) cout << fn << endl; return fn; } int main() { fib(5); return 0; } I thought that the root call differs from all children by returning to a different caller, namely the main method in this example. I wanted to know whether it is possible to use this property to write the condition and how. Update: please note that this is a contrived example that only serves to present the idea. This should be clear from the tags. I'm not looking for standard solutions. Thanks.

    Read the article

  • Why C++ is (one of) the best language to learn at first [closed]

    - by AlexV
    C++ is one of the most used programming language in the world since like 25+ years. My first job as programmer was in C++ and I coded in C++ everyday for nearly 4 years. Now I do mostly PHP, but I will forever cherish this C++ background. C++ has helped me understand many "under the hood" features/behaviors/restrictions of many other (and different) programming languages like PHP and Delphi. I'm a full time programmer for 6+ years now and since I have a quite varied programming background I often get questions by "newbies" as where to start to become a "good" programmer. I think C++ is one of the best language to start with because it gives you a real usefull experience that will last and will teach you how things work under the hood. It's not the easier one to learn for a newbie, but in my opinion it's the one who will reward the most in long term. I would like to know your opinion on this matter to add to my arguments when I guide "newbies". After this introduction, here's my question : Why C++ is for you (one of) the best language to learn at first. Since it's subjective, I've marked this question as community wiki.

    Read the article

  • Should constant contructor aguments be passed by reference or value?

    - by Mike
    When const values are passed to an object construct should they be passed by reference or value? If you pass by value and the arguments are immediately fed to initializes are two copies being made? Is this something that the compiler will automatically take care of. I have noticed that all textbook examples of constructors and intitializers pass by value but this seems inefficient to me. class Point { public: int x; int y; Point(const int _x, const int _y) : x(_x), y(_y) {} }; int main() { const int a = 1, b = 2; Point p(a,b); Point q(3,5); cout << p.x << "," << p.y << endl; cout << q.x << "," << q.y << endl; } vs. class Point { public: int x; int y; Point(const int& _x, const int& _y) : x(_x), y(_y) {} }; Both compile and do the same thing but which is correct?

    Read the article

  • Compile time error: cannot convert from specific type to a generic type

    - by Water Cooler v2
    I get a compile time error with the following relevant code snippet at the line that calls NotifyObservers in the if construct. public class ExternalSystem<TEmployee, TEventArgs> : ISubject<TEventArgs> where TEmployee : Employee where TEventArgs : EmployeeEventArgs { protected List<IObserver<TEventArgs>> _observers = null; protected List<TEmployee> _employees = null; public virtual void AddNewEmployee(TEmployee employee) { if (_employees.Contains(employee) == false) { _employees.Add(employee); string message = FormatMessage("New {0} hired.", employee); if (employee is Executive) NotifyObservers(new ExecutiveEventArgs { e = employee, msg = message }); else if (employee is BuildingSecurity) NotifyObservers(new BuildingSecurityEventArgs { e = employee, msg = message }); } } public void NotifyObservers(TEventArgs args) { foreach (IObserver<TEventArgs> observer in _observers) observer.EmployeeEventHandler(this, args); } } The error I receive is: The best overloaded method match for 'ExternalSystem.NotifyObservers(TEventArgs)' has some invalid arguments. Cannot convert from 'ExecutiveEventArgs' to 'TEventArgs'. I am compiling this in C# 3.0 using Visual Studio 2008 Express Edition.

    Read the article

  • Java: refactoring static constants

    - by akf
    We are in the process of refactoring some code. There is a feature that we have developed in one project that we would like to now use in other projects. We are extracting the foundation of this feature and making it a full-fledged project which can then be imported by its current project and others. This effort has been relatively straight-forward but we have one headache. When the framework in question was originally developed, we chose to keep a variety of constant values defined as static fields in a single class. Over time this list of static members grew. The class is used in very many places in our code. In our current refactoring, we will be elevating some of the members of this class to our new framework, but leaving others in place. Our headache is in extracting the foundation members of this class to be used in our new project, and more specifically, how we should address those extracted members in our existing code. We know that we can have our existing Constants class subclass this new project's Constants class and it would inherit all of the parent's static members. This would allow us to effect the change without touching the code that uses these members to change the class name on the static reference. However, the tight coupling inherent in this choice doesn't feel right. before: public class ConstantsA { public static final String CONSTANT1 = "constant.1"; public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } after: public class ConstantsA extends ConstantsB { public static final String CONSTANT1 = "constant.1"; } public class ConstantsB { public static final String CONSTANT2 = "constant.2"; public static final String CONSTANT3 = "constant.3"; } In our existing code branch, all of the above would be accessible in this manner: ConstantsA.CONSTANT2 I would like to solicit arguments about whether this is 'acceptable' and/or what the best practices are.

    Read the article

  • Creating rapid function overloads in C++

    - by DeadMG
    template<typename Functor, typename Return, typename Arg1, typename Arg2, typename Arg3, typename Arg4, typename Arg5, typename Arg6, typename Arg7, typename Arg8, typename Arg9, typename Arg10> class LambdaCall : public Instruction { public: LambdaCall(Functor func ,unsigned char constructorarg1 ,unsigned char constructorarg2 ,unsigned char constructorarg3 ,unsigned char constructorarg4 ,unsigned char constructorarg5 ,unsigned char constructorarg6 ,unsigned char constructorarg7 ,unsigned char constructorarg8 ,unsigned char constructorarg9 ,unsigned char constructorarg10) : arg1(constructorarg1) , arg2(constructorarg2) , arg3(constructorarg3) , arg4(constructorarg4) , arg5(constructorarg5) , arg6(constructorarg6) , arg7(constructorarg7) , arg8(constructorarg8) , arg9(constructorarg9) , arg10(constructorarg10) , function(func) {} void Call(State& state) { state.Push<Return>(func(*state.GetRegisterValue<Arg1>(arg1) ,*state.GetRegisterValue<Arg1>(arg1) ,*state.GetRegisterValue<Arg2>(arg2) ,*state.GetRegisterValue<Arg3>(arg3) ,*state.GetRegisterValue<Arg4>(arg4) ,*state.GetRegisterValue<Arg5>(arg5) ,*state.GetRegisterValue<Arg6>(arg6) ,*state.GetRegisterValue<Arg7>(arg7) ,*state.GetRegisterValue<Arg8>(arg8) ,*state.GetRegisterValue<Arg9>(arg9) ,*state.GetRegisterValue<Arg10>(arg10) )); } Functor function; unsigned char arg1; unsigned char arg2; unsigned char arg3; unsigned char arg4; unsigned char arg5; unsigned char arg6; unsigned char arg7; unsigned char arg8; unsigned char arg9; unsigned char arg10; }; Then again for every possible number of arguments I want to support, and again for void returns. Any way to do this faster?

    Read the article

  • Design patterns for Caching Images in a MVC?

    - by Onema
    Hi, I'm designing an image cache system that will be used in an MVC CMS. The main purpose of the image cacher is to modify images: scale, crop, etc and cache them in the client site. I have created an image cache Model and Mapper that interact with the Database, to keep track of the images and know what kind of actions have been applied to them (scale, crop, etc). In addition to the Model and Mapper I have created a ImageCacher Class that is used by the API to manage the Model and image creation based on arguments passed by the client site, this class creates the images and generates the links to the images for the View. A coworker argued that I need to include the functionality of this last Class inside the Model, as the bulk of the logic should go in the model. I respectfully disagree with him since I feel the model's responsibility is to deal with the information about the images cached at the database level, and the responsibility of the ImageCacher Class is to create the url/image that we will be caching (keeping the single responsibility principle). In addition to this I believe that a model should not have Presentation-related features, like creating or showing images. Does anyone have any insight on this? is there a particular design pattern that would make this division of tasks clear and and the image cacher reusable? Should I add all the logic in the Model? Thank you.

    Read the article

  • Error while sending mail (attachment file)

    - by Surya sasidhar
    hi, in my application i am using to send mail with attachments i write the code like this Using System.Net.Mail; MailMessage mail = new MailMessage(); mail.Body = "<html><body><b> Name Of The Job Seeker: " + txtName.Text + "<br><br>" + "The Mail ID:" + txtEmail.Text + "<br><br>" + " The Mobile Number: " + txtmobile.Text + "<br><br>" + "Position For Applied: " + txtPostionAppl.Text + "<br><br>" + "Description " + txtdescript.Text + "<br><br></b></body></html>"; mail.From = new MailAddress ( txtEmail.Text); mail.To .Add (new MailAddress ( mailid)); mail.Priority = MailPriority.High; FileUpload1.PostedFile.SaveAs("~/Resume/" + FileUpload1.FileName); mail.Attachments.Add(filenme); SmtpMail sm = new SmtpMail(); sm.Send(mail); it is giving error at attachment like mail.Attachemts.Add(filena) like this 'System.Collections.ObjectModel.Collection.Add(System.Net.Mail.Attachment)' has some invalid arguments.

    Read the article

  • Doesn't (didn't) Scala have automatically generated setters?

    - by Malvolio
    Google and my failing memory are both giving me hints that it does, but every attempt is coming up dry. class Y { var y = 0 } var m = new Y() m.y_(3) error: value y_ is not a member of Y Please tell me I am doing something wrong. (Also: please tell me what it is I am doing wrong.) EDIT The thing I am not doing wrong, or at least not the only thing I am doing wrong, is the way I am invoking the setter. The following things also fail, all with the same error message: m.y_ // should be a function valued expression m.y_ = (3) // suggested by Google and by Mchl f(m.y_) // where f takes Int => Unit as an argument f(m.y) // complains that I am passing in Int not a function I am doing this all through SimplyScala, because I'm too lazy and impatient to set up Scala on my tiny home machine. Hope it isn't that... And the winner is ... Fabian, who pointed out that I can't have a space between the _ and the =. I thought out why this should be and then it occurred to me: The name of the setter for y is not y_, it is y_= ! Observe: class Y { var y = 0 } var m = new Y() m.y_=(3) m.y res1: Int = 3 m.y_= error: missing arguments for method y_= in class Y; follow this method with `_` if you want to treat it as a partially applied function m.y_= ^ m.y_=_ res2: (Int) => Unit = def four(f : Int => Unit) = f(4) four(m.y_=) m.y res3: Int = 4 Another successful day on StackExchange.

