Search Results

Search found 8232 results on 330 pages for 'boolean expression'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 122/330 | < Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >

  • In Blackberry's Application class what is the difference between hasEventThread() and isHandlingEven

    - by Eric Sniff
    In Blackberry's Application class what is the difference between hasEventThread() and isHandlingEvents(). I'm just curious, because I have only found hasEventThread useful. From BB's docs for Applicaiton: public boolean hasEventThread() Determines if this application has entered the event dispatcher. Returns: True if this application has entered the event dispatcher (i.e. has invoked Application.enterEventDispatcher()); otherwise, false. isHandlingEvents public final boolean isHandlingEvents() Determines if this application has entered the event dispatch loop. Returns: True if the application has entered the event dispatch loop; otherwise, false. My only guess is that isHandlingEvents most happen sometime after hasEventThread. But is that really that useful?

    Read the article

  • Why is false being returned in this function

    - by Kay
    Hello all, I have this function below which makes it to the second IF function which sets the variable th as true but what is returned is false? Why?! public boolean nodeExist(TreeNode Tree, T value){ boolean th = false; if(Tree.getValue()!= null){ if(value == Tree.getValue()){ th = true; }else{ if(value.compareTo((T) Tree.getValue()) < 0){ nodeExist(Tree.getLeft(), value); }else{ nodeExist(Tree.getRight(), value); } } }else{ th = false; } return th; }

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • How to check whether a String fully matches a Regex in Scala?

    - by mkneissl
    Assume I have a Regex pattern I want to match many Strings to. val Digit = """\d""".r I just want to check whether a given String fully matches the Regex. What is a good and idiomatic way to do this in Scala? I know that I can pattern match on Regexes, but this is syntactically not very pleasing in this case, because I have no groups to extract: scala> "5" match { case Digit() => true case _ => false } res4: Boolean = true Or I could fall back to the underlying Java pattern: scala> Digit.pattern.matcher("5").matches res6: Boolean = true which is not elegant, either. Is there a better solution?

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • Please explain how Trial Division works for Primality Test

    - by mister_dani
    I came across this algorithm for testing primality through trial division I fully understand this algorithm static boolean isPrime(int N) { if (N < 2) return false; for (int i = 2; i <= Math.sqrt(N); i++) if (N % i == 0) return false; return true; } It works just fine. But then I came across this other one which works just as good but I do not fully understand the logic behind it. static boolean isPrime(int N) { if (N < 2) return false; for (int i = 2; i * i<N; i++) if (N % i == 0) return false; return true; } It seems like i *i < N behaves like i <= Math.sqrt(N). If so, why?

    Read the article

  • When debugging in VS 2008 why does the debugger land on a second return statement?

    - by Hellfire
    When debugging the following console program: class Program { static void Main(string[] args) { Console.WriteLine(DoIt(false)); Console.WriteLine(DoIt(true)); } private static Boolean DoIt(Boolean abort) { try { throw new InvalidOperationException(); } catch(Exception ex) { if (abort) { return true; } Console.WriteLine("Got here"); return false; } } } Why does the IDE land on the second return statement during the second call to DoIt()? The results of the execution is correct but the debugging experience is misleading. Is this a known issue? Is the behavior in VS 2010 the same?

    Read the article

  • Finding records within a 5 min time interval in SQL

    - by Mellonjollie
    I have a table with over 100,000 rows that contain the following columns: ID, Time, and Boolean. The time column tracks time down to the second. I need a query that will find all instances of Boolean = 1 for every 5 minute interval of time from the start of the table to the end, then group the count by time interval. The table represents 4 hours of data, so I should get 48 rows of results. I'm using MS SQL Server. I've tried a few approaches, but the time interval logic is giving me a hard time.

    Read the article

  • i have done code so please help

    - by davit-datuashvili
    public class bitap{ public static void main(String[]args){ String text="tbillisi"; String pattern="tbilxiri"; int k=2; int m=pattern.length(); long pattern_mask[]=new long[Character.MAX_VALUE+1]; String result=""; boolean[]R=new boolean[m+1]; long i,d; for (i=0;i<=k;i++){ R[i]=~1; } for (i=0;i if (0==(R[k]& (1< System.out.println(result); } } http://en.wikipedia.org/wiki/Bitap_algorithm from this site

    Read the article

  • Help doing a dynamic sort?

    - by Kevin
    I have a notifications table which contains different types of notifications for different events. Inside the table is a notifications_type:string column that contains the type of notification, i.e. "foo" or "bar" or "oof" I want the user to be able to select what notifications they want to display, so there are checkboxes below the result that correspond to prefs_display_foo:boolean, prefs_display_bar:boolean in the User model. What is an elegant way for me to set the :conditions in the find to properly display the sorted results? Also, currently I have it as a method in the user, but how would I do it as a has_many :notifications, :conditions = .....

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Android LVL: Could not bind to service

    - by josh
    Hello, I'm trying to run LVL on my app but I'm getting this error when debugging on my phone: ERROR/LicenseChecker(29924): Could not bind to service. I tried on emulator too and I'm getting the same error, so I decided investigate on LicenseChecker.java and I changed: boolean bindResult = mContext.bindService( new Intent(ILicensingService.class.getName()), this, // ServiceConnection. Context.BIND_AUTO_CREATE); to: boolean bindResult = mContext.bindService( new Intent("com.android.vending.licensing.ILicensingService"), this, // ServiceConnection. Context.BIND_AUTO_CREATE); but same problem occurs. I'm testing with SDK 8, any idea how to solve this problem? Thanks in advance

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • ActionScript Custom Class With Return Type?

    - by TheDarkIn1978
    i just know this is a dumb question, so excuse me in advance. i want to essentially classify a simple function in it's own .as file. the function compares integers. but i don't know how to call the class and receive a boolean return. here's my class package { public class CompareInts { public function CompareInts(small:int, big:int) { compare(small, big); } private function compare(small:int, big:int):Boolean { if (small < big) return true; else return false; } } } so now i'd like to write something like this: if (CompareInts(1, 5) == true). or output 'true' by writing trace(CompareInts(1, 5));

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • Returning string in java using 3 parameters

    - by user2905118
    Need to write a method describePerson() that takes 3 parameters, a String giving a person’s name, a boolean indicating their gender (true for female, false for male), and an integer giving their age. The method should return a String formatted as in the following examples: Lark is female. She is 2 years old. Or Jay is male. He is 1 year old. I am not sure how to write it correctly (my code): int describePerson(String name, boolean gender, int age) { String words=""; if(gender==true) return (name + "is "+gender+". "+"She is"+age+ "years old.); else return (name + "is "+gender+". "+"She is"+age+ "years old.); } The outcome "year" and "years" is also differs, but i don't know how to make it correct..

    Read the article

  • How do I "valueOf" an enum given a class name?

    - by stevemac
    Lets say I have a simple Enum called Animal defined as: public enum Animal { CAT, DOG } and I have a method like: private static Object valueOf(String value, Class<?> classType) { if (classType == String.class) { return value; } if (classType == Integer.class) { return Integer.parseInt(value); } if (classType == Long.class) { return Long.parseLong(value); } if (classType == Boolean.class) { return Boolean.parseBoolean(value); } // Enum resolution here } What can I put inside this method to return an instance of my enum where the value is of the classType? I have looked at trying: if (classType == Enum.class) { return Enum.valueOf((Class<Enum>)classType, value); } But that doesn't work.

    Read the article

  • Multiple uses of "this" keyword in Java

    - by frodosamoa
    So, I have this. It compares two card decks and if they are the same the result is true. public boolean equals ( Object obj ) { boolean result = true; for (int i = 0; i < 52; i++) { if (this.cardAt(i) = this2.cardlist(i)) { result = true; } else { result = false; } } } I would like to be able to compare two random card decks, if you will. But I don't know how to compare two different ones using "this . I simply wrote "this2" to replace another instance of "this". What could I do to replace this "this2" to still be able to compare two card decks?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 118 119 120 121 122 123 124 125 126 127 128 129  | Next Page >