Search Results

Search found 8232 results on 330 pages for 'boolean expression'.

Page 122/330 | < Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >

  • Does XSD allow simpleContent and complexContent at the same time?

    - by Willi Schönborn
    I want to write an xsd for the xmlrpc spec (and generate java classes out of it using jaxb). The xmlrpc spec allows values like: <value><int>123</int></value> <value><boolean>1</boolean></value> But at the same time it requires: If no type is indicated, the type is string. Which means i could receive something like this: <value>test123</value> which is equivalent to <value><string>test123</string></value> Is there a way to define this in an xsd.

    Read the article

  • negative look ahead to exclude html tags

    - by Remoh
    I'm trying to come up with a validation expression to prevent users from entering html or javascript tags into a comment box on a web page. The following works fine for a single line of text: ^(?!.(<|)).$ ..but it won't allow any newline characters because of the dot(.). If I go with something like this: ^(?!.(<|))(.|\s)$ it will allow multiple lines but the expression only matches '<' and '' on the first line. I need it to match any line. This works fine: ^[-_\s\d\w"'.,:;#/&\$\%\?!@+*\()]{0,4000}$ but it's ugly and I'm concerned that it's going to break for some users because it's a multi-lingual application. Any ideas? Thanks!

    Read the article

  • Finding records within a 5 min time interval in SQL

    - by Mellonjollie
    I have a table with over 100,000 rows that contain the following columns: ID, Time, and Boolean. The time column tracks time down to the second. I need a query that will find all instances of Boolean = 1 for every 5 minute interval of time from the start of the table to the end, then group the count by time interval. The table represents 4 hours of data, so I should get 48 rows of results. I'm using MS SQL Server. I've tried a few approaches, but the time interval logic is giving me a hard time.

    Read the article

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Please explain how Trial Division works for Primality Test

    - by mister_dani
    I came across this algorithm for testing primality through trial division I fully understand this algorithm static boolean isPrime(int N) { if (N < 2) return false; for (int i = 2; i <= Math.sqrt(N); i++) if (N % i == 0) return false; return true; } It works just fine. But then I came across this other one which works just as good but I do not fully understand the logic behind it. static boolean isPrime(int N) { if (N < 2) return false; for (int i = 2; i * i<N; i++) if (N % i == 0) return false; return true; } It seems like i *i < N behaves like i <= Math.sqrt(N). If so, why?

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • Can SQLite file copied successfully on the data folder of an unrooted android device ?

    - by student
    I know that in order to access the data folder on the device, it needs to be rooted. However, if I just want to copy the database from my assets folder to the data folder on my device, will the copying process works on an unrooted phone? The following is my Database Helper class. From logcat, I can verify that the methods call to copyDataBase(), createDataBase() and openDataBase() are returned successfully. However, I got this error message android.database.sqlite.SQLiteException: no such table: TABLE_NAME: when my application is executing rawQuery. I'm suspecting the database file is not copied successfully (cannot be too sure as I do not have access to data folder), yet the method call to copyDatabase() are not throwing any exception. What could it be? Thanks. ps: My device is still unrooted, I hope it is not the main cause of the error. public DatabaseHelper(Context context) { super(context, DB_NAME, null, 1); this.myContext = context; } public void createDataBase() throws IOException{ boolean dbExist = checkDataBase(); String s = new Boolean(dbExist).toString(); Log.d("dbExist", s ); if(dbExist){ //do nothing - database already exist Log.d("createdatabase","DB exists so do nothing"); }else{ this.getReadableDatabase(); try { copyDataBase(); Log.d("copydatabase","Successful return frm method call!"); } catch (IOException e) { throw new Error("Error copying database"); } } } private boolean checkDataBase(){ File dbFile = new File(DB_PATH + DB_NAME); return dbFile.exists(); } private void copyDataBase() throws IOException{ //Open your local db as the input stream InputStream myInput = null; myInput = myContext.getAssets().open(DB_NAME); Log.d("copydatabase","InputStream successful!"); // Path to the just created empty db String outFileName = DB_PATH + DB_NAME; //Open the empty db as the output stream OutputStream myOutput = new FileOutputStream(outFileName); //transfer bytes from the inputfile to the outputfile byte[] buffer = new byte[1024]; int length; while ((length = myInput.read(buffer))>0){ myOutput.write(buffer, 0, length); } //Close the streams myOutput.flush(); myOutput.close(); myInput.close(); } public void openDataBase() throws SQLException{ //Open the database String myPath = DB_PATH + DB_NAME; myDataBase = SQLiteDatabase.openDatabase(myPath, null, SQLiteDatabase.OPEN_READONLY); } /* @Override public synchronized void close() { if(myDataBase != null) myDataBase.close(); super.close(); }*/ public void close() { // NOTE: openHelper must now be a member of CallDataHelper; // you currently have it as a local in your constructor if (myDataBase != null) { myDataBase.close(); } } @Override public void onCreate(SQLiteDatabase db) { } @Override public void onUpgrade(SQLiteDatabase db, int oldVersion, int newVersion) { } }

    Read the article

  • FULLTEXT Irrelevant results

    - by Imran Omar Bukhsh
    Just came across this issue using the fulltext search of mysql. I have like 250 records ( long articles like stuff ) and am using the fulltext MATCH AGAINST IN BOOLEAN MODE. Now if I search for a keyword e.g. 'Samsung' and if this keyword is present in ALL the records then it returns all the 250 records which it should ( of course without `IN BOOLEAN MODE it would return nothing as the keyword is present in more than 50% of the records ). Now the problem is that in some articles the keyword 'Samsung' occurs once and in others a couple of times, but MYSQL is giving a score of 1 to all the records returned, even those which have 'Samsung' like 15 times in them.