    Read the article

  • Passing an arbritrary JavaScript object in Xul

    - by Tom Brito
    I'm following this example to pass an object to a window, but when it as an argument it's with "undefined" value. This is my first window (obs. dump is the way to print to console when debug options are turned on): <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window id="windowID" width="400" height="300" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script> <![CDATA[ function onClickMe(event) { dump("begin\n"); try { var args = { param1: true, param2: 42 }; args.wrappedJSObject = args; var watcher = Components.classes["@mozilla.org/embedcomp/window-watcher;1"].getService(Components.interfaces.nsIWindowWatcher); watcher.openWindow(null, "chrome://XulWindowArgTest/content/about.xul", "windowName", "chrome", args); } catch (e) { dump("error: " + e + "\n"); } dump("end\n"); } ]]> </script> <button label="Click me !" oncommand="onClickMe();" /> </window> and my second window: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <!DOCTYPE window SYSTEM "chrome://XulWindowArgTest/locale/XulWindowArgTest.dtd"> <window xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul" onload="onload()"> <script> <![CDATA[ function onload() { dump('arg = ' + window.arguments[0].wrappedJSObject + "\n"); } ]]> </script> <label value="test" /> </window> when the second window loads, it calls the onload and prints: arg = undefined Any idea how to fix it?

    Read the article

  • JQuery click anywhere except certain divs and issues with dynamically added html

    - by jCuga
    I want this webpage to highlight certain elements when you click on one of them, but if you click anywhere else on the page, then all of these elements should no longer be highlighted. I accomplished this task by the following, and it works just fine except for one thing (described below): $(document).click(function() { // Do stuff when clicking anywhere but on elements of class suggestion_box $(".suggestion_box").css('background-color', '#FFFFFF'); }); $(".suggestion_box").click(function() { // means you clicked on an object belonging to class suggestion_box return false; }); // the code for handling onclicks for each element function clickSuggestion() { // remove all highlighting $(".suggestion_box").css('background-color', '#FFFFFF'); // then highlight only a specific item $("div[name=" + arguments[0] + "]").css('background-color', '#CCFFCC'); } This way of enforcing the highlighting of elements works fine until I add more html to the page without having a new page load. This is done by .append() and .prepend() What I suspected from debugging was that the page is not "aware" of the new elements that were added to the page dynamically. Despite the new, dynamically added elements having the appropriate class names/IDs/names/onclicks ect, they never get highlighted like the rest of the elements (which continue to work fine the entire time). I was wondering if a possible reason for why my approach does not work for the dynamically added content is that the page is not able to recognize the elements that were not present during the pageload. And if this is a possibility, then is there a way to reconcile this without a pageload? If this line of reasoning is wrong, then the code I have above is probably not enough to show what's wrong with my webpage. But I'm really just interested in whether or not this line of thought is a possibility.

    Read the article

  • C Map String to Function

    - by Scriptonaut
    So, I'm making a Unix minishell, and have come to a roadblock. I need to be able to execute built-in functions, so I made a function: int exec_if_built_in(char **args) It takes an array of strings(the first being the command, and the rest being arguments). For non built-in commands I simply use something like execvp, however I need to find a way to map the first string to a function. I was thinking of making two arrays, one of strings, and another with their corresponding function pointers. However, since many of these functions will be different(return and accept different things), this approach won't work. I also thought of making an array of structs with a name property and a function pointer property, however once again due to the varied nature of the functions I'll be using, this won't work. So, what's the best way to execute a function based on the input of a string? How do I map a string to a certain function? I'm not very familiar with function pointers so I may be missing something. Thank you guys for the help :)

    Read the article

  • get random password with puppet function

    - by ninja-2
    I have a function that allow me to generate random password. My function is working well without a puppetmaster. When i tried with a master an error appear when I called the function : Error 400 on SERVER: bad value for range Here is my function module Puppet::Parser::Functions newfunction(:get_random_password, :type => :rvalue, :doc => <<-EOS Returns a random password. EOS ) do |args| raise(Puppet::ParseError, "get_random_password(): Wrong number of arguments " + "given (#{args.size} for 1)") if args.size != 1 specials = ((33..33).to_a + (35..38).to_a + (40..47).to_a + (58..64).to_a + (91..93).to_a + (95..96).to_a + (123..125).to_a).pack('U*').chars.to_a numbers = (0..9).to_a alphal = ('a'..'z').to_a alphau = ('A'..'Z').to_a length = args[0] CHARS = (alphal + specials + numbers + alphau) pwd = CHARS.sort_by { rand }.join[0...length] return pwd end end The function is called in both case with $pwd = get_random_password(10). When I specified the length directly in the function to 10 for example. the password is well generated in master mode. Have you any idea why i can't specify the lentgth value ? Thanks for any help.

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >