Search Results

Search found 4426 results on 178 pages for 'cs student'.

Page 124/178 | < Previous Page | 120 121 122 123 124 125 126 127 128 129 130 131  | Next Page >

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Programmatically Setting the Version of a Window's Service on the ProjectInstaller

    - by user302004
    I have a Windows Service created in Visual Studio 2005 in C#. I have a setup project and a ProjectInstaller class. I also have code to programmatically get the version from the AssemblyFileVersionAttribute. I need to figure out where I set the version that I've obtained (and where this code should go). I tried placing it in the InitializeComponent method on ProjectInstaller.Designer.cs and then appending the version to serviceInstaller1.DisplayName and serviceInstaller1.ServiceName. This didn't work and you're not supposed to modify the contents of this method. Any ideas?

    Read the article

  • C++ Questions about vectors

    - by xbonez
    Hey guys, I have a CS exam tomorrow. Just want to get a few questions cleared up. Thanks a lot, and I really appreciate the help. Que 1. What are parallel vectors? Vectors of the same length that contain data that is meant to be processed together Vectors that are all of the same data type Vectors that are of the same length Any vector of data type parallel Que 2. Arrays are faster and more efficient than vectors. True False Que 3. Arrays can be a return type of a function call. True False Que 4. Vectors can be a return type of a function call. True False

    Read the article

  • Changing careers to Software Engineering.... Wise?

    - by Phil
    Hello everyone, I notice this site has a wealth of software professionals and I am investigating a career change to Software Engineering: *Particularly, I would like to know how likely one would be able to work from home or another country over the internet. Is this something that can be done and what does it usually entail? (time?,experience?, specific companies?, etc) *Currently, I am a teacher but always had a passion for tech. I am interested in a MS - Software Engineering program designed for individuals based from another field. Is this a wise degree to obtain? Would I be just wasting my time and money obtaining this degree? (I'm suspicious about this program and the feasibility of obtaining employment without a healthy CS background) Thanks for any assistance you can provide!

    Read the article

  • SiteCore 6.5 - GeneralLink

    - by Steve Ward
    Im new to SiteCore.. I have created a Page template and add a field for a URL of type General Link. I have created another field for the text for the link (this is standard practice in this project). I simply want to display the link in my user control but I just cant get it to work. This should be simple but Im going round in circles Here's an example of the code I've tried .. ascx : ascx.cs: lnkMain.NavigateUrl = SiteCore.Context.Item.GetGeneralLink("Link1"); lnkMain.Text = item.GetFieldValue("Link1Text");

    Read the article

  • How to manage enterprise network of Linux machines?

    - by killy9999
    I work at the university. In my institute we have six computer laboratories used for teaching. Each lab has almost 20 computers, which gives over 100 machines total. Computers have either Windows XP or Windows 7 Eneterprise operating system. We use Symantec Ghost to manage all the computers. Each computer has a Ghost client installed, which allows to control computers over network. Every six months we restore a master image on one of the computers in a lab, update that image and distribute it over the network to all computers in a laboratory. Thanks to Ghost client this is done automatically with just a few clicks. Recently I suggested that it would be good to have Linux installed in the laboratories. The administrators were concerned that we would not be able to manage that many computers if each would have to be updated manually. The question is: how to manage such a huge network of Linux machines in an automated way? To make the description of our network more complete I'll add that all students have their accounts (about few thousand users) on a central server. These are accessed via LDAP. To use a computer in laboratory each student has to log in using his own account.

    Read the article

  • Thread 0 crashed with X86 Thread State (32-bit): in cocoa Application

    - by John
    I am doing crash fixing in an osx application .The crash report shows Date/Time: 2012-05-01 16:05:58.004 +0200 OS Version: Mac OS X 10.5.8 (9L31a) Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000000545f5f00 Crashed Thread: 8 Thread 8 crashed with X86 Thread State (32-bit): eax: 0x140e0850 ebx: 0x00060fc8 ecx: 0x92df0ec0 edx: 0xc0000003 edi: 0x545f5f00 esi: 0x140e0870 ebp: 0xb0445988 esp: 0xb0445964 ss: 0x0000001f efl: 0x00010206 eip: 0x92dca68c cs: 0x00000017 ds: 0x0000001f es: 0x0000001f fs: 0x0000001f gs: 0x00000037 cr2: 0x545f5f00 How to tares the application code with this report? what is Thread 0 crashed with X86 Thread State (32-bit)? if anybody know please help me. Thanks in advance.

    Read the article

  • Error message regarding IEnumerable.GetEnumerator().

    - by Bon_chan
    I get this error message and I can't figure out why! Error 1 'Exo5Chap12.ShortCollection<T>' does not implement interface member 'System.Collections.IEnumerable.GetEnumerator()'. 'Exo5Chap12.ShortCollection<T>.GetEnumerator()' cannot implement 'System.Collections.IEnumerable.GetEnumerator()' because it does not have the matching return type of 'System.Collections.IEnumerator'. E:\MyFolders\Dev\c#\Chapter12\Exo5Chap12\Exo5Chap12\exo5.cs 9 18 Exo5Chap12 Here is the code with an implementation of GetEnumerator(). What is wrong? public class ShortCollection<T> : IList<T> { protected Collection<T> innerCollection; protected int maxSize = 10; public IEnumerator<T> GetEnumerator() { return (innerCollection as IEnumerator<T>).GetEnumerator(); } }

    Read the article

  • Should I use C(99) booleans ? ( also c++ booleans in c++ ?)

    - by Roman A. Taycher
    I haven't done much c programming but when I do when I need a false I put 0 when I want true I put 1, (ex. while(1)), in other cases I use things like "while(ptr)" or "if(x)". Should I try using C99 booleans, should I recommend them to others if I'm helping people new to programming learn c basics(thinking of cs 1?? students)? I'm pretty sure the Visual Studio compiler supports c99 bools, but do a lot of projects (open source and c apps in industry) compile for c89? If I don't use C bools should I at least do something like #define TRUE 1 #define FALSE 0? Also what about c++ Booleans (for c++)?

    Read the article

  • Catching / Redirecting 404's (ASP.NET)

    - by maxp
    Ive noticed that when I request a page in ASP.NET (webforms) that does not exist, the 'StaticFile' handler deals with the error notification. Id like to be a bit more helpful in these situations. What is the correct way for me to intercept this 404, and as a result, run some code to redirect the user? Two ways Ive thought of doing which I currently don't really like are: 1 - Create a module that basically does a if (!file.exists($url){redirect to $correctedurl}) 2 - Modify the error.aspx.cs(or the default error page) to do something similar (yuck!)

    Read the article

  • Did anybody use the constream (constrea.h) lib?

    - by user337938
    Two years ago, I used the conio.h (actually conio2.h for Dev-C++) to create a console form interface. Now I want to make the same thing, but C++ std lib does not provide the needed functions and I don't want to use the old C conio lib. I found some websites which highlights the constream lib, but I have no idea to use it on VS! I tried just copying the header file into my project, but VS show several erros. I believe I am doing something wrong. ps: i got this file: ftp://ftp.cs.technion.ac.il/pub/misc/baram/TC31/INCLUDE/CONSTREA.H

    Read the article

  • IEnumerable<SelectListItem> error question

    - by user281180
    I have the following code, but i`m having error of Error 6 foreach statement cannot operate on variables of type 'int' because 'int' does not contain a public definition for 'GetEnumerator' C:\Dev\DEV\Code\MvcUI\Models\MappingModel.cs 100 13 MvcUI How can I solve this? Note: string [] projectID; Class Employee { int id {get; set;} string Name {get;set;} } public IEnumerable<SelectListItem> GetStudents() { List<SelectListItem> result = new List<SelectListItem>(); foreach (var id in Convert.ToInt32(projectID)) { foreach( Employee emp in Project.Load(id)) result.Add(new SelectListItem { Selected = false, Text = emp.ID.ToString(), Value = emp.Name }); return result.AsEnumerable(); } }

    Read the article

  • Hilighting div tag in Masterpage on redirection to content page

    - by user1713632
    I have a link in Master page within a div tag. I want to highlight the div when I am clicking the link, in order to redirect to some content page. I have written the following code: <li> <div id="div_test" runat="server"> <asp:LinkButton ID="lnk_test_menu" Font-Underline="false" ForeColor="Black" runat="server" Text="Test Link" CausesValidation="false" onclick="lnk_test_menu_Click1" > </asp:LinkButton></div> </li> Code in the cs page: protected void lnk_test_menu_Click1(object sender, EventArgs e) { div_test.Attributes.Add("class", "testSelected"); Response.Redirect(Test.aspx"); } The div in the master page is not being selected on redirection. Could anybody help me on this?

    Read the article

  • Data binding of itemscontrol in Silverlight 3.0

    - by jmkarthik
    I am trying to define an itemscontrol and data bind it to a List and the code is as below. XAML Item Class public class Item { public string val; } XAML.cs public MainPage() { InitializeComponent(); List<Item> items = new List<Item>(); Item item1 = new Item(); item1.val = "iasl;fdj1"; items.Add(item1); Item item2 = new Item(); item2.val = "iasfdkasdkljf2"; items.Add(item2); ic.ItemsSource = items; } The items are displayed when I run this. Am I missing something?

    Read the article

  • How to Use a Windows App with Embeded files and folders to copy to a destination. In C#

    - by Mark Sweetman
    I am trying to write a small application, whose only purpose is to copy some folders and .cs source files into a user specified Directory, I can do it easy enough by simply having the application look for the files and folders in its own install directory then copy them to thier destination Directory, but I was wondering if its possible to Embed the Folders and Files into the Application, so that when you run the application it creates or copies the folders and files from the exe app directly to the install directory, rather than searching for them in the apps install directory then copying them over. Basically Im trying to only have a single exe file rather than having an exe file and a bunch of folders and files along side it. Is this possible to do with just a Windows Form App without using an actual Installer Class?

    Read the article

  • Introducing the Earthquake Locator – A Bing Maps Silverlight Application, part 1

    - by Bobby Diaz
    Update: Live demo and source code now available!  The recent wave of earthquakes (no pun intended) being reported in the news got me wondering about the frequency and severity of earthquakes around the world. Since I’ve been doing a lot of Silverlight development lately, I decided to scratch my curiosity with a nice little Bing Maps application that will show the location and relative strength of recent seismic activity. Here is a list of technologies this application will utilize, so be sure to have everything downloaded and installed if you plan on following along. Silverlight 3 WCF RIA Services Bing Maps Silverlight Control * Managed Extensibility Framework (optional) MVVM Light Toolkit (optional) log4net (optional) * If you are new to Bing Maps or have not signed up for a Developer Account, you will need to visit www.bingmapsportal.com to request a Bing Maps key for your application. Getting Started We start out by creating a new Silverlight Application called EarthquakeLocator and specify that we want to automatically create the Web Application Project with RIA Services enabled. I cleaned up the web app by removing the Default.aspx and EarthquakeLocatorTestPage.html. Then I renamed the EarthquakeLocatorTestPage.aspx to Default.aspx and set it as my start page. I also set the development server to use a specific port, as shown below. RIA Services Next, I created a Services folder in the EarthquakeLocator.Web project and added a new Domain Service Class called EarthquakeService.cs. This is the RIA Services Domain Service that will provide earthquake data for our client application. I am not using LINQ to SQL or Entity Framework, so I will use the <empty domain service class> option. We will be pulling data from an external Atom feed, but this example could just as easily pull data from a database or another web service. This is an important distinction to point out because each scenario I just mentioned could potentially use a different Domain Service base class (i.e. LinqToSqlDomainService<TDataContext>). Now we can start adding Query methods to our EarthquakeService that pull data from the USGS web site. Here is the complete code for our service class: using System; using System.Collections.Generic; using System.IO; using System.Linq; using System.ServiceModel.Syndication; using System.Web.DomainServices; using System.Web.Ria; using System.Xml; using log4net; using EarthquakeLocator.Web.Model;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// Provides earthquake data to client applications.     /// </summary>     [EnableClientAccess()]     public class EarthquakeService : DomainService     {         private static readonly ILog log = LogManager.GetLogger(typeof(EarthquakeService));           // USGS Data Feeds: http://earthquake.usgs.gov/earthquakes/catalogs/         private const string FeedForPreviousDay =             "http://earthquake.usgs.gov/earthquakes/catalogs/1day-M2.5.xml";         private const string FeedForPreviousWeek =             "http://earthquake.usgs.gov/earthquakes/catalogs/7day-M2.5.xml";           /// <summary>         /// Gets the earthquake data for the previous week.         /// </summary>         /// <returns>A queryable collection of <see cref="Earthquake"/> objects.</returns>         public IQueryable<Earthquake> GetEarthquakes()         {             var feed = GetFeed(FeedForPreviousWeek);             var list = new List<Earthquake>();               if ( feed != null )             {                 foreach ( var entry in feed.Items )                 {                     var quake = CreateEarthquake(entry);                     if ( quake != null )                     {                         list.Add(quake);                     }                 }             }               return list.AsQueryable();         }           /// <summary>         /// Creates an <see cref="Earthquake"/> object for each entry in the Atom feed.         /// </summary>         /// <param name="entry">The Atom entry.</param>         /// <returns></returns>         private Earthquake CreateEarthquake(SyndicationItem entry)         {             Earthquake quake = null;             string title = entry.Title.Text;             string summary = entry.Summary.Text;             string point = GetElementValue<String>(entry, "point");             string depth = GetElementValue<String>(entry, "elev");             string utcTime = null;             string localTime = null;             string depthDesc = null;             double? magnitude = null;             double? latitude = null;             double? longitude = null;             double? depthKm = null;               if ( !String.IsNullOrEmpty(title) && title.StartsWith("M") )             {                 title = title.Substring(2, title.IndexOf(',')-3).Trim();                 magnitude = TryParse(title);             }             if ( !String.IsNullOrEmpty(point) )             {                 var values = point.Split(' ');                 if ( values.Length == 2 )                 {                     latitude = TryParse(values[0]);                     longitude = TryParse(values[1]);                 }             }             if ( !String.IsNullOrEmpty(depth) )             {                 depthKm = TryParse(depth);                 if ( depthKm != null )                 {                     depthKm = Math.Round((-1 * depthKm.Value) / 100, 2);                 }             }             if ( !String.IsNullOrEmpty(summary) )             {                 summary = summary.Replace("</p>", "");                 var values = summary.Split(                     new string[] { "<p>" },                     StringSplitOptions.RemoveEmptyEntries);                   if ( values.Length == 3 )                 {                     var times = values[1].Split(                         new string[] { "<br>" },                         StringSplitOptions.RemoveEmptyEntries);                       if ( times.Length > 0 )                     {                         utcTime = times[0];                     }                     if ( times.Length > 1 )                     {                         localTime = times[1];                     }                       depthDesc = values[2];                     depthDesc = "Depth: " + depthDesc.Substring(depthDesc.IndexOf(":") + 2);                 }             }               if ( latitude != null && longitude != null )             {                 quake = new Earthquake()                 {                     Id = entry.Id,                     Title = entry.Title.Text,                     Summary = entry.Summary.Text,                     Date = entry.LastUpdatedTime.DateTime,                     Url = entry.Links.Select(l => Path.Combine(l.BaseUri.OriginalString,                         l.Uri.OriginalString)).FirstOrDefault(),                     Age = entry.Categories.Where(c => c.Label == "Age")                         .Select(c => c.Name).FirstOrDefault(),                     Magnitude = magnitude.GetValueOrDefault(),                     Latitude = latitude.GetValueOrDefault(),                     Longitude = longitude.GetValueOrDefault(