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • When debugging in VS 2008 why does the debugger land on a second return statement?

    - by Hellfire
    When debugging the following console program: class Program { static void Main(string[] args) { Console.WriteLine(DoIt(false)); Console.WriteLine(DoIt(true)); } private static Boolean DoIt(Boolean abort) { try { throw new InvalidOperationException(); } catch(Exception ex) { if (abort) { return true; } Console.WriteLine("Got here"); return false; } } } Why does the IDE land on the second return statement during the second call to DoIt()? The results of the execution is correct but the debugging experience is misleading. Is this a known issue? Is the behavior in VS 2010 the same?

    Read the article

  • Android LVL: Could not bind to service

    - by josh
    Hello, I'm trying to run LVL on my app but I'm getting this error when debugging on my phone: ERROR/LicenseChecker(29924): Could not bind to service. I tried on emulator too and I'm getting the same error, so I decided investigate on LicenseChecker.java and I changed: boolean bindResult = mContext.bindService( new Intent(ILicensingService.class.getName()), this, // ServiceConnection. Context.BIND_AUTO_CREATE); to: boolean bindResult = mContext.bindService( new Intent("com.android.vending.licensing.ILicensingService"), this, // ServiceConnection. Context.BIND_AUTO_CREATE); but same problem occurs. I'm testing with SDK 8, any idea how to solve this problem? Thanks in advance

    Read the article

  • Why is false being returned in this function

    - by Kay
    Hello all, I have this function below which makes it to the second IF function which sets the variable th as true but what is returned is false? Why?! public boolean nodeExist(TreeNode Tree, T value){ boolean th = false; if(Tree.getValue()!= null){ if(value == Tree.getValue()){ th = true; }else{ if(value.compareTo((T) Tree.getValue()) < 0){ nodeExist(Tree.getLeft(), value); }else{ nodeExist(Tree.getRight(), value); } } }else{ th = false; } return th; }

    Read the article

  • In Blackberry's Application class what is the difference between hasEventThread() and isHandlingEven

    - by Eric Sniff
    In Blackberry's Application class what is the difference between hasEventThread() and isHandlingEvents(). I'm just curious, because I have only found hasEventThread useful. From BB's docs for Applicaiton: public boolean hasEventThread() Determines if this application has entered the event dispatcher. Returns: True if this application has entered the event dispatcher (i.e. has invoked Application.enterEventDispatcher()); otherwise, false. isHandlingEvents public final boolean isHandlingEvents() Determines if this application has entered the event dispatch loop. Returns: True if the application has entered the event dispatch loop; otherwise, false. My only guess is that isHandlingEvents most happen sometime after hasEventThread. But is that really that useful?

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • i have done code so please help

    - by davit-datuashvili
    public class bitap{ public static void main(String[]args){ String text="tbillisi"; String pattern="tbilxiri"; int k=2; int m=pattern.length(); long pattern_mask[]=new long[Character.MAX_VALUE+1]; String result=""; boolean[]R=new boolean[m+1]; long i,d; for (i=0;i<=k;i++){ R[i]=~1; } for (i=0;i if (0==(R[k]& (1< System.out.println(result); } } http://en.wikipedia.org/wiki/Bitap_algorithm from this site

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Help doing a dynamic sort?

    - by Kevin
    I have a notifications table which contains different types of notifications for different events. Inside the table is a notifications_type:string column that contains the type of notification, i.e. "foo" or "bar" or "oof" I want the user to be able to select what notifications they want to display, so there are checkboxes below the result that correspond to prefs_display_foo:boolean, prefs_display_bar:boolean in the User model. What is an elegant way for me to set the :conditions in the find to properly display the sorted results? Also, currently I have it as a method in the user, but how would I do it as a has_many :notifications, :conditions = .....

    Read the article

  • Multiple uses of "this" keyword in Java

    - by frodosamoa
    So, I have this. It compares two card decks and if they are the same the result is true. public boolean equals ( Object obj ) { boolean result = true; for (int i = 0; i < 52; i++) { if (this.cardAt(i) = this2.cardlist(i)) { result = true; } else { result = false; } } } I would like to be able to compare two random card decks, if you will. But I don't know how to compare two different ones using "this . I simply wrote "this2" to replace another instance of "this". What could I do to replace this "this2" to still be able to compare two card decks?

    Read the article

< Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >