Search Results

Search found 4842 results on 194 pages for 'computation expression'.

Page 120/194 | < Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >

  • How can I apply a PSSM efficiently?

    - by flies
    I am fitting for position specific scoring matrices (PSSM aka Position Specific Weight Matrices). The fit I'm using is like simulated annealing, where I the perturb the PSSM, compare the prediction to experiment and accept the change if it improves agreement. This means I apply the PSSM millions of times per fit; performance is critical. In my particular problem, I'm applying a PSSM for an object of length L (~8 bp) at every position of a DNA sequence of length M (~30 bp) (so there are M-L+1 valid positions). I need an efficient algorithm to apply a PSSM. Can anyone help improve performance? My best idea is to convert the DNA into some kind of a matrix so that applying the PSSM is matrix multiplication. There are efficient linear algebra libraries out there (e.g. BLAS), but I'm not sure how best to turn an M-length DNA sequence into a matrix M x 4 matrix and then apply the PSSM at each position. The solution needs to work for higher order/dinucleotide terms in the PSSM - presumably this means representing the sequence-matrix for mono-nucleotides and separately for dinucleotides. My current solution iterates over each position m, then over each letter in word from m to m+L-1, adding the corresponding term in the matrix. I'm storing the matrix as a multi-dimensional STL vector, and profiling has revealed that a lot of the computation time is just accessing the elements of the PSSM (with similar performance bottlenecks accessing the DNA sequence). If someone has an idea besides matrix multiplication, I'm all ears.

    Read the article

  • Is there a good way to QuickCheck Happstack.State methods?

    - by Paul Kuliniewicz
    I have a set of Happstack.State MACID methods that I want to test using QuickCheck, but I'm having trouble figuring out the most elegant way to accomplish that. The problems I'm running into are: The only way to evaluate an Ev monad computation is in the IO monad via query or update. There's no way to create a purely in-memory MACID store; this is by design. Therefore, running things in the IO monad means there are temporary files to clean up after each test. There's no way to initialize a new MACID store except with the initialValue for the state; it can't be generated via Arbitrary unless I expose an access method that replaces the state wholesale. Working around all of the above means writing methods that only use features of MonadReader or MonadState (and running the test inside Reader or State instead of Ev. This means forgoing the use of getRandom or getEventClockTime and the like inside the method definitions. The only options I can see are: Run the methods in a throw-away on-disk MACID store, cleaning up after each test and settling for starting from initialValue each time. Write the methods to have most of the code run in a MonadReader or MonadState (which is more easily testable), and rely on a small amount of non-QuickCheck-able glue around it that calls getRandom or getEventClockTime as necessary. Is there a better solution that I'm overlooking?

    Read the article

  • Understanding F# Asynchronous Programming

    - by Yin Zhu
    I kind of know the syntax of asynchronous programming in F#. E.g. let downloadUrl(url:string) = async { let req = HttpWebRequest.Create(url) // Run operation asynchronously let! resp = req.AsyncGetResponse() let stream = resp.GetResponseStream() // Dispose 'StreamReader' when completed use reader = new StreamReader(stream) // Run asynchronously and then return the result return! reader.AsyncReadToEnd() } In F# expert book (and many other sources), they say like let! var = expr simply means "perform the asynchronous operation expr and bind the result to var when the operation completes. Then continue by executing the rest of the computation body" I also know that a new thread is created when performing async operation. My original understanding was that there are two parallel threads after the async operation, one doing I/O and one continuing to execute the async body at the same time. But in this example, I am confused at let! resp = req.AsyncGetResponse() let stream = resp.GetResponseStream() What happens if resp has not started yet and the thread in the async body wants to GetResponseStream? Is this a possible error? So maybe my original understanding was wrong. The quoted sentences in the F# expert book actually means that "creating a new thread, hang the current thread up, when the new thread finishes, wake up the body thread and continue", but in this case I don't see we could save any time. In the original understanding, the time is saved when there are several independent IO operations in one async block so that they could be done at the same time without intervention with each other. But here, if I don't get the response, I cannot create the stream; only I have stream, I can start reading the stream. Where's the time gained?

    Read the article

  • F# List SelectMany

    - by Tuomas Hietanen
    This is quite simple question but I didn't find an answer: Is there any Seq/List operation in F# to match the LINQ SelectMany? I know I can use System.Linq in F# if I want to. I know I can make a recursive method and use F# Computation Expressions (and make even more powerful things). But if I try to prove that F# List operations are more powerful than LINQ... .Where = List.filter .Select = List.map .Aggregate = List.fold ... In C# SelectMany usage syntax is pretty simple: var flattenedList = from i in items1 from j in items2 select ... Is there any easy direct match, List.flatten, List.bind or something like that? SelectMany has a couple of signatures, but the most complex one seems to be: IEnumerable<TResult> SelectMany<TSource, TCollection, TResult>( this IEnumerable<TSource> source, Func<TSource, IEnumerable<TCollection>> collectionSelector, Func<TSource, TCollection, TResult> resultSelector ); In F# terms this would be: ('a -> 'b list) -> ('a -> 'b -> 'c) -> 'a list -> 'c list

    Read the article

  • Existing LINQ extension method similar to Parallel.For?

    - by Joel Martinez
    The linq extension methods for ienumerable are very handy ... but not that useful if all you want to do is apply some computation to each item in the enumeration without returning anything. So I was wondering if perhaps I was just missing the right method, or if it truly doesn't exist as I'd rather use a built-in version if it's available ... but I haven't found one :-) I could have sworn there was a .ForEach method somewhere, but I have yet to find it. In the meantime, I did write my own version in case it's useful for anyone else: using System.Collections; using System.Collections.Generic; public delegate void Function<T>(T item); public delegate void Function(object item); public static class EnumerableExtensions { public static void For(this IEnumerable enumerable, Function func) { foreach (object item in enumerable) { func(item); } } public static void For<T>(this IEnumerable<T> enumerable, Function<T> func) { foreach (T item in enumerable) { func(item); } } } usage is: myEnumerable.For<MyClass>(delegate(MyClass item) { item.Count++; });

    Read the article

  • Java many to many association map

    - by Raphael Jolivet
    Hi, I have to classes, ClassA and ClassB and a "many to many" AssociationClass. I want to use a structure to hold the associations between A and B such as I can know, for each instance of A or B, which are their counterparts. I thought of using a Hashmap, with pair keys: Hasmap<Pair<ClassA, ClassB>, AssociationClass> associations; This way, I can add and remove an association between two instances of ClassA and ClassB, and I can query a relation for two given instances. However, I miss the feature of getting all associations defined for a given instance of ClassA or ClassB. I could do it by brute force and loop over all keys of the map to search for associations between a given instance, but this is inefficient and not elegant. Do you know of any data structure / free library that enables this ? I don't want to reinvent the wheel. Thanks in advance for your help, Raphael NB: This is not a "database" question. These objects are pure POJO used for live computation, I don't need persistence stuff.

    Read the article

  • What is the the relation between programming and mathematics?

    - by Math Grad
    Programmers seem to think that their work is quite mathematical. I understand this when you try to optimize something in performance, find the most efficient alogithm, etc.. But it patently seems false when you look at a billing application for a shop, or a systems software riddled with I/O calls. So what is it exactly? Is computation and associated programming really mathematical? Here I have in mind particularly the words of the philosopher Schopenhauer in mind: That arithmetic is the basest of all mental activities is proved by the fact that it is the only one that can be accomplished by means of a machine. Take, for instance, the reckoning machines that are so commonly used in England at the present time, and solely for the sake of convenience. But all analysis finitorum et infinitorum is fundamentally based on calculation. Therefore we may gauge the “profound sense of the mathematician,” of whom Lichtenberg has made fun, in that he says: “These so-called professors of mathematics have taken advantage of the ingenuousness of other people, have attained the credit of possessing profound sense, which strongly resembles the theologians’ profound sense of their own holiness.” I lifted the above quote from here. It seems that programmers are doing precisely the sort of mechanized base mental activity the grand old man is contemptuous about. So what exactly is the deal? Is programming really the "good" kind of mathematics, or just the baser type, or altogether something else just meant for business not to be confused with a pure discipline?

    Read the article

  • 500 Worker Threads, what kind of thread pool?

    - by Submerged
    I am wondering if this is the best way to do this. I have about 500 threads that run indefinitely, but Thread.sleep for a minute when done one cycle of processing. ExecutorService es = Executors.newFixedThreadPool(list.size()+1); for (int i = 0; i < list.size(); i++) { es.execute(coreAppVector.elementAt(i)); //coreAppVector is a vector of extends thread objects } The code that is executing is really simple and basically just this class aThread extends Thread { public void run(){ while(true){ Thread.sleep(ONE_MINUTE); //Lots of computation every minute } } } I do need a separate threads for each running task, so changing the architecture isn't an option. I tried making my threadPool size equal to Runtime.getRuntime().availableProcessors() which attempted to run all 500 threads, but only let 8 (4xhyperthreading) of them execute. The other threads wouldn't surrender and let other threads have their turn. I tried putting in a wait() and notify(), but still no luck. If anyone has a simple example or some tips, I would be grateful! Well, the design is arguably flawed. The threads implement Genetic-Programming or GP, a type of learning algorithm. Each thread analyzes advanced trends makes predictions. If the thread ever completes, the learning is lost. That said, I was hoping that sleep() would allow me to share some of the resources while one thread isn't "learning"

    Read the article

  • Improving the performance of XSL

    - by Rachel
    I am using the below XSL 2.0 code to find the ids of the text nodes that contains the list of indices that i give as input. the code works perfectly but in terms for performance it is taking a long time for huge files. Even for huge files if the index values are small then the result is quick in few ms. I am using saxon9he Java processor to execute the XSL. <xsl:variable name="insert-data" as="element(data)*"> <xsl:for-each-group select="doc($insert-file)/insert-data/data" group-by="xsd:integer(@index)"> <xsl:sort select="current-grouping-key()"/> <data index="{current-grouping-key()}" text-id="{generate-id( $main-root/descendant::text()[ sum((preceding::text(), .)/string-length(.)) ge current-grouping-key() ][1] )}"> <xsl:copy-of select="current-group()/node()"/> </data> </xsl:for-each-group> </xsl:variable> In the above solution if the index value is too huge say 270962 then the time taken for the XSL to execute is 83427ms. In huge files if the index value is huge say 4605415, 4605431 it takes several minutes to execute. Seems the computation of the variable "insert-data" takes time though it is a global variable and computed only once. Should the XSL be addessed or the processor? How can i improve the performance of the XSL.

    Read the article

  • On-Demand thumbnail creation with django and nginx

    - by sharjeel
    I want to generate thumbnails of images on the fly. My site is built with django and deployed using nginx which serves all the static content and communicates with django/apache using reverse proxy. Right now, for every image in my site, I generate all required sizes of thumbnails on-hand and deliver them when required. The problem is that whenever I change the size of a thumbnail, I have to regenerate all of them (and they are tons). However now I'd like to generate the thumbnail the first time it is accessed and later on nginx would deliver the same file over n over. If I delete that thumbnail file because of lesser accesses, it should get generated automatically the next time. Thumbnails in my case also have watermarks which require some computation logic of my application so a webserver thumbnail module might not work very well. The size of the thumbnail can be embedded in the URL. So http://www.example.com/thumbnail/abc_320x240.jpg gets the 320x240 size of the thumbnail. The approach I'm looking right now is to let nginx lookup the file and if it doesn't exist, forward the query to my django application which would create the thumbnail and send either the response or a redirect string. However I'm not sure about the concurrency issues and any other issues which might pop up later. What is the appropriate way to achieve this?

    Read the article

  • Pump Messages During Long Operations + C# (it is urgent)

    - by Newbie
    Hi I have a web service that is doing huge computation and is taking more than a minute. I have generated the proxy file of the web service and then from my client end I am using the dll(of course I generated the proxy dll). My client side code is TimeSeries3D t = new TimeSeries3D(); int portfolioId = 4387919; string[] str = new string[2]; str[0] = "MKT_CAP"; DateRange dr = new DateRange(); dr.mStartDate = DateTime.Today; dr.mEndDate = DateTime.Today; Service1 sc = new Service1(); t = sc.GetAttributesForPortfolio(portfolioId, true, str, dr); But since it is taking to much time for the server to compute, after 1 minute I am receiving an error message The CLR has been unable to transition from COM context 0x33caf30 to COM context 0x33cb0a0 for 60 seconds. The thread that owns the destination context/apartment is most likely either doing a non pumping wait or processing a very long running operation without pumping Windows messages. This situation generally has a negative performance impact and may even lead to the application becoming non responsive or memory usage accumulating continually over time. To avoid this problem, all single threaded apartment (STA) threads should use pumping wait primitives (such as CoWaitForMultipleHandles) and routinely pump messages during long running operations. Kindly guide me what to do? It is very urgent. Thanks

    Read the article

  • Swimlane Diagram Softwares with Expand/Collapse Features

    - by louis xie
    I've been searching real hard for a software which can fulfill my needs, but to no avail. I have a swimlane diagram which is extremely huge, and almost impossible to model using Visio or any traditional swimlane software. I would need to model both the operational process, as well as the interactions within an application and between different applications. Therefore, without wasting additional effort modelling these separately, I am looking for a solution which I can combine both views together. That is, possibly one which I can expand/collapse/group/ungroup processes/subprocesses together. Take a typical credit card process for instance, a hypothetical description of the swimlane could be as such: Customer submits application form to the bank Bank Officer A receives the application form and validates that it was correctly filled Bank Officer A submits application form to Bank Officer B for processing. Bank Officer B checks credit quality of the customer through Application X. Application X submits query to Application Y to retrieve Credit Report. Application X retrieves credit report and submits to Application Z for computation of credit scores Bank Officer B validates that customer is credit worthy, and submits application to Bank Officer C for processing. The above is an over-simplified credit card request process, and a purely hypothetical one. What I'm trying to drive at is, each of the above processes have sub-processes, and I want to be able to switch between a "detailed" view and "aggregated" view. If possible, add in time dependency of the different tasks, as well. I haven't been able to find one such software which could do this.

    Read the article

  • Natural problems to solve using closures

    - by m.u.sheikh
    I have read quite a few articles on closures, and, embarassingly enough, I still don't understand this concept! Articles explain how to create a closure with a few examples, but I don't see any point in paying much attention to them, as they largely look contrived examples. I am not saying all of them are contrived, just that the ones I found looked contrived, and I dint see how even after understanding them, I will be able to use them. So in order to understand closures, I am looking at a few real problems, that can be solved very naturally using closures. For instance, a natural way to explain recursion to a person could be to explain the computation of n!. It is very natural to understand a problem like computing the factorial of a number using recursion. Similarly, it is almost a no-brainer to find an element in an unsorted array by reading each element, and comparing with the number in question. Also, at a different level, doing Object-oriented programming also makes sense. So I am trying to find a number of problems that could be solved with or without closures, but using closures makes thinking about them and solving them easier. Also, there are two types to closures, where each call to a closure can create a copy of the environment variables, or reference the same variables. So what sort of problems can be solved more naturally in which of the closure implementations?

    Read the article

  • wpf: capturing mouse does not work

    - by amethyste
    hello I am developing an kind of outlook calendar application where I need to make the appointment resizable from mouse. My first try with a thumb did not work properly so I tried another way. What I did is that: 1) on the botton of the appointmennt panel I added a rectangle to figure out the resize zone (the thumb). The appointment panel is put on a grid panel. 2) I intercept down event on the rectangle and send event to this code: private Point startPoint; private void OnResizeElementMouseDown(object sender, MouseButtonEventArgs e) { e.Handled = true; this.MouseMove += new MouseEventHandler(ResizeEndElement_MouseMove); this.MouseLeftButtonUp += new MouseButtonEventHandler(OnResizeElementMouseUp); // some code to perform new height computation Mouse.Capture(this); } where this is the appointment panel that own the thumb. Decreasing height works well. But increasing is more difficult. If I move the mouse very very slowly it's OK, if I speed it up a little bit it tends to leave out the appointment panel and then all MouseMove event are lost. I thought Mouse.Capture() was propose to solve this kind of problem, but in fact not. Does anybody know what is wrong in my code?

    Read the article

  • Lookup table size reduction

    - by Ryan
    Hello: I have an application in which I have to store a couple of millions of integers, I have to store them in a Look up table, obviously I cannot store such amount of data in memory and in my requirements I am very limited I have to store the data in an embebedded system so I am very limited in the space, so I would like to ask you about recommended methods that I can use for the reduction of the look up table. I cannot use function approximation such as neural networks, the values needs to be in a table. The range of the integers is not known at the moment. When I say integers I mean a 32 bit value. Basically the idea is use some copmpression method to reduce the amount of memory but without losing many precision. This thing needs to run in hardware so the computation overhead cannot be very high. In my algorithm I have to access to one value of the table do some operations with it and after update the value. In the end what I should have is a function which I pass an index to it and then I get a value, and after I have to use another function to write a value in the table. I found one called tile coding http://www.cs.ualberta.ca/~sutton/book/8/node6.html, this one is based on several look up tables, does anyone know any other method?. Thanks.

    Read the article

  • Neural Networks or Human-computer interaction

    - by Shahin
    I will be entering my third year of university in my next academic year, once I've finished my placement year as a web developer, and I would like to hear some opinions on the two modules in the Title. I'm interested in both, however I want to pick one that will be relevant to my career and that I can apply to systems I develop. I'm doing an Internet Computing degree, it covers web development, networking, database work and programming. Though I have had myself set on becoming a web developer I'm not so sure about that any more so am trying not to limit myself to that area of development. I know HCI would help me as a web developer, but do you think it's worth it? Do you think Neural Network knowledge could help me realistically in a system I write in the future? Thanks. EDIT: Hi guys, I thought it would be useful to follow-up with what I decided to do and how it's worked out. I picked Artificial Neural Networks over HCI, and I've really enjoyed it. Having a peek into cognitive science and machine learning has ignited my interest for the subject area, and I will be hoping to take on a postgraduate project a few years from now when I can afford it. I have got a job which I am starting after my final exams (which are in a few days) and I was indeed asked if I had done a module in HCI or similar. It didn't seem to matter, as it isn't a front-end developer position! I would recommend taking the module if you have it as an option, as well as any module consisting of biological computation, it will open up more doors should you want to go onto postgraduate research in the future. Thanks again, Shahin

    Read the article

  • Pump Messages During Long Operations + C#

    - by Newbie
    Hi I have a web service that is doing huge computation and is taking more than a minute. I have generated the proxy file of the web service and then from my client end I am using the dll(of course I generated the proxy dll). My client side code is TimeSeries3D t = new TimeSeries3D(); int portfolioId = 4387919; string[] str = new string[2]; str[0] = "MKT_CAP"; DateRange dr = new DateRange(); dr.mStartDate = DateTime.Today; dr.mEndDate = DateTime.Today; Service1 sc = new Service1(); t = sc.GetAttributesForPortfolio(portfolioId, true, str, dr); But since it is taking to much time for the server to compute, after 1 minute I am receiving an error message The CLR has been unable to transition from COM context 0x33caf30 to COM context 0x33cb0a0 for 60 seconds. The thread that owns the destination context/apartment is most likely either doing a non pumping wait or processing a very long running operation without pumping Windows messages. This situation generally has a negative performance impact and may even lead to the application becoming non responsive or memory usage accumulating continually over time. To avoid this problem, all single threaded apartment (STA) threads should use pumping wait primitives (such as CoWaitForMultipleHandles) and routinely pump messages during long running operations. Kindly guide me what to do? Thanks

    Read the article

  • Reversible numerical calculations in Prolog

    - by user8472
    While reading SICP I came across logic programming chapter 4.4. Then I started looking into the Prolog programming language and tried to understand some simple assignments in Prolog. I found that Prolog seems to have troubles with numerical calculations. Here is the computation of a factorial in standard Prolog: f(0, 1). f(A, B) :- A > 0, C is A-1, f(C, D), B is A*D. The issues I find is that I need to introduce two auxiliary variables (C and D), a new syntax (is) and that the problem is non-reversible (i.e., f(5,X) works as expected, but f(X,120) does not). Naively, I expect that at the very least C is A-1, f(C, D) above may be replaced by f(A-1,D), but even that does not work. My question is: Why do I need to do this extra "stuff" in numerical calculations but not in other queries? I do understand (and SICP is quite clear about it) that in general information on "what to do" is insufficient to answer the question of "how to do it". So the declarative knowledge in (at least some) math problems is insufficient to actually solve these problems. But that begs the next question: How does this extra "stuff" in Prolog help me to restrict the formulation to just those problems where "what to do" is sufficient to answer "how to do it"?

    Read the article

  • Thread-safety of read-only memory access

    - by Edmund
    I've implemented the Barnes-Hut gravity algorithm in C as follows: Build a tree of clustered stars. For each star, traverse the tree and apply the gravitational forces from each applicable node. Update the star velocities and positions. Stage 2 is the most expensive stage, and so is implemented in parallel by dividing the set of stars. E.g. with 1000 stars and 2 threads, I have one thread processing the first 500 stars and the second thread processing the second 500. In practice this works: it speeds the computation by about 30% with two threads on a two-core machine, compared to the non-threaded version. Additionally, it yields the same numerical results as the original non-threaded version. My concern is that the two threads are accessing the same resource (namely, the tree) simultaneously. I have not added any synchronisation to the thread workers, so it's likely they will attempt to read from the same location at some point. Although access to the tree is strictly read-only I am not 100% sure it's safe. It has worked when I've tested it but I know this is no guarantee of correctness! Questions Do I need to make a private copy of the tree for each thread? Even if it is safe, are there performance problems of accessing the same memory from multiple threads?

    Read the article

  • Numerical calculations in Prolog

    - by user8472
    While reading SICP I came across logic programming chapter 4.4. Then I started looking into the Prolog programming language and tried to understand some simple assignments in Prolog. I found that Prolog seems to have troubles with numerical calculations. Here is the computation of a factorial in standard Prolog: f(0, 1). f(A, B) :- A > 0, C is A-1, f(C, D), B is A*D. The issues I find is that I need to introduce two auxiliary variables (C and D), a new syntax (is) and that the problem is non-reversible (i.e., f(5,X) works as expected, but f(X,120) does not). Naively, I expect that at the very least C is A-1, f(C, D) above may be replaced by f(A-1,D), but even that does not work. My question is: Why do I need to do this extra "stuff" in numerical calculations but not in other queries? I do understand (and SICP is quite clear about it) that in general information on "what to do" is insufficient to answer the question of "how to do it". So the declarative knowledge in (at least some) math problems is insufficient to actually solve these problems. But that begs the next question: How does this extra "stuff" in Prolog help me to restrict the formulation to just those problems where "what to do" is sufficient to answer "how to do it"?

    Read the article

  • Time with and without OpenMP

    - by was
    I have a question.. I tried to improve a well known program algorithm in C, FOX algorithm for matrix multiplication.. relative link without openMP: (http://web.mst.edu/~ercal/387/MPI/ppmpi_c/chap07/fox.c). The initial program had only MPI and I tried to insert openMP in the matrix multiplication method, in order to improve the time of computation: (This program runs in a cluster and computers have 2 cores, thus I created 2 threads.) The problem is that there is no difference of time, with and without openMP. I observed that using openMP sometimes, time is equivalent or greater than the time without openMP. I tried to multiply two 600x600 matrices. void Local_matrix_multiply( LOCAL_MATRIX_T* local_A /* in */, LOCAL_MATRIX_T* local_B /* in */, LOCAL_MATRIX_T* local_C /* out */) { int i, j, k; chunk = CHUNKSIZE; // 100 #pragma omp parallel shared(local_A, local_B, local_C, chunk, nthreads) private(i,j,k,tid) num_threads(2) { /* tid = omp_get_thread_num(); if(tid == 0){ nthreads = omp_get_num_threads(); printf("O Pollaplasiamos pinakwn ksekina me %d threads\n", nthreads); } printf("Thread %d use the matrix: \n", tid); */ #pragma omp for schedule(static, chunk) for (i = 0; i < Order(local_A); i++) for (j = 0; j < Order(local_A); j++) for (k = 0; k < Order(local_B); k++) Entry(local_C,i,j) = Entry(local_C,i,j) + Entry(local_A,i,k)*Entry(local_B,k,j); } //end pragma omp parallel } /* Local_matrix_multiply */

    Read the article

  • Problem with Boost::Asio for C++

    - by Martin Lauridsen
    Hi there, For my bachelors thesis, I am implementing a distributed version of an algorithm for factoring large integers (finding the prime factorisation). This has applications in e.g. security of the RSA cryptosystem. My vision is, that clients (linux or windows) will download an application and compute some numbers (these are independant, thus suited for parallelization). The numbers (not found very often), will be sent to a master server, to collect these numbers. Once enough numbers have been collected by the master server, it will do the rest of the computation, which cannot be easily parallelized. Anyhow, to the technicalities. I was thinking to use Boost::Asio to do a socket client/server implementation, for the clients communication with the master server. Since I want to compile for both linux and windows, I thought windows would be as good a place to start as any. So I downloaded the Boost library and compiled it, as it said on the Boost Getting Started page: bootstrap .\bjam It all compiled just fine. Then I try to compile one of the tutorial examples, client.cpp, from Asio, found (here.. edit: cant post link because of restrictions). I am using the Visual C++ compiler from Microsoft Visual Studio 2008, like this: cl /EHsc /I D:\Downloads\boost_1_42_0 client.cpp But I get this error: /out:client.exe client.obj LINK : fatal error LNK1104: cannot open file 'libboost_system-vc90-mt-s-1_42.lib' Anyone have any idea what could be wrong, or how I could move forward? I have been trying pretty much all week, to get a simple client/server socket program for c++ working, but with no luck. Serious frustration kicking in. Thank you in advance.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Can piping of screen to file change the result of a C++ code?

    - by Biga
    I am having this very weird behaviour with a C++ code: It gives me different results when running with and without piping the screen to a file (reproducible in cygwin and linux). I mean, if I get the same executable and run it like './run' or run it like './run out.log', I get different results! I use std::cout to output to screen, all lines ending with endl; I use ifstream for the input file; I use ofstream for output, all lines ending with endl. I am using g++ 4. Any idea what is going on? UPDATE: I have hard-coded the input data, so 'ifstream' is not used, and problem persists. UPDATE 2: That's getting interesting. I have output three variables that are computed initially, and that's what I get with and without piping direct to screen: 0 -0.02 0 piped: 0 -0.02 1.04083e-17 So there's a round-off difference with and without piping the output! Now, why piping would interefere with an internal computation of the code?

    Read the article

  • Longer execution through Java shell than console?

    - by czuk
    I have a script in Python which do some computations. When I run this script in console it takes about 7 minutes to complete but when I run it thought Java shell it takes three times longer. I use following code to execute the script in Java: this.p = Runtime.getRuntime().exec("script.py --batch", envp); this.input = new BufferedReader(new InputStreamReader(p.getInputStream())); this.output = new BufferedWriter(new OutputStreamWriter(p.getOutputStream())); this.error = new BufferedReader(new InputStreamReader(p.getErrorStream())); Do you have any suggestion why the Python script runs three time longer in Java than in a console? update The computation goes as follow: Java sends data to the Python. Python reads the data. Python generates a decision tree --- this is a long operation. Python sends a confirmation that the tree is ready. Java receives the confirmation. Later there is a series of communications between Java and Python but it takes only several second.

    Read the article

< Previous Page | 116 117 118 119 120 121 122 123 124 125 126 127  | Next Page >