Search Results

Search found 4842 results on 194 pages for 'computation expression'.

Page 121/194 | < Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >

  • Can piping of screen to file change the result of a C++ code?

    - by Biga
    I am having this very weird behaviour with a C++ code: It gives me different results when running with and without piping the screen to a file (reproducible in cygwin and linux). I mean, if I get the same executable and run it like './run' or run it like './run out.log', I get different results! I use std::cout to output to screen, all lines ending with endl; I use ifstream for the input file; I use ofstream for output, all lines ending with endl. I am using g++ 4. Any idea what is going on? UPDATE: I have hard-coded the input data, so 'ifstream' is not used, and problem persists. UPDATE 2: That's getting interesting. I have output three variables that are computed initially, and that's what I get with and without piping direct to screen: 0 -0.02 0 piped: 0 -0.02 1.04083e-17 So there's a round-off difference with and without piping the output! Now, why piping would interefere with an internal computation of the code?

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • What OpenGL functions are not GPU accelerated?

    - by Xavier Ho
    I was shocked when I read this (from the OpenGL wiki): glTranslate, glRotate, glScale Are these hardware accelerated? No, there are no known GPUs that execute this. The driver computes the matrix on the CPU and uploads it to the GPU. All the other matrix operations are done on the CPU as well : glPushMatrix, glPopMatrix, glLoadIdentity, glFrustum, glOrtho. This is the reason why these functions are considered deprecated in GL 3.0. You should have your own math library, build your own matrix, upload your matrix to the shader. For a very, very long time I thought most of the OpenGL functions use the GPU to do computation. I'm not sure if this is a common misconception, but after a while of thinking, this makes sense. Old OpenGL functions (2.x and older) are really not suitable for real-world applications, due to too many state switches. This makes me realise that, possibly, many OpenGL functions do not use the GPU at all. So, the question is: Which OpenGL function calls don't use the GPU? I believe knowing the answer to the above question would help me become a better programmer with OpenGL. Please do share some of your insights.

    Read the article

  • Java: fastest way to do random reads on huge disk file(s)

    - by cocotwo
    I've got a moderately big set of data, about 800 MB or so, that is basically some big precomputed table that I need to speed some computation by several orders of magnitude (creating that file took several mutlicores computers days to produce using an optimized and multi-threaded algo... I do really need that file). Now that it has been computed once, that 800MB of data is read only. I cannot hold it in memory. As of now it is one big huge 800MB file but splitting in into smaller files ain't a problem if it can help. I need to read about 32 bits of data here and there in that file a lot of time. I don't know before hand where I'll need to read these data: the reads are uniformly distributed. What would be the fastest way in Java to do my random reads in such a file or files? Ideally I should be doing these reads from several unrelated threads (but I could queue the reads in a single thread if needed). Is Java NIO the way to go? I'm not familiar with 'memory mapped file': I think I don't want to map the 800 MB in memory. All I want is the fastest random reads I can get to access these 800MB of disk-based data. btw in case people wonder this is not at all the same as the question I asked not long ago: http://stackoverflow.com/questions/2346722/java-fast-disk-based-hash-set

    Read the article

  • Template trick to optimize out allocations

    - by anon
    I have: struct DoubleVec { std::vector<double> data; }; DoubleVec operator+(const DoubleVec& lhs, const DoubleVec& rhs) { DoubleVec ans(lhs.size()); for(int i = 0; i < lhs.size(); ++i) { ans[i] = lhs[i]] + rhs[i]; // assume lhs.size() == rhs.size() } return ans; } DoubleVec someFunc(DoubleVec a, DoubleVec b, DoubleVec c, DoubleVec d) { DoubleVec ans = a + b + c + d; } Now, in the above, the "a + b + c + d" will cause the creation of 3 temporary DoubleVec's -- is there a way to optimize this away with some type of template magic ... i.e. to optimize it down to something equivalent to: DoubleVec ans(a.size()); for(int i = 0; i < ans.size(); i++) ans[i] = a[i] + b[i] + c[i] + d[i]; You can assume all DoubleVec's have the same # of elements. The high level idea is to have do some type of templateied magic on "+", which "delays the computation" until the =, at which point it looks into itself, goes hmm ... I'm just adding thes numbers, and syntheizes a[i] + b[i] + c[i] + d[i] ... instead of all the temporaries. Thanks!

    Read the article

  • Load page for validation but do not display it to user in ASP.NET

    - by Kevin
    We have a site requiring users pay $2 to view the details of a record. We occasionally get complaints because we send them to the payment page, and once they pay it turns out the record isn't valid, or it was lost, or the data couldn't be generated. So we want to add in a check to ensure the page constructs properly before the user is required to pay for it. However, we don't want the user to have access to the page until they pay for it. Is there anything in ASP.NET 3.5 or just general web design that would allow something like this? The data on the record is real time and computed on a backend server before sent to the client. Occasionally this computation fails for whatever reason. Our alternative is to call all of the loading methods and validate the data, then redirect them to the payment page. The problem is A) this will be a relatively involved process rewriting all of these methods to return validation information, and B) it still doesn't guarentee us the page will load properly. Any thoughts?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Which OpenGL functions are not GPU-accelerated?

    - by Xavier Ho
    I was shocked when I read this (from the OpenGL wiki): glTranslate, glRotate, glScale Are these hardware accelerated? No, there are no known GPUs that execute this. The driver computes the matrix on the CPU and uploads it to the GPU. All the other matrix operations are done on the CPU as well : glPushMatrix, glPopMatrix, glLoadIdentity, glFrustum, glOrtho. This is the reason why these functions are considered deprecated in GL 3.0. You should have your own math library, build your own matrix, upload your matrix to the shader. For a very, very long time I thought most of the OpenGL functions use the GPU to do computation. I'm not sure if this is a common misconception, but after a while of thinking, this makes sense. Old OpenGL functions (2.x and older) are really not suitable for real-world applications, due to too many state switches. This makes me realise that, possibly, many OpenGL functions do not use the GPU at all. So, the question is: Which OpenGL function calls don't use the GPU? I believe knowing the answer to the above question would help me become a better programmer with OpenGL. Please do share some of your insights.

    Read the article

  • Triangulation & Direct linear transform

    - by srand
    Following Hartley/Zisserman's Multiview Geometery, Algorithm 12: The optimal triangulation method (p318), I got the corresponding image points xhat1 and xhat2 (step 10). In step 11, one needs to compute the 3D point Xhat. One such method is Direct Linear Transform (DLT), mentioned in 12.2 (p312) and 4.1 (p88). The homogenous method (DLT), p312-313, states that it finds a solution as the unit singular vector corresponding to the smallest singular value of A, thus, A = [xhat1(1) * P1(3,:)' - P1(1,:)' ; xhat1(2) * P1(3,:)' - P1(2,:)' ; xhat2(1) * P2(3,:)' - P2(1,:)' ; xhat2(2) * P2(3,:)' - P2(2,:)' ]; [Ua Ea Va] = svd(A); Xhat = Va(:,end); plot3(Xhat(1),Xhat(2),Xhat(3), 'r.'); However, A is a 16x1 matrix, resulting in a Va that is 1x1. What am I doing wrong (and a fix) in getting the 3D point? For what its worth sample data: xhat1 = 1.0e+009 * 4.9973 -0.2024 0.0027 xhat2 = 1.0e+011 * 2.0729 2.6624 0.0098 P1 = 699.6674 0 392.1170 0 0 701.6136 304.0275 0 0 0 1.0000 0 P2 = 1.0e+003 * -0.7845 0.0508 -0.1592 1.8619 -0.1379 0.7338 0.1649 0.6825 -0.0006 0.0001 0.0008 0.0010 A = <- my computation 1.0e+011 * -0.0000 0 0.0500 0 0 -0.0000 -0.0020 0 -1.3369 0.2563 1.5634 2.0729 -1.7170 0.3292 2.0079 2.6624

    Read the article

  • Migrating Ajax web application to web socket

    - by Bastan
    Hi, I think i'm just missing a little detail that is preventing me from seeing the whole picture. I have a web application which use ajax request every x time to update client with new information or tasks. I also have a long running process on the server which is a java computation engine. I would like this engine to send update to the client. I am wondering how to migrate my web app to using websocket. Probably phpwebsocket or similar. Can my server 'decide' to send information to a specific client? It seems possible looking at the php-websocket. Can my java backend long process use the websocket server to send notification to a specific client. How? well I can say that my java app could use a class that could send over websocket instead of http. But how the websocket server knows to which client to send the 'info'. I am puzzle by all this. Any document that explain this in more details? It seems that the websocket could create an instance of my web application. Thanks

    Read the article

  • converting a UTC time to a local time zone in Java

    - by aloo
    I know this subject has been beaten to death but after searching for a few hours to this problem I had to ask. My Problem: do calculations on dates on a server based on the current time zone of a client app (iphone). The client app tells the server, in seconds, how far away its time zone is away from GMT. I would like to then use this information to do computation on dates in the server. The dates on the server are all stored as UTC time. So I would like to get the HOUR of a UTC Date object after it has been converted to this local time zone. My current attempt: int hours = (int) Math.floor(secondsFromGMT / (60.0 * 60.0)); int mins = (int) Math.floor((secondsFromGMT - (hours * 60.0 * 60.0)) / 60.0); String sign = hours > 0 ? "+" : "-"; Calendar now = Calendar.getInstance(); TimeZone t = TimeZone.getTimeZone("GMT" + sign + hours + ":" + mins); now.setTimeZone(t); now.setTime(someDateTimeObject); int hourOfDay = now.get(Calendar.HOUR_OF_DAY); The variables hour and mins represent the hour and mins the local time zone is away from GMT. After debugging this code - the variables hour, mins and sign are correct. The problem is hourOfDay does not return the correct hour - it is returning the hour as of UTC time and not local time. Ideas?

    Read the article

  • A good way to write unit tests

    - by bobobobo
    So, I previously wasn't really in the practice of writing unit tests - now I kind of am and I need to check if I'm on the right track. Say you have a class that deals with math computations. class Vector3 { public: // Yes, public. float x,y,z ; // ... ctors ... } ; Vector3 operator+( const Vector3& a, const Vector3 &b ) { return Vector3( a.x + b.y /* oops!! hence the need for unit testing.. */, a.y + b.y, a.z + b.z ) ; } There are 2 ways I can really think of to do a unit test on a Vector class: 1) Hand-solve some problems, then hard code the numbers into the unit test and pass only if equal to your hand and hard-coded result bool UnitTest_ClassVector3_operatorPlus() { Vector3 a( 2, 3, 4 ) ; Vector3 b( 5, 6, 7 ) ; Vector3 result = a + b ; // "expected" is computed outside of computer, and // hard coded here. For more complicated operations like // arbitrary axis rotation this takes a bit of paperwork, // but only the final result will ever be entered here. Vector3 expected( 7, 9, 11 ) ; if( result.isNear( expected ) ) return PASS ; else return FAIL ; } 2) Rewrite the computation code very carefully inside the unit test. bool UnitTest_ClassVector3_operatorPlus() { Vector3 a( 2, 3, 4 ) ; Vector3 b( 5, 6, 7 ) ; Vector3 result = a + b ; // "expected" is computed HERE. This // means all you've done is coded the // same thing twice, hopefully not having // repeated the same mistake again Vector3 expected( 2 + 5, 6 + 3, 4 + 7 ) ; if( result.isNear( expected ) ) return PASS ; else return FAIL ; } Or is there another way to do something like this?

    Read the article

  • Outer product using CBLAS

    - by The Dude
    I am having trouble utilizing CBLAS to perform an Outer Product. My code is as follows: //===SET UP===// double x1[] = {1,2,3,4}; double x2[] = {1,2,3}; int dx1 = 4; int dx2 = 3; double X[dx1 * dx2]; for (int i = 0; i < (dx1*dx2); i++) {X[i] = 0.0;} //===DO THE OUTER PRODUCT===// cblas_dgemm(CblasRowMajor, CblasNoTrans, CblasTrans, dx1, dx2, 1, 1.0, x1, dx1, x2, 1, 0.0, X, dx1); //===PRINT THE RESULTS===// printf("\nMatrix X (%d x %d) = x1 (*) x2 is:\n", dx1, dx2); for (i=0; i<4; i++) { for (j=0; j<3; j++) { printf ("%lf ", X[j+i*3]); } printf ("\n"); } I get: Matrix X (4 x 3) = x1 (*) x2 is: 1.000000 2.000000 3.000000 0.000000 -1.000000 -2.000000 -3.000000 0.000000 7.000000 14.000000 21.000000 0.000000 But the correct answer is found here: https://www.sharcnet.ca/help/index.php/BLAS_and_CBLAS_Usage_and_Examples I have seen: Efficient computation of kronecker products in C But, it doesn't help me because they don't actually say how to utilize dgemm to actually do this... Any help? What am I doing wrong here?

    Read the article

  • How (and if) to write a single-consumer queue using the task parallel library?

    - by Eric
    I've heard a bunch of podcasts recently about the TPL in .NET 4.0. Most of them describe background activities like downloading images or doing a computation, using tasks so that the work doesn't interfere with a GUI thread. Most of the code I work on has more of a multiple-producer / single-consumer flavor, where work items from multiple sources must be queued and then processed in order. One example would be logging, where log lines from multiple threads are sequentialized into a single queue for eventual writing to a file or database. All the records from any single source must remain in order, and records from the same moment in time should be "close" to each other in the eventual output. So multiple threads or tasks or whatever are all invoking a queuer: lock( _queue ) // or use a lock-free queue! { _queue.enqueue( some_work ); _queueSemaphore.Release(); } And a dedicated worker thread processes the queue: while( _queueSemaphore.WaitOne() ) { lock( _queue ) { some_work = _queue.dequeue(); } deal_with( some_work ); } It's always seemed reasonable to dedicate a worker thread for the consumer side of these tasks. Should I write future programs using some construct from the TPL instead? Which one? Why?

    Read the article

  • Travelling software. Is that a concept?

    - by Bubba88
    Hi! This is barely a sensible question. I would like to ask if there existed a program, which were intended to travel (for example following some physical forces) across the planet, possibly occupying and freeing computational resources/nodes. Literally that means that some agent-based system is just regularly changing it's location and (inevitably to some extent) configuration. An example would be: suppose you have external sensors, and free computers - nodes - across the space; would it make sense to self-replicate agents to follow the initializers from sensors, but in such restrictive manner that the computation is only localized at where the physical business is going on. I want to stress that this question is just for 'theoretical' fun, cause I cannot see any practical benefits of the restrictions mentioned, apart from the optimization of 'outdated' (outplaced?) agent disposal. But maybe it could be of some interest. Thank you! EDIT: It's obvious that a virus is fitting example, although the deletion of such agents is rarely of concern of the developers. More precisely, I'm interested in 'travelling' software - that is, when the count (or at least order) of the agents is kind of constant, and it's just the whole system who travels.

    Read the article

  • Unit Conversion from feet to meters

    - by user1742419
    I have to write a program that reads in a length in feet and inches and outputs the equivalent length in meters and centimeters. I have to create three functions: one for input, one or more for calculating, and one for output; And include a loop that lets the user repeat this computation for new input values until the user says he or she wants to end the program. I can't seem to get the input from one function to be used in the conversion function and then outputted by the next function. How do I do that? Thank you. #include <iostream> #include <conio.h> using namespace std; double leng; void length(double leng); double conv(double leng); void output(double leng); int main() { length(leng); conv(leng); output(leng); _getche(); return 0; } void length(double leng) { cout<<"Enter a length in feet, then enter a length in inches if needed: "; cin>>leng; return; } double conv(double leng) { return leng = leng * .3048; } void output(double leng) { cout<<"Your input is converted to "<<leng; return; }

    Read the article

  • C non-trivial constants

    - by user525869
    I want to make several constants in C with #define to speed up computation. Two of them are not simply trivial numbers, where one is a right shift, the other is a power. math.h in C gives the function pow() for doubles, whereas I need powers for integers, so I wrote my own function, ipow, so I wouldn't need to be casting everytime. My question is this: One of the #define constants I want to make is a power, say ipow(M, T), where M and T were also #define constants. ipow is a function in the actual code, so this actually seems to slows things down when I run the code (is it running ipow everytime the constant is mentioned?). However, when I ues the built in pow function and just do (int)pow(M,T), the code is sped up. I'm confused as to why this is, since the ipow and pow functions are just as fast. On a more general note, can I define constants using #define using functions inside the actual code? The above example has me confused on whether this speeds things up or actually slows things down.

    Read the article

  • What's New in ASP.NET 4

    - by Navaneeth
    The .NET Framework version 4 includes enhancements for ASP.NET 4 in targeted areas. Visual Studio 2010 and Microsoft Visual Web Developer Express also include enhancements and new features for improved Web development. This document provides an overview of many of the new features that are included in the upcoming release. This topic contains the following sections: ASP.NET Core Services ASP.NET Web Forms ASP.NET MVC Dynamic Data ASP.NET Chart Control Visual Web Developer Enhancements Web Application Deployment with Visual Studio 2010 Enhancements to ASP.NET Multi-Targeting ASP.NET Core Services ASP.NET 4 introduces many features that improve core ASP.NET services such as output caching and session state storage. Extensible Output Caching Since the time that ASP.NET 1.0 was released, output caching has enabled developers to store the generated output of pages, controls, and HTTP responses in memory. On subsequent Web requests, ASP.NET can serve content more quickly by retrieving the generated output from memory instead of regenerating the output from scratch. However, this approach has a limitation — generated content always has to be stored in memory. On servers that experience heavy traffic, the memory requirements for output caching can compete with memory requirements for other parts of a Web application. ASP.NET 4 adds extensibility to output caching that enables you to configure one or more custom output-cache providers. Output-cache providers can use any storage mechanism to persist HTML content. These storage options can include local or remote disks, cloud storage, and distributed cache engines. Output-cache provider extensibility in ASP.NET 4 lets you design more aggressive and more intelligent output-caching strategies for Web sites. For example, you can create an output-cache provider that caches the "Top 10" pages of a site in memory, while caching pages that get lower traffic on disk. Alternatively, you can cache every vary-by combination for a rendered page, but use a distributed cache so that the memory consumption is offloaded from front-end Web servers. You create a custom output-cache provider as a class that derives from the OutputCacheProvider type. You can then configure the provider in the Web.config file by using the new providers subsection of the outputCache element For more information and for examples that show how to configure the output cache, see outputCache Element for caching (ASP.NET Settings Schema). For more information about the classes that support caching, see the documentation for the OutputCache and OutputCacheProvider classes. By default, in ASP.NET 4, all HTTP responses, rendered pages, and controls use the in-memory output cache. The defaultProvider attribute for ASP.NET is AspNetInternalProvider. You can change the default output-cache provider used for a Web application by specifying a different provider name for defaultProvider attribute. In addition, you can select different output-cache providers for individual control and for individual requests and programmatically specify which provider to use. For more information, see the HttpApplication.GetOutputCacheProviderName(HttpContext) method. The easiest way to choose a different output-cache provider for different Web user controls is to do so declaratively by using the new providerName attribute in a page or control directive, as shown in the following example: <%@ OutputCache Duration="60" VaryByParam="None" providerName="DiskCache" %> Preloading Web Applications Some Web applications must load large amounts of data or must perform expensive initialization processing before serving the first request. In earlier versions of ASP.NET, for these situations you had to devise custom approaches to "wake up" an ASP.NET application and then run initialization code during the Application_Load method in the Global.asax file. To address this scenario, a new application preload manager (autostart feature) is available when ASP.NET 4 runs on IIS 7.5 on Windows Server 2008 R2. The preload feature provides a controlled approach for starting up an application pool, initializing an ASP.NET application, and then accepting HTTP requests. It lets you perform expensive application initialization prior to processing the first HTTP request. For example, you can use the application preload manager to initialize an application and then signal a load-balancer that the application was initialized and ready to accept HTTP traffic. To use the application preload manager, an IIS administrator sets an application pool in IIS 7.5 to be automatically started by using the following configuration in the applicationHost.config file: <applicationPools> <add name="MyApplicationPool" startMode="AlwaysRunning" /> </applicationPools> Because a single application pool can contain multiple applications, you specify individual applications to be automatically started by using the following configuration in the applicationHost.config file: <sites> <site name="MySite" id="1"> <application path="/" serviceAutoStartEnabled="true" serviceAutoStartProvider="PrewarmMyCache" > <!-- Additional content --> </application> </site> </sites> <!-- Additional content --> <serviceAutoStartProviders> <add name="PrewarmMyCache" type="MyNamespace.CustomInitialization, MyLibrary" /> </serviceAutoStartProviders> When an IIS 7.5 server is cold-started or when an individual application pool is recycled, IIS 7.5 uses the information in the applicationHost.config file to determine which Web applications have to be automatically started. For each application that is marked for preload, IIS7.5 sends a request to ASP.NET 4 to start the application in a state during which the application temporarily does not accept HTTP requests. When it is in this state, ASP.NET instantiates the type defined by the serviceAutoStartProvider attribute (as shown in the previous example) and calls into its public entry point. You create a managed preload type that has the required entry point by implementing the IProcessHostPreloadClient interface, as shown in the following example: public class CustomInitialization : System.Web.Hosting.IProcessHostPreloadClient { public void Preload(string[] parameters) { // Perform initialization. } } After your initialization code runs in the Preload method and after the method returns, the ASP.NET application is ready to process requests. Permanently Redirecting a Page Content in Web applications is often moved over the lifetime of the application. This can lead to links to be out of date, such as the links that are returned by search engines. In ASP.NET, developers have traditionally handled requests to old URLs by using the Redirect method to forward a request to the new URL. However, the Redirect method issues an HTTP 302 (Found) response (which is used for a temporary redirect). This results in an extra HTTP round trip. ASP.NET 4 adds a RedirectPermanent helper method that makes it easy to issue HTTP 301 (Moved Permanently) responses, as in the following example: RedirectPermanent("/newpath/foroldcontent.aspx"); Search engines and other user agents that recognize permanent redirects will store the new URL that is associated with the content, which eliminates the unnecessary round trip made by the browser for temporary redirects. Session State Compression By default, ASP.NET provides two options for storing session state across a Web farm. The first option is a session state provider that invokes an out-of-process session state server. The second option is a session state provider that stores data in a Microsoft SQL Server database. Because both options store state information outside a Web application's worker process, session state has to be serialized before it is sent to remote storage. If a large amount of data is saved in session state, the size of the serialized data can become very large. ASP.NET 4 introduces a new compression option for both kinds of out-of-process session state providers. By using this option, applications that have spare CPU cycles on Web servers can achieve substantial reductions in the size of serialized session state data. You can set this option using the new compressionEnabled attribute of the sessionState element in the configuration file. When the compressionEnabled configuration option is set to true, ASP.NET compresses (and decompresses) serialized session state by using the .NET Framework GZipStreamclass. The following example shows how to set this attribute. <sessionState mode="SqlServer" sqlConnectionString="data source=dbserver;Initial Catalog=aspnetstate" allowCustomSqlDatabase="true" compressionEnabled="true" /> ASP.NET Web Forms Web Forms has been a core feature in ASP.NET since the release of ASP.NET 1.0. Many enhancements have been in this area for ASP.NET 4, such as the following: The ability to set meta tags. More control over view state. Support for recently introduced browsers and devices. Easier ways to work with browser capabilities. Support for using ASP.NET routing with Web Forms. More control over generated IDs. The ability to persist selected rows in data controls. More control over rendered HTML in the FormView and ListView controls. Filtering support for data source controls. Enhanced support for Web standards and accessibility Setting Meta Tags with the Page.MetaKeywords and Page.MetaDescription Properties Two properties have been added to the Page class: MetaKeywords and MetaDescription. These two properties represent corresponding meta tags in the HTML rendered for a page, as shown in the following example: <head id="Head1" runat="server"> <title>Untitled Page</title> <meta name="keywords" content="keyword1, keyword2' /> <meta name="description" content="Description of my page" /> </head> These two properties work like the Title property does, and they can be set in the @ Page directive. For more information, see Page.MetaKeywords and Page.MetaDescription. Enabling View State for Individual Controls A new property has been added to the Control class: ViewStateMode. You can use this property to disable view state for all controls on a page except those for which you explicitly enable view state. View state data is included in a page's HTML and increases the amount of time it takes to send a page to the client and post it back. Storing more view state than is necessary can cause significant decrease in performance. In earlier versions of ASP.NET, you could reduce the impact of view state on a page's performance by disabling view state for specific controls. But sometimes it is easier to enable view state for a few controls that need it instead of disabling it for many that do not need it. For more information, see Control.ViewStateMode. Support for Recently Introduced Browsers and Devices ASP.NET includes a feature that is named browser capabilities that lets you determine the capabilities of the browser that a user is using. Browser capabilities are represented by the HttpBrowserCapabilities object which is stored in the HttpRequest.Browser property. Information about a particular browser's capabilities is defined by a browser definition file. In ASP.NET 4, these browser definition files have been updated to contain information about recently introduced browsers and devices such as Google Chrome, Research in Motion BlackBerry smart phones, and Apple iPhone. Existing browser definition files have also been updated. For more information, see How to: Upgrade an ASP.NET Web Application to ASP.NET 4 and ASP.NET Web Server Controls and Browser Capabilities. The browser definition files that are included with ASP.NET 4 are shown in the following list: •blackberry.browser •chrome.browser •Default.browser •firefox.browser •gateway.browser •generic.browser •ie.browser •iemobile.browser •iphone.browser •opera.browser •safari.browser A New Way to Define Browser Capabilities ASP.NET 4 includes a new feature referred to as browser capabilities providers. As the name suggests, this lets you build a provider that in turn lets you write custom code to determine browser capabilities. In ASP.NET version 3.5 Service Pack 1, you define browser capabilities in an XML file. This file resides in a machine-level folder or an application-level folder. Most developers do not need to customize these files, but for those who do, the provider approach can be easier than dealing with complex XML syntax. The provider approach makes it possible to simplify the process by implementing a common browser definition syntax, or a database that contains up-to-date browser definitions, or even a Web service for such a database. For more information about the new browser capabilities provider, see the What's New for ASP.NET 4 White Paper. Routing in ASP.NET 4 ASP.NET 4 adds built-in support for routing with Web Forms. Routing is a feature that was introduced with ASP.NET 3.5 SP1 and lets you configure an application to use URLs that are meaningful to users and to search engines because they do not have to specify physical file names. This can make your site more user-friendly and your site content more discoverable by search engines. For example, the URL for a page that displays product categories in your application might look like the following example: http://website/products.aspx?categoryid=12 By using routing, you can use the following URL to render the same information: http://website/products/software The second URL lets the user know what to expect and can result in significantly improved rankings in search engine results. the new features include the following: The PageRouteHandler class is a simple HTTP handler that you use when you define routes. You no longer have to write a custom route handler. The HttpRequest.RequestContext and Page.RouteData properties make it easier to access information that is passed in URL parameters. The RouteUrl expression provides a simple way to create a routed URL in markup. The RouteValue expression provides a simple way to extract URL parameter values in markup. The RouteParameter class makes it easier to pass URL parameter values to a query for a data source control (similar to FormParameter). You no longer have to change the Web.config file to enable routing. For more information about routing, see the following topics: ASP.NET Routing Walkthrough: Using ASP.NET Routing in a Web Forms Application How to: Define Routes for Web Forms Applications How to: Construct URLs from Routes How to: Access URL Parameters in a Routed Page Setting Client IDs The new ClientIDMode property makes it easier to write client script that references HTML elements rendered for server controls. Increasing use of Microsoft Ajax makes the need to do this more common. For example, you may have a data control that renders a long list of products with prices and you want to use client script to make a Web service call and update individual prices in the list as they change without refreshing the entire page. Typically you get a reference to an HTML element in client script by using the document.GetElementById method. You pass to this method the value of the id attribute of the HTML element you want to reference. In the case of elements that are rendered for ASP.NET server controls earlier versions of ASP.NET could make this difficult or impossible. You were not always able to predict what id values ASP.NET would generate, or ASP.NET could generate very long id values. The problem was especially difficult for data controls that would generate multiple rows for a single instance of the control in your markup. ASP.NET 4 adds two new algorithms for generating id attributes. These algorithms can generate id attributes that are easier to work with in client script because they are more predictable and that are easier to work with because they are simpler. For more information about how to use the new algorithms, see the following topics: ASP.NET Web Server Control Identification Walkthrough: Making Data-Bound Controls Easier to Access from JavaScript Walkthrough: Making Controls Located in Web User Controls Easier to Access from JavaScript How to: Access Controls from JavaScript by ID Persisting Row Selection in Data Controls The GridView and ListView controls enable users to select a row. In previous versions of ASP.NET, row selection was based on the row index on the page. For example, if you select the third item on page 1 and then move to page 2, the third item on page 2 is selected. In most cases, is more desirable not to select any rows on page 2. ASP.NET 4 supports Persisted Selection, a new feature that was initially supported only in Dynamic Data projects in the .NET Framework 3.5 SP1. When this feature is enabled, the selected item is based on the row data key. This means that if you select the third row on page 1 and move to page 2, nothing is selected on page 2. When you move back to page 1, the third row is still selected. This is a much more natural behavior than the behavior in earlier versions of ASP.NET. Persisted selection is now supported for the GridView and ListView controls in all projects. You can enable this feature in the GridView control, for example, by setting the EnablePersistedSelection property, as shown in the following example: <asp:GridView id="GridView2" runat="server" PersistedSelection="true"> </asp:GridView> FormView Control Enhancements The FormView control is enhanced to make it easier to style the content of the control with CSS. In previous versions of ASP.NET, the FormView control rendered it contents using an item template. This made styling more difficult in the markup because unexpected table row and table cell tags were rendered by the control. The FormView control supports RenderOuterTable, a property in ASP.NET 4. When this property is set to false, as show in the following example, the table tags are not rendered. This makes it easier to apply CSS style to the contents of the control. <asp:FormView ID="FormView1" runat="server" RenderTable="false"> For more information, see FormView Web Server Control Overview. ListView Control Enhancements The ListView control, which was introduced in ASP.NET 3.5, has all the functionality of the GridView control while giving you complete control over the output. This control has been made easier to use in ASP.NET 4. The earlier version of the control required that you specify a layout template that contained a server control with a known ID. The following markup shows a typical example of how to use the ListView control in ASP.NET 3.5. <asp:ListView ID="ListView1" runat="server"> <LayoutTemplate> <asp:PlaceHolder ID="ItemPlaceHolder" runat="server"></asp:PlaceHolder> </LayoutTemplate> <ItemTemplate> <% Eval("LastName")%> </ItemTemplate> </asp:ListView> In ASP.NET 4, the ListView control does not require a layout template. The markup shown in the previous example can be replaced with the following markup: <asp:ListView ID="ListView1" runat="server"> <ItemTemplate> <% Eval("LastName")%> </ItemTemplate> </asp:ListView> For more information, see ListView Web Server Control Overview. Filtering Data with the QueryExtender Control A very common task for developers who create data-driven Web pages is to filter data. This traditionally has been performed by building Where clauses in data source controls. This approach can be complicated, and in some cases the Where syntax does not let you take advantage of the full functionality of the underlying database. To make filtering easier, a new QueryExtender control has been added in ASP.NET 4. This control can be added to EntityDataSource or LinqDataSource controls in order to filter the data returned by these controls. Because the QueryExtender control relies on LINQ, but you do not to need to know how to write LINQ queries to use the query extender. The QueryExtender control supports a variety of filter options. The following lists QueryExtender filter options. Term Definition SearchExpression Searches a field or fields for string values and compares them to a specified string value. RangeExpression Searches a field or fields for values in a range specified by a pair of values. PropertyExpression Compares a specified value to a property value in a field. If the expression evaluates to true, the data that is being examined is returned. OrderByExpression Sorts data by a specified column and sort direction. CustomExpression Calls a function that defines custom filter in the page. For more information, see QueryExtenderQueryExtender Web Server Control Overview. Enhanced Support for Web Standards and Accessibility Earlier versions of ASP.NET controls sometimes render markup that does not conform to HTML, XHTML, or accessibility standards. ASP.NET 4 eliminates most of these exceptions. For details about how the HTML that is rendered by each control meets accessibility standards, see ASP.NET Controls and Accessibility. CSS for Controls that Can be Disabled In ASP.NET 3.5, when a control is disabled (see WebControl.Enabled), a disabled attribute is added to the rendered HTML element. For example, the following markup creates a Label control that is disabled: <asp:Label id="Label1" runat="server"   Text="Test" Enabled="false" /> In ASP.NET 3.5, the previous control settings generate the following HTML: <span id="Label1" disabled="disabled">Test</span> In HTML 4.01, the disabled attribute is not considered valid on span elements. It is valid only on input elements because it specifies that they cannot be accessed. On display-only elements such as span elements, browsers typically support rendering for a disabled appearance, but a Web page that relies on this non-standard behavior is not robust according to accessibility standards. For display-only elements, you should use CSS to indicate a disabled visual appearance. Therefore, by default ASP.NET 4 generates the following HTML for the control settings shown previously: <span id="Label1" class="aspNetDisabled">Test</span> You can change the value of the class attribute that is rendered by default when a control is disabled by setting the DisabledCssClass property. CSS for Validation Controls In ASP.NET 3.5, validation controls render a default color of red as an inline style. For example, the following markup creates a RequiredFieldValidator control: <asp:RequiredFieldValidator ID="RequiredFieldValidator1" runat="server"   ErrorMessage="Required Field" ControlToValidate="RadioButtonList1" /> ASP.NET 3.5 renders the following HTML for the validator control: <span id="RequiredFieldValidator1"   style="color:Red;visibility:hidden;">RequiredFieldValidator</span> By default, ASP.NET 4 does not render an inline style to set the color to red. An inline style is used only to hide or show the validator, as shown in the following example: <span id="RequiredFieldValidator1"   style"visibility:hidden;">RequiredFieldValidator</span> Therefore, ASP.NET 4 does not automatically show error messages in red. For information about how to use CSS to specify a visual style for a validation control, see Validating User Input in ASP.NET Web Pages. CSS for the Hidden Fields Div Element ASP.NET uses hidden fields to store state information such as view state and control state. These hidden fields are contained by a div element. In ASP.NET 3.5, this div element does not have a class attribute or an id attribute. Therefore, CSS rules that affect all div elements could unintentionally cause this div to be visible. To avoid this problem, ASP.NET 4 renders the div element for hidden fields with a CSS class that you can use to differentiate the hidden fields div from others. The new classvalue is shown in the following example: <div class="aspNetHidden"> CSS for the Table, Image, and ImageButton Controls By default, in ASP.NET 3.5, some controls set the border attribute of rendered HTML to zero (0). The following example shows HTML that is generated by the Table control in ASP.NET 3.5: <table id="Table2" border="0"> The Image control and the ImageButton control also do this. Because this is not necessary and provides visual formatting information that should be provided by using CSS, the attribute is not generated in ASP.NET 4. CSS for the UpdatePanel and UpdateProgress Controls In ASP.NET 3.5, the UpdatePanel and UpdateProgress controls do not support expando attributes. This makes it impossible to set a CSS class on the HTMLelements that they render. In ASP.NET 4 these controls have been changed to accept expando attributes, as shown in the following example: <asp:UpdatePanel runat="server" class="myStyle"> </asp:UpdatePanel> The following HTML is rendered for this markup: <div id="ctl00_MainContent_UpdatePanel1" class="expandoclass"> </div> Eliminating Unnecessary Outer Tables In ASP.NET 3.5, the HTML that is rendered for the following controls is wrapped in a table element whose purpose is to apply inline styles to the entire control: FormView Login PasswordRecovery ChangePassword If you use templates to customize the appearance of these controls, you can specify CSS styles in the markup that you provide in the templates. In that case, no extra outer table is required. In ASP.NET 4, you can prevent the table from being rendered by setting the new RenderOuterTable property to false. Layout Templates for Wizard Controls In ASP.NET 3.5, the Wizard and CreateUserWizard controls generate an HTML table element that is used for visual formatting. In ASP.NET 4 you can use a LayoutTemplate element to specify the layout. If you do this, the HTML table element is not generated. In the template, you create placeholder controls to indicate where items should be dynamically inserted into the control. (This is similar to how the template model for the ListView control works.) For more information, see the Wizard.LayoutTemplate property. New HTML Formatting Options for the CheckBoxList and RadioButtonList Controls ASP.NET 3.5 uses HTML table elements to format the output for the CheckBoxList and RadioButtonList controls. To provide an alternative that does not use tables for visual formatting, ASP.NET 4 adds two new options to the RepeatLayout enumeration: UnorderedList. This option causes the HTML output to be formatted by using ul and li elements instead of a table. OrderedList. This option causes the HTML output to be formatted by using ol and li elements instead of a table. For examples of HTML that is rendered for the new options, see the RepeatLayout enumeration. Header and Footer Elements for the Table Control In ASP.NET 3.5, the Table control can be configured to render thead and tfoot elements by setting the TableSection property of the TableHeaderRow class and the TableFooterRow class. In ASP.NET 4 these properties are set to the appropriate values by default. CSS and ARIA Support for the Menu Control In ASP.NET 3.5, the Menu control uses HTML table elements for visual formatting, and in some configurations it is not keyboard-accessible. ASP.NET 4 addresses these problems and improves accessibility in the following ways: The generated HTML is structured as an unordered list (ul and li elements). CSS is used for visual formatting. The menu behaves in accordance with ARIA standards for keyboard access. You can use arrow keys to navigate menu items. (For information about ARIA, see Accessibility in Visual Studio and ASP.NET.) ARIA role and property attributes are added to the generated HTML. (Attributes are added by using JavaScript instead of included in the HTML, to avoid generating HTML that would cause markup validation errors.) Styles for the Menu control are rendered in a style block at the top of the page, instead of inline with the rendered HTML elements. If you want to use a separate CSS file so that you can modify the menu styles, you can set the Menu control's new IncludeStyleBlock property to false, in which case the style block is not generated. Valid XHTML for the HtmlForm Control In ASP.NET 3.5, the HtmlForm control (which is created implicitly by the <form runat="server"> tag) renders an HTML form element that has both name and id attributes. The name attribute is deprecated in XHTML 1.1. Therefore, this control does not render the name attribute in ASP.NET 4. Maintaining Backward Compatibility in Control Rendering An existing ASP.NET Web site might have code in it that assumes that controls are rendering HTML the way they do in ASP.NET 3.5. To avoid causing backward compatibility problems when you upgrade the site to ASP.NET 4, you can have ASP.NET continue to generate HTML the way it does in ASP.NET 3.5 after you upgrade the site. To do so, you can set the controlRenderingCompatibilityVersion attribute of the pages element to "3.5" in the Web.config file of an ASP.NET 4 Web site, as shown in the following example: <system.web>   <pages controlRenderingCompatibilityVersion="3.5"/> </system.web> If this setting is omitted, the default value is the same as the version of ASP.NET that the Web site targets. (For information about multi-targeting in ASP.NET, see .NET Framework Multi-Targeting for ASP.NET Web Projects.) ASP.NET MVC ASP.NET MVC helps Web developers build compelling standards-based Web sites that are easy to maintain because it decreases the dependency among application layers by using the Model-View-Controller (MVC) pattern. MVC provides complete control over the page markup. It also improves testability by inherently supporting Test Driven Development (TDD). Web sites created using ASP.NET MVC have a modular architecture. This allows members of a team to work independently on the various modules and can be used to improve collaboration. For example, developers can work on the model and controller layers (data and logic), while the designer work on the view (presentation). For tutorials, walkthroughs, conceptual content, code samples, and a complete API reference, see ASP.NET MVC 2. Dynamic Data Dynamic Data was introduced in the .NET Framework 3.5 SP1 release in mid-2008. This feature provides many enhancements for creating data-driven applications, such as the following: A RAD experience for quickly building a data-driven Web site. Automatic validation that is based on constraints defined in the data model. The ability to easily change the markup that is generated for fields in the GridView and DetailsView controls by using field templates that are part of your Dynamic Data project. For ASP.NET 4, Dynamic Data has been enhanced to give developers even more power for quickly building data-driven Web sites. For more information, see ASP.NET Dynamic Data Content Map. Enabling Dynamic Data for Individual Data-Bound Controls in Existing Web Applications You can use Dynamic Data features in existing ASP.NET Web applications that do not use scaffolding by enabling Dynamic Data for individual data-bound controls. Dynamic Data provides the presentation and data layer support for rendering these controls. When you enable Dynamic Data for data-bound controls, you get the following benefits: Setting default values for data fields. Dynamic Data enables you to provide default values at run time for fields in a data control. Interacting with the database without creating and registering a data model. Automatically validating the data that is entered by the user without writing any code. For more information, see Walkthrough: Enabling Dynamic Data in ASP.NET Data-Bound Controls. New Field Templates for URLs and E-mail Addresses ASP.NET 4 introduces two new built-in field templates, EmailAddress.ascx and Url.ascx. These templates are used for fields that are marked as EmailAddress or Url using the DataTypeAttribute attribute. For EmailAddress objects, the field is displayed as a hyperlink that is created by using the mailto: protocol. When users click the link, it opens the user's e-mail client and creates a skeleton message. Objects typed as Url are displayed as ordinary hyperlinks. The following example shows how to mark fields. [DataType(DataType.EmailAddress)] public object HomeEmail { get; set; } [DataType(DataType.Url)] public object Website { get; set; } Creating Links with the DynamicHyperLink Control Dynamic Data uses the new routing feature that was added in the .NET Framework 3.5 SP1 to control the URLs that users see when they access the Web site. The new DynamicHyperLink control makes it easy to build links to pages in a Dynamic Data site. For information, see How to: Create Table Action Links in Dynamic Data Support for Inheritance in the Data Model Both the ADO.NET Entity Framework and LINQ to SQL support inheritance in their data models. An example of this might be a database that has an InsurancePolicy table. It might also contain CarPolicy and HousePolicy tables that have the same fields as InsurancePolicy and then add more fields. Dynamic Data has been modified to understand inherited objects in the data model and to support scaffolding for the inherited tables. For more information, see Walkthrough: Mapping Table-per-Hierarchy Inheritance in Dynamic Data. Support for Many-to-Many Relationships (Entity Framework Only) The Entity Framework has rich support for many-to-many relationships between tables, which is implemented by exposing the relationship as a collection on an Entity object. New field templates (ManyToMany.ascx and ManyToMany_Edit.ascx) have been added to provide support for displaying and editing data that is involved in many-to-many relationships. For more information, see Working with Many-to-Many Data Relationships in Dynamic Data. New Attributes to Control Display and Support Enumerations The DisplayAttribute has been added to give you additional control over how fields are displayed. The DisplayNameAttribute attribute in earlier versions of Dynamic Data enabled you to change the name that is used as a caption for a field. The new DisplayAttribute class lets you specify more options for displaying a field, such as the order in which a field is displayed and whether a field will be used as a filter. The attribute also provides independent control of the name that is used for the labels in a GridView control, the name that is used in a DetailsView control, the help text for the field, and the watermark used for the field (if the field accepts text input). The EnumDataTypeAttribute class has been added to let you map fields to enumerations. When you apply this attribute to a field, you specify an enumeration type. Dynamic Data uses the new Enumeration.ascx field template to create UI for displaying and editing enumeration values. The template maps the values from the database to the names in the enumeration. Enhanced Support for Filters Dynamic Data 1.0 had built-in filters for Boolean columns and foreign-key columns. The filters did not let you specify the order in which they were displayed. The new DisplayAttribute attribute addresses this by giving you control over whether a column appears as a filter and in what order it will be displayed. An additional enhancement is that filtering support has been rewritten to use the new QueryExtender feature of Web Forms. This lets you create filters without requiring knowledge of the data source control that the filters will be used with. Along with these extensions, filters have also been turned into template controls, which lets you add new ones. Finally, the DisplayAttribute class mentioned earlier allows the default filter to be overridden, in the same way that UIHint allows the default field template for a column to be overridden. For more information, see Walkthrough: Filtering Rows in Tables That Have a Parent-Child Relationship and QueryableFilterRepeater. ASP.NET Chart Control The ASP.NET chart server control enables you to create ASP.NET pages applications that have simple, intuitive charts for complex statistical or financial analysis. The chart control supports the following features: Data series, chart areas, axes, legends, labels, titles, and more. Data binding. Data manipulation, such as copying, splitting, merging, alignment, grouping, sorting, searching, and filtering. Statistical formulas and financial formulas. Advanced chart appearance, such as 3-D, anti-aliasing, lighting, and perspective. Events and customizations. Interactivity and Microsoft Ajax. Support for the Ajax Content Delivery Network (CDN), which provides an optimized way for you to add Microsoft Ajax Library and jQuery scripts to your Web applications. For more information, see Chart Web Server Control Overview. Visual Web Developer Enhancements The following sections provide information about enhancements and new features in Visual Studio 2010 and Visual Web Developer Express. The Web page designer in Visual Studio 2010 has been enhanced for better CSS compatibility, includes additional support for HTML and ASP.NET markup snippets, and features a redesigned version of IntelliSense for JScript. Improved CSS Compatibility The Visual Web Developer designer in Visual Studio 2010 has been updated to improve CSS 2.1 standards compliance. The designer better preserves HTML source code and is more robust than in previous versions of Visual Studio. HTML and JScript Snippets In the HTML editor, IntelliSense auto-completes tag names. The IntelliSense Snippets feature auto-completes whole tags and more. In Visual Studio 2010, IntelliSense snippets are supported for JScript, alongside C# and Visual Basic, which were supported in earlier versions of Visual Studio. Visual Studio 2010 includes over 200 snippets that help you auto-complete common ASP.NET and HTML tags, including required attributes (such as runat="server") and common attributes specific to a tag (such as ID, DataSourceID, ControlToValidate, and Text). You can download additional snippets, or you can write your own snippets that encapsulate the blocks of markup that you or your team use for common tasks. For more information on HTML snippets, see Walkthrough: Using HTML Snippets. JScript IntelliSense Enhancements In Visual 2010, JScript IntelliSense has been redesigned to provide an even richer editing experience. IntelliSense now recognizes objects that have been dynamically generated by methods such as registerNamespace and by similar techniques used by other JavaScript frameworks. Performance has been improved to analyze large libraries of script and to display IntelliSense with little or no processing delay. Compatibility has been significantly increased to support almost all third-party libraries and to support diverse coding styles. Documentation comments are now parsed as you type and are immediately leveraged by IntelliSense. Web Application Deployment with Visual Studio 2010 For Web application projects, Visual Studio now provides tools that work with the IIS Web Deployment Tool (Web Deploy) to automate many processes that had to be done manually in earlier versions of ASP.NET. For example, the following tasks can now be automated: Creating an IIS application on the destination computer and configuring IIS settings. Copying files to the destination computer. Changing Web.config settings that must be different in the destination environment. Propagating changes to data or data structures in SQL Server databases that are used by the Web application. For more information about Web application deployment, see ASP.NET Deployment Content Map. Enhancements to ASP.NET Multi-Targeting ASP.NET 4 adds new features to the multi-targeting feature to make it easier to work with projects that target earlier versions of the .NET Framework. Multi-targeting was introduced in ASP.NET 3.5 to enable you to use the latest version of Visual Studio without having to upgrade existing Web sites or Web services to the latest version of the .NET Framework. In Visual Studio 2008, when you work with a project targeted for an earlier version of the .NET Framework, most features of the development environment adapt to the targeted version. However, IntelliSense displays language features that are available in the current version, and property windows display properties available in the current version. In Visual Studio 2010, only language features and properties available in the targeted version of the .NET Framework are shown. For more information about multi-targeting, see the following topics: .NET Framework Multi-Targeting for ASP.NET Web Projects ASP.NET Side-by-Side Execution Overview How to: Host Web Applications That Use Different Versions of the .NET Framework on the Same Server How to: Deploy Web Site Projects Targeted for Earlier Versions of the .NET Framework

    Read the article

  • Problem with hadoop start-dfs.sh

    - by user288501
    I installed and configured hadoop on my Ubuntu 14.04 server, virtualized inside of hyper-v, however I am getting an issue when i run start-dfs.sh root@sUbuntu01:/var/log# start-dfs.sh 14/06/04 15:27:08 WARN util.NativeCodeLoader: Unable to load native-hadoop library for your platform... using builtin-java classes where applicable Starting namenodes on [OpenJDK 64-Bit Server VM warning: You have loaded library /usr/local/hadoop/lib/native/libhadoop.so.1.0.0 which might have disabled stack guard. The VM will try to fix the stack guard now. It's highly recommended that you fix the library with 'execstack -c <libfile>', or link it with '-z noexecstack'. localhost] sed: -e expression #1, char 6: unknown option to `s' -c: Unknown cipher type 'cd' localhost: Ubuntu 14.04 LTS localhost: starting namenode, logging to /usr/local/hadoop/logs/hadoop-root-namenode-sUbuntu01.out noexecstack'.: ssh: Could not resolve hostname noexecstack'.: Name or service not known '-z: ssh: Could not resolve hostname '-z: Name or service not known 'execstack: ssh: Could not resolve hostname 'execstack: Name or service not known disabled: ssh: Could not resolve hostname disabled: Name or service not known with: ssh: Could not resolve hostname with: Name or service not known have: ssh: Could not resolve hostname have: Name or service not known VM: ssh: Could not resolve hostname vm: Name or service not known stack: ssh: Could not resolve hostname stack: Name or service not known guard: ssh: Could not resolve hostname guard: Name or service not known fix: ssh: Could not resolve hostname fix: Name or service not known VM: ssh: Could not resolve hostname vm: Name or service not known the: ssh: Could not resolve hostname the: Name or service not known to: ssh: Could not resolve hostname to: Name or service not known warning:: ssh: Could not resolve hostname warning:: Name or service not known it: ssh: Could not resolve hostname it: Name or service not known now.: ssh: Could not resolve hostname now.: Name or service not known library: ssh: Could not resolve hostname library: Name or service not known will: ssh: Could not resolve hostname will: Name or service not known link: ssh: Could not resolve hostname link: Name or service not known or: ssh: Could not resolve hostname or: Name or service not known It's: ssh: Could not resolve hostname it's: Name or service not known <libfile>',: ssh: Could not resolve hostname <libfile>',: Name or service not known which: ssh: connect to host which port 22: Connection timed out have: ssh: connect to host have port 22: Connection timed out you: ssh: connect to host you port 22: Connection timed out try: ssh: connect to host try port 22: Connection timed out the: ssh: connect to host the port 22: Connection timed out highly: ssh: connect to host highly port 22: Connection timed out might: ssh: connect to host might port 22: Connection timed out loaded: ssh: connect to host loaded port 22: Connection timed out You: ssh: connect to host you port 22: Connection timed out guard.: ssh: connect to host guard. port 22: Connection timed out library: ssh: connect to host library port 22: Connection timed out Server: ssh: connect to host server port 22: Connection timed out fix: ssh: connect to host fix port 22: Connection timed out The: ssh: connect to host the port 22: Connection timed out recommended: ssh: connect to host recommended port 22: Connection timed out that: ssh: connect to host that port 22: Connection timed out stack: ssh: connect to host stack port 22: Connection timed out OpenJDK: ssh: connect to host openjdk port 22: Connection timed out 64-Bit: ssh: connect to host 64-bit port 22: Connection timed out with: ssh: connect to host with port 22: Connection timed out localhost: Ubuntu 14.04 LTS localhost: starting datanode, logging to /usr/local/hadoop/logs/hadoop-root-datanode-sUbuntu01.out localhost: OpenJDK 64-Bit Server VM warning: You have loaded library /usr/local/hadoop/lib/native/libhadoop.so.1.0.0 which might have disabled stack guard. The VM will try to fix the stack guard now. localhost: It's highly recommended that you fix the library with 'execstack -c <libfile>', or link it with '-z noexecstack'. Starting secondary namenodes [OpenJDK 64-Bit Server VM warning: You have loaded library /usr/local/hadoop/lib/native/libhadoop.so.1.0.0 which might have disabled stack guard. The VM will try to fix the stack guard now. It's highly recommended that you fix the library with 'execstack -c <libfile>', or link it with '-z noexecstack'. 0.0.0.0] sed: -e expression #1, char 6: unknown option to `s' warning:: ssh: Could not resolve hostname warning:: Name or service not known -c: Unknown cipher type 'cd' It's: ssh: Could not resolve hostname it's: Name or service not known 'execstack: ssh: Could not resolve hostname 'execstack: Name or service not known '-z: ssh: Could not resolve hostname '-z: Name or service not known 0.0.0.0: Ubuntu 14.04 LTS 0.0.0.0: starting secondarynamenode, logging to /usr/local/hadoop/logs/hadoop-root-secondarynamenode-sUbuntu01.out 0.0.0.0: OpenJDK 64-Bit Server VM warning: You have loaded library /usr/local/hadoop/lib/native/libhadoop.so.1.0.0 which might have disabled stack guard. The VM will try to fix the stack guard now. 0.0.0.0: It's highly recommended that you fix the library with 'execstack -c <libfile>', or link it with '-z noexecstack'. noexecstack'.: ssh: Could not resolve hostname noexecstack'.: Name or service not known <libfile>',: ssh: Could not resolve hostname <libfile>',: Name or service not known link: ssh: Could not resolve hostname link: No address associated with hostname it: ssh: Could not resolve hostname it: No address associated with hostname to: ssh: connect to host to port 22: Connection timed out or: ssh: connect to host or port 22: Connection timed out you: ssh: connect to host you port 22: Connection timed out guard.: ssh: connect to host guard. port 22: Connection timed out VM: ssh: connect to host vm port 22: Connection timed out stack: ssh: connect to host stack port 22: Connection timed out library: ssh: connect to host library port 22: Connection timed out Server: ssh: connect to host server port 22: Connection timed out might: ssh: connect to host might port 22: Connection timed out stack: ssh: connect to host stack port 22: Connection timed out You: ssh: connect to host you port 22: Connection timed out now.: ssh: connect to host now. port 22: Connection timed out disabled: ssh: connect to host disabled port 22: Connection timed out have: ssh: connect to host have port 22: Connection timed out will: ssh: connect to host will port 22: Connection timed out The: ssh: connect to host the port 22: Connection timed out have: ssh: connect to host have port 22: Connection timed out try: ssh: connect to host try port 22: Connection timed out the: ssh: connect to host the port 22: Connection timed out guard: ssh: connect to host guard port 22: Connection timed out the: ssh: connect to host the port 22: Connection timed out recommended: ssh: connect to host recommended port 22: Connection timed out with: ssh: connect to host with port 22: Connection timed out library: ssh: connect to host library port 22: Connection timed out 64-Bit: ssh: connect to host 64-bit port 22: Connection timed out fix: ssh: connect to host fix port 22: Connection timed out which: ssh: connect to host which port 22: Connection timed out VM: ssh: connect to host vm port 22: Connection timed out OpenJDK: ssh: connect to host openjdk port 22: Connection timed out fix: ssh: connect to host fix port 22: Connection timed out highly: ssh: connect to host highly port 22: Connection timed out that: ssh: connect to host that port 22: Connection timed out with: ssh: connect to host with port 22: Connection timed out loaded: ssh: connect to host loaded port 22: Connection timed out 14/06/04 15:36:02 WARN util.NativeCodeLoader: Unable to load native-hadoop library for your platform... using builtin-java classes where applicable Any advice?

    Read the article

  • Security Trimmed Cross Site Collection Navigation

    - by Sahil Malik
    Ad:: SharePoint 2007 Training in .NET 3.5 technologies (more information). This article will serve as documentation of a fully functional codeplex project that I just created. This project will give you a WebPart that will give you security trimmed navigation across site collections. The first question is, why create such a project? In every single SharePoint project you will do, one question you will always be faced with is, what should the boundaries of sites be, and what should the boundaries of site collections be? There is no good or bad answer to this, because it really really depends on your needs. There are some factors in play here. Site Collections will allow you to scale, as a Site collection is the smallest entity you can put inside a content database Site collections will allow you to offer different levels of SLAs, because you put a site collection on a separate content database, and put that database on a separate server. Site collections are a security boundary – and they can be moved around at will without affecting other site collections. Site collections are also a branding boundary. They are also a feature deployment boundary, so you can have two site collections on the same web application with completely different nature of services. But site collections break navigation, i.e. a site collection at “/”, and a site collection at “/sites/mySiteCollection”, are completely independent of each other. If you have access to both, the navigation of / won’t show you a link to /sites/mySiteCollection. Some people refer to this as a huge issue in SharePoint. Luckily, some workarounds exist. A long time ago, I had blogged about “Implementing Consistent Navigation across Site Collections”. That approach was a no-code solution, it worked – it gave you a consistent navigation across site collections. But, it didn’t work in a security trimmed fashion! i.e., if I don’t have access to Site Collection ‘X’, it would still show me a link to ‘X’. Well this project gets around that issue. Simply deploy this project, and it’ll give you a WebPart. You can use that WebPart as either a webpart or as a server control dropped via SharePoint designer, and it will give you Security Trimmed Cross Site Collection Navigation. The code has been written for SP2010, but it will work in SP2007 with the help of http://spwcfsupport.codeplex.com . What do I need to do to make it work? I’m glad you asked! Simple! Deploy the .wsp (which you can download here). This will give you a site collection feature called “Winsmarts Cross Site Collection Navigation” as shown below. Go ahead and activate it, and this will give you a WebPart called “Winsmarts Navigation Web Part” as shown below: Just drop this WebPart on your page, and it will show you all site collections that the currently logged in user has access to. Really it’s that easy! This is shown as below - In the above example, I have two site collections that I created at /sites/SiteCollection1 and /sites/SiteCollection2. The navigation shows the titles. You see some extraneous crap as well, you might want to clean that – I’ll talk about that in a minute. What? You’re running into problems? If the problem you’re running into is that you are prompted to login three times, and then it shows a blank webpart that says “Loading your applications ..” and then craps out!, then most probably you’re using a different authentication scheme. Behind the scenes I use a custom WCF service to perform this job. OOTB, I’ve set it to work with NTLM, but if you need to make it work alternate authentications such as forms based auth, or client side certs, you will need to edit the %14%\ISAPI\Winsmarts.CrossSCNav\web.config file, specifically, this section - 1: <bindings> 2: <webHttpBinding> 3: <binding name="customWebHttpBinding"> 4: <security mode="TransportCredentialOnly"> 5: <transport clientCredentialType="Ntlm"/> 6: </security> 7: </binding> 8: </webHttpBinding> 9: </bindings> For Kerberos, change the “clientCredentialType” to “Windows” For Forms auth, remove that transport line For client certs – well that’s a bit more involved, but it’s just web.config changes – hit a good book on WCF or hire me for a billion trillion $. But fair warning, I might be too busy to help immediately. If you’re running into a different problem, please leave a comment below, but the code is pretty rock solid, so .. hmm .. check what you’re doing! BTW, I don’t  make any guarantee/warranty on this – if this code makes you sterile, unpopular, bad hairstyle, anything else, that is your problem! But, there are some known issues - I wrote this as a concept – you can easily extend it to be more flexible. Example, hierarchical nav, or, horizontal nav, jazzy effects with jquery or silverlight– all those are possible very very easily. This webpart is not smart enough to co-exist with another instance of itself on the same page. I can easily extend it to do so, which I will do in my spare(!?) time! Okay good! But that’s not all! As you can see, just dropping the WebPart may show you many extraneous site collections, or maybe you want to restrict which site collections are shown, or exclude a certain site collection to be shown from the navigation. To support that, I created a property on the WebPart called “UrlMatchPattern”, which is a regex expression you specify to trim the results :). So, just edit the WebPart, and specify a string property of “http://sp2010/sites/” as shown below. Note that you can put in whatever regex expression you want! So go crazy, I don’t care! And this gives you a cleaner look.   w00t! Enjoy! Comment on the article ....

    Read the article

  • Pre-filtering and shaping OData feeds using WCF Data Services and the Entity Framework - Part 1

    - by rajbk
    The Open Data Protocol, referred to as OData, is a new data-sharing standard that breaks down silos and fosters an interoperative ecosystem for data consumers (clients) and producers (services) that is far more powerful than currently possible. It enables more applications to make sense of a broader set of data, and helps every data service and client add value to the whole ecosystem. WCF Data Services (previously known as ADO.NET Data Services), then, was the first Microsoft technology to support the Open Data Protocol in Visual Studio 2008 SP1. It provides developers with client libraries for .NET, Silverlight, AJAX, PHP and Java. Microsoft now also supports OData in SQL Server 2008 R2, Windows Azure Storage, Excel 2010 (through PowerPivot), and SharePoint 2010. Many other other applications in the works. * This post walks you through how to create an OData feed, define a shape for the data and pre-filter the data using Visual Studio 2010, WCF Data Services and the Entity Framework. A sample project is attached at the bottom of Part 2 of this post. Pre-filtering and shaping OData feeds using WCF Data Services and the Entity Framework - Part 2 Create the Web Application File –› New –› Project, Select “ASP.NET Empty Web Application” Add the Entity Data Model Right click on the Web Application in the Solution Explorer and select “Add New Item..” Select “ADO.NET Entity Data Model” under "Data”. Name the Model “Northwind” and click “Add”.   In the “Choose Model Contents”, select “Generate Model From Database” and click “Next”   Define a connection to your database containing the Northwind database in the next screen. We are going to expose the Products table through our OData feed. Select “Products” in the “Choose your Database Object” screen.   Click “Finish”. We are done creating our Entity Data Model. Save the Northwind.edmx file created. Add the WCF Data Service Right click on the Web Application in the Solution Explorer and select “Add New Item..” Select “WCF Data Service” from the list and call the service “DataService” (creative, huh?). Click “Add”.   Enable Access to the Data Service Open the DataService.svc.cs class. The class is well commented and instructs us on the next steps. public class DataService : DataService< /* TODO: put your data source class name here */ > { // This method is called only once to initialize service-wide policies. public static void InitializeService(DataServiceConfiguration config) { // TODO: set rules to indicate which entity sets and service operations are visible, updatable, etc. // Examples: // config.SetEntitySetAccessRule("MyEntityset", EntitySetRights.AllRead); // config.SetServiceOperationAccessRule("MyServiceOperation", ServiceOperationRights.All); config.DataServiceBehavior.MaxProtocolVersion = DataServiceProtocolVersion.V2; } } Replace the comment that starts with “/* TODO:” with “NorthwindEntities” (the entity container name of the Model we created earlier).  WCF Data Services is initially locked down by default, FTW! No data is exposed without you explicitly setting it. You have explicitly specify which Entity sets you wish to expose and what rights are allowed by using the SetEntitySetAccessRule. The SetServiceOperationAccessRule on the other hand sets rules for a specified operation. Let us define an access rule to expose the Products Entity we created earlier. We use the EnititySetRights.AllRead since we want to give read only access. Our modified code is shown below. public class DataService : DataService<NorthwindEntities> { public static void InitializeService(DataServiceConfiguration config) { config.SetEntitySetAccessRule("Products", EntitySetRights.AllRead); config.DataServiceBehavior.MaxProtocolVersion = DataServiceProtocolVersion.V2; } } We are done setting up our ODataFeed! Compile your project. Right click on DataService.svc and select “View in Browser” to see the OData feed. To view the feed in IE, you must make sure that "Feed Reading View" is turned off. You set this under Tools -› Internet Options -› Content tab.   If you navigate to “Products”, you should see the Products feed. Note also that URIs are case sensitive. ie. Products work but products doesn’t.   Filtering our data OData has a set of system query operations you can use to perform common operations against data exposed by the model. For example, to see only Products in CategoryID 2, we can use the following request: /DataService.svc/Products?$filter=CategoryID eq 2 At the time of this writing, supported operations are $orderby, $top, $skip, $filter, $expand, $format†, $select, $inlinecount. Pre-filtering our data using Query Interceptors The Product feed currently returns all Products. We want to change that so that it contains only Products that have not been discontinued. WCF introduces the concept of interceptors which allows us to inject custom validation/policy logic into the request/response pipeline of a WCF data service. We will use a QueryInterceptor to pre-filter the data so that it returns only Products that are not discontinued. To create a QueryInterceptor, write a method that returns an Expression<Func<T, bool>> and mark it with the QueryInterceptor attribute as shown below. [QueryInterceptor("Products")] public Expression<Func<Product, bool>> OnReadProducts() { return o => o.Discontinued == false; } Viewing the feed after compilation will only show products that have not been discontinued. We also confirm this by looking at the WHERE clause in the SQL generated by the entity framework. SELECT [Extent1].[ProductID] AS [ProductID], ... ... [Extent1].[Discontinued] AS [Discontinued] FROM [dbo].[Products] AS [Extent1] WHERE 0 = [Extent1].[Discontinued] Other examples of Query/Change interceptors can be seen here including an example to filter data based on the identity of the authenticated user. We are done pre-filtering our data. In the next part of this post, we will see how to shape our data. Pre-filtering and shaping OData feeds using WCF Data Services and the Entity Framework - Part 2 Foot Notes * http://msdn.microsoft.com/en-us/data/aa937697.aspx † $format did not work for me. The way to get a Json response is to include the following in the  request header “Accept: application/json, text/javascript, */*” when making the request. This is easily done with most JavaScript libraries.

    Read the article

  • Enhanced REST Support in Oracle Service Bus 11gR1

    - by jeff.x.davies
    In a previous entry on REST and Oracle Service Bus (see http://blogs.oracle.com/jeffdavies/2009/06/restful_services_with_oracle_s_1.html) I encoded the REST query string really as part of the relative URL. For example, consider the following URI: http://localhost:7001/SimpleREST/Products/id=1234 Now, technically there is nothing wrong with this approach. However, it is generally more common to encode the search parameters into the query string. Take a look at the following URI that shows this principle http://localhost:7001/SimpleREST/Products?id=1234 At first blush this appears to be a trivial change. However, this approach is more intuitive, especially if you are passing in multiple parameters. For example: http://localhost:7001/SimpleREST/Products?cat=electronics&subcat=television&mfg=sony The above URI is obviously used to retrieve a list of televisions made by Sony. In prior versions of OSB (before 11gR1PS3), parsing the query string of a URI was more difficult than in the current release. In 11gR1PS3 it is now much easier to parse the query strings, which in turn makes developing REST services in OSB even easier. In this blog entry, we will re-implement the REST-ful Products services using query strings for passing parameter information. Lets begin with the implementation of the Products REST service. This service is implemented in the Products.proxy file of the project. Lets begin with the overall structure of the service, as shown in the following screenshot. This is a common pattern for REST services in the Oracle Service Bus. You implement different flows for each of the HTTP verbs that you want your service to support. Lets take a look at how the GET verb is implemented. This is the path that is taken of you were to point your browser to: http://localhost:7001/SimpleREST/Products/id=1234 There is an Assign action in the request pipeline that shows how to extract a query parameter. Here is the expression that is used to extract the id parameter: $inbound/ctx:transport/ctx:request/http:query-parameters/http:parameter[@name="id"]/@value The Assign action that stores the value into an OSB variable named id. Using this type of XPath statement you can query for any variables by name, without regard to their order in the parameter list. The Log statement is there simply to provided some debugging info in the OSB server console. The response pipeline contains a Replace action that constructs the response document for our rest service. Most of the response data is static, but the ID field that is returned is set based upon the query-parameter that was passed into the REST proxy. Testing the REST service with a browser is very simple. Just point it to the URL I showed you earlier. However, the browser is really only good for testing simple GET services. The OSB Test Console provides a much more robust environment for testing REST services, no matter which HTTP verb is used. Lets see how to use the Test Console to test this GET service. Open the OSB we console (http://localhost:7001/sbconsole) and log in as the administrator. Click on the Test Console icon (the little "bug") next to the Products proxy service in the SimpleREST project. This will bring up the Test Console browser window. Unlike SOAP services, we don't need to do much work in the request document because all of our request information will be encoded into the URI of the service itself. Belore the Request Document section of the Test Console is the Transport section. Expand that section and modify the query-parameters and http-method fields as shown in the next screenshot. By default, the query-parameters field will have the tags already defined. You just need to add a tag for each parameter you want to pass into the service. For out purposes with this particular call, you'd set the quer-parameters field as follows: <tp:parameter name="id" value="1234" /> </tp:query-parameters> Now you are ready to push the Execute button to see the results of the call. That covers the process for parsing query parameters using OSB. However, what if you have an OSB proxy service that needs to consume a REST-ful service? How do you tell OSB to pass the query parameters to the external service? In the sample code you will see a 2nd proxy service called CallREST. It invokes the Products proxy service in exactly the same way it would invoke any REST service. Our CallREST proxy service is defined as a SOAP service. This help to demonstrate OSBs ability to mediate between service consumers and service providers, decreasing the level of coupling between them. If you examine the message flow for the CallREST proxy service, you'll see that it uses an Operational branch to isolate processing logic for each operation that is defined by the SOAP service. We will focus on the getProductDetail branch, that calls the Products REST service using the HTTP GET verb. Expand the getProduct pipeline and the stage node that it contains. There is a single Assign statement that simply extracts the productID from the SOA request and stores it in a local OSB variable. Nothing suprising here. The real work (and the real learning) occurs in the Route node below the pipeline. The first thing to learn is that you need to use a route node when calling REST services, not a Service Callout or a Publish action. That's because only the Routing action has access to the $oubound variable, especially when invoking a business service. The Routing action contains 3 Insert actions. The first Insert action shows how to specify the HTTP verb as a GET. The second insert action simply inserts the XML node into the request. This element does not exist in the request by default, so we need to add it manually. Now that we have the element defined in our outbound request, we can fill it with the parameters that we want to send to the REST service. In the following screenshot you can see how we define the id parameter based on the productID value we extracted earlier from the SOAP request document. That expression will look for the parameter that has the name id and extract its value. That's all there is to it. You now know how to take full advantage of the query parameter parsing capability of the Oracle Service Bus 11gR1PS2. Download the sample source code here: rest2_sbconfig.jar Ubuntu and the OSB Test Console You will get an error when you try to use the Test Console with the Oracle Service Bus, using Ubuntu (or likely a number of other Linux distros also). The error (shown below) will state that the Test Console service is not running. The fix for this problem is quite simple. Open up the WebLogic Server administrator console (usually running at http://localhost:7001/console). In the Domain Structure window on the left side of the console, select the Servers entry under the Environment heading. The select the Admin Server entry in the main window of the console. By default, you should be viewing the Configuration tabe and the General sub tab in the main window. Look for the Listen Address field. By default it is blank, which means it is listening on all interfaces. For some reason Ubuntu doesn't like this. So enter a value like localhost or the specific IP address or DNS name for your server (usually its just localhost in development envirionments). Save your changes and restart the server. Your Test Console will now work correctly.

    Read the article

  • New <%: %> Syntax for HTML Encoding Output in ASP.NET 4 (and ASP.NET MVC 2)

    - by ScottGu
    [In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu] This is the nineteenth in a series of blog posts I’m doing on the upcoming VS 2010 and .NET 4 release. Today’s post covers a small, but very useful, new syntax feature being introduced with ASP.NET 4 – which is the ability to automatically HTML encode output within code nuggets.  This helps protect your applications and sites against cross-site script injection (XSS) and HTML injection attacks, and enables you to do so using a nice concise syntax. HTML Encoding Cross-site script injection (XSS) and HTML encoding attacks are two of the most common security issues that plague web-sites and applications.  They occur when hackers find a way to inject client-side script or HTML markup into web-pages that are then viewed by other visitors to a site.  This can be used to both vandalize a site, as well as enable hackers to run client-script code that steals cookie data and/or exploits a user’s identity on a site to do bad things. One way to help mitigate against cross-site scripting attacks is to make sure that rendered output is HTML encoded within a page.  This helps ensures that any content that might have been input/modified by an end-user cannot be output back onto a page containing tags like <script> or <img> elements.  ASP.NET applications (especially those using ASP.NET MVC) often rely on using <%= %> code-nugget expressions to render output.  Developers today often use the Server.HtmlEncode() or HttpUtility.Encode() helper methods within these expressions to HTML encode the output before it is rendered.  This can be done using code like below: While this works fine, there are two downsides of it: It is a little verbose Developers often forget to call the HtmlEncode method New <%: %> Code Nugget Syntax With ASP.NET 4 we are introducing a new code expression syntax (<%:  %>) that renders output like <%= %> blocks do – but which also automatically HTML encodes it before doing so.  This eliminates the need to explicitly HTML encode content like we did in the example above.  Instead you can just write the more concise code below to accomplish the same thing: We chose the <%: %> syntax so that it would be easy to quickly replace existing instances of <%= %> code blocks.  It also enables you to easily search your code-base for <%= %> elements to find and verify any cases where you are not using HTML encoding within your application to ensure that you have the correct behavior. Avoiding Double Encoding While HTML encoding content is often a good best practice, there are times when the content you are outputting is meant to be HTML or is already encoded – in which case you don’t want to HTML encode it again.  ASP.NET 4 introduces a new IHtmlString interface (along with a concrete implementation: HtmlString) that you can implement on types to indicate that its value is already properly encoded (or otherwise examined) for displaying as HTML, and that therefore the value should not be HTML-encoded again.  The <%: %> code-nugget syntax checks for the presence of the IHtmlString interface and will not HTML encode the output of the code expression if its value implements this interface.  This allows developers to avoid having to decide on a per-case basis whether to use <%= %> or <%: %> code-nuggets.  Instead you can always use <%: %> code nuggets, and then have any properties or data-types that are already HTML encoded implement the IHtmlString interface. Using ASP.NET MVC HTML Helper Methods with <%: %> For a practical example of where this HTML encoding escape mechanism is useful, consider scenarios where you use HTML helper methods with ASP.NET MVC.  These helper methods typically return HTML.  For example: the Html.TextBox() helper method returns markup like <input type=”text”/>.  With ASP.NET MVC 2 these helper methods now by default return HtmlString types – which indicates that the returned string content is safe for rendering and should not be encoded by <%: %> nuggets.  This allows you to use these methods within both <%= %> code nugget blocks: As well as within <%: %> code nugget blocks: In both cases above the HTML content returned from the helper method will be rendered to the client as HTML – and the <%: %> code nugget will avoid double-encoding it. This enables you to default to always using <%: %> code nuggets instead of <%= %> code blocks within your applications.  If you want to be really hardcore you can even create a build rule that searches your application looking for <%= %> usages and flags any cases it finds as an error to enforce that HTML encoding always takes place. Scaffolding ASP.NET MVC 2 Views When you use VS 2010 (or the free Visual Web Developer 2010 Express) you’ll find that the views that are scaffolded using the “Add View” dialog now by default always use <%: %> blocks when outputting any content.  For example, below I’ve scaffolded a simple “Edit” view for an article object.  Note the three usages of <%: %> code nuggets for the label, textbox, and validation message (all output with HTML helper methods): Summary The new <%: %> syntax provides a concise way to automatically HTML encode content and then render it as output.  It allows you to make your code a little less verbose, and to easily check/verify that you are always HTML encoding content throughout your site.  This can help protect your applications against cross-site script injection (XSS) and HTML injection attacks.  Hope this helps, Scott

    Read the article

  • VS 2010 Debugger Improvements (BreakPoints, DataTips, Import/Export)

    - by ScottGu
    This is the twenty-first in a series of blog posts I’m doing on the VS 2010 and .NET 4 release.  Today’s blog post covers a few of the nice usability improvements coming with the VS 2010 debugger.  The VS 2010 debugger has a ton of great new capabilities.  Features like Intellitrace (aka historical debugging), the new parallel/multithreaded debugging capabilities, and dump debuging support typically get a ton of (well deserved) buzz and attention when people talk about the debugging improvements with this release.  I’ll be doing blog posts in the future that demonstrate how to take advantage of them as well.  With today’s post, though, I thought I’d start off by covering a few small, but nice, debugger usability improvements that were also included with the VS 2010 release, and which I think you’ll find useful. Breakpoint Labels VS 2010 includes new support for better managing debugger breakpoints.  One particularly useful feature is called “Breakpoint Labels” – it enables much better grouping and filtering of breakpoints within a project or across a solution.  With previous releases of Visual Studio you had to manage each debugger breakpoint as a separate item. Managing each breakpoint separately can be a pain with large projects and for cases when you want to maintain “logical groups” of breakpoints that you turn on/off depending on what you are debugging.  Using the new VS 2010 “breakpoint labeling” feature you can now name these “groups” of breakpoints and manage them as a unit. Grouping Multiple Breakpoints Together using a Label Below is a screen-shot of the breakpoints window within Visual Studio 2010.  This lists all of the breakpoints defined within my solution (which in this case is the ASP.NET MVC 2 code base): The first and last breakpoint in the list above breaks into the debugger when a Controller instance is created or released by the ASP.NET MVC Framework. Using VS 2010, I can now select these two breakpoints, right-click, and then select the new “Edit labels…” menu command to give them a common label/name (making them easier to find and manage): Below is the dialog that appears when I select the “Edit labels” command.  We can use it to create a new string label for our breakpoints or select an existing one we have already defined.  In this case we’ll create a new label called “Lifetime Management” to describe what these two breakpoints cover: When we press the OK button our two selected breakpoints will be grouped under the newly created “Lifetime Management” label: Filtering/Sorting Breakpoints by Label We can use the “Search” combobox to quickly filter/sort breakpoints by label.  Below we are only showing those breakpoints with the “Lifetime Management” label: Toggling Breakpoints On/Off by Label We can also toggle sets of breakpoints on/off by label group.  We can simply filter by the label group, do a Ctrl-A to select all the breakpoints, and then enable/disable all of them with a single click: Importing/Exporting Breakpoints VS 2010 now supports importing/exporting breakpoints to XML files – which you can then pass off to another developer, attach to a bug report, or simply re-load later.  To export only a subset of breakpoints, you can filter by a particular label and then click the “Export breakpoint” button in the Breakpoints window: Above I’ve filtered my breakpoint list to only export two particular breakpoints (specific to a bug that I’m chasing down).  I can export these breakpoints to an XML file and then attach it to a bug report or email – which will enable another developer to easily setup the debugger in the correct state to investigate it on a separate machine.  Pinned DataTips Visual Studio 2010 also includes some nice new “DataTip pinning” features that enable you to better see and track variable and expression values when in the debugger.  Simply hover over a variable or expression within the debugger to expose its DataTip (which is a tooltip that displays its value)  – and then click the new “pin” button on it to make the DataTip always visible: You can “pin” any number of DataTips you want onto the screen.  In addition to pinning top-level variables, you can also drill into the sub-properties on variables and pin them as well.  Below I’ve “pinned” three variables: “category”, “Request.RawUrl” and “Request.LogonUserIdentity.Name”.  Note that these last two variable are sub-properties of the “Request” object.   Associating Comments with Pinned DataTips Hovering over a pinned DataTip exposes some additional UI within the debugger: Clicking the comment button at the bottom of this UI expands the DataTip - and allows you to optionally add a comment with it: This makes it really easy to attach and track debugging notes: Pinned DataTips are usable across both Debug Sessions and Visual Studio Sessions Pinned DataTips can be used across multiple debugger sessions.  This means that if you stop the debugger, make a code change, and then recompile and start a new debug session - any pinned DataTips will still be there, along with any comments you associate with them.  Pinned DataTips can also be used across multiple Visual Studio sessions.  This means that if you close your project, shutdown Visual Studio, and then later open the project up again – any pinned DataTips will still be there, along with any comments you associate with them. See the Value from Last Debug Session (Great Code Editor Feature) How many times have you ever stopped the debugger only to go back to your code and say: $#@! – what was the value of that variable again??? One of the nice things about pinned DataTips is that they keep track of their “last value from debug session” – and you can look these values up within the VB/C# code editor even when the debugger is no longer running.  DataTips are by default hidden when you are in the code editor and the debugger isn’t running.  On the left-hand margin of the code editor, though, you’ll find a push-pin for each pinned DataTip that you’ve previously setup: Hovering your mouse over a pinned DataTip will cause it to display on the screen.  Below you can see what happens when I hover over the first pin in the editor - it displays our debug session’s last values for the “Request” object DataTip along with the comment we associated with them: This makes it much easier to keep track of state and conditions as you toggle between code editing mode and debugging mode on your projects. Importing/Exporting Pinned DataTips As I mentioned earlier in this post, pinned DataTips are by default saved across Visual Studio sessions (you don’t need to do anything to enable this). VS 2010 also now supports importing/exporting pinned DataTips to XML files – which you can then pass off to other developers, attach to a bug report, or simply re-load later. Combined with the new support for importing/exporting breakpoints, this makes it much easier for multiple developers to share debugger configurations and collaborate across debug sessions. Summary Visual Studio 2010 includes a bunch of great new debugger features – both big and small.  Today’s post shared some of the nice debugger usability improvements. All of the features above are supported with the Visual Studio 2010 Professional edition (the Pinned DataTip features are also supported in the free Visual Studio 2010 Express Editions)  I’ll be covering some of the “big big” new debugging features like Intellitrace, parallel/multithreaded debugging, and dump file analysis in future blog posts.  Hope this helps, Scott P.S. In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu

    Read the article

  • How-to tell the ViewCriteria a user chose in an af:query component

    - by frank.nimphius
    Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} The af:query component defines a search form for application users to enter search conditions for a selected View Criteria. A View Criteria is a named where clauses that you can create declaratively on the ADF Business Component View Object. A default View Criteria that allows users to search in all attributes exists by default and exposed in the Data Controls panel. To create an ADF Faces search form, expand the View Object node that contains the View Criteria definition in the Data Controls panel. Drag the View Criteria that should be displayed as the default criteria onto the page and choose Query in the opened context menu. One of the options within the Query option is to create an ADF Query Panel with Table, which displays the result set in a table view, which can have additional column filters defined. Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} To intercept the user query for modification, or just to know about the selected View Criteria, you override the QueryListener property on the af:query component of the af:table component. Overriding the QueryListener on the table makes sense if the table allows users to further filter the result set using column filters.To override the default QueryListener, copy the existing string referencing the binding layer to the clipboard and then select Edit from the field context menu (press the arrow icon to open it) to selecte or create a new managed bean and method to handle the query event.  The code below is from a managed bean with custom query listener handlers defined for the af:query component and the af:table component. The default listener entry copied to the clipboard was "#{bindings.ImplicitViewCriteriaQuery.processQuery}"  public void onQueryList(QueryEvent queryEvent) {   // The generated QueryListener replaced by this method   //#{bindings.ImplicitViewCriteriaQuery.processQuery}        QueryDescriptor qdes = queryEvent.getDescriptor();          //print or log selected View Criteria   System.out.println("NAME "+qdes.getName());           //call default Query Event        invokeQueryEventMethodExpression("      #{bindings.ImplicitViewCriteriaQuery.processQuery}",queryEvent);  } public void onQueryTable(QueryEvent queryEvent) {   // The generated QueryListener replaced by this method   //#{bindings.ImplicitViewCriteriaQuery.processQuery}   QueryDescriptor qdes = queryEvent.getDescriptor();   //print or log selected View Criteria   System.out.println("NAME "+qdes.getName());                   invokeQueryEventMethodExpression(     "#{bindings.ImplicitViewCriteriaQuery.processQuery}",queryEvent); } private void invokeQueryEventMethodExpression(                        String expression, QueryEvent queryEvent){   FacesContext fctx = FacesContext.getCurrentInstance();   ELContext elctx = fctx.getELContext();   ExpressionFactory efactory   fctx.getApplication().getExpressionFactory();     MethodExpression me =     efactory.createMethodExpression(elctx,expression,                                     Object.class,                                     new Class[]{QueryEvent.class});     me.invoke(elctx, new Object[]{queryEvent}); } Of course, this code also can be used as a starting point for other query manipulations and also works with saved custom criterias. To read more about the af:query component, see: http://download.oracle.com/docs/cd/E15523_01/apirefs.1111/e12419/tagdoc/af_query.html

    Read the article

< Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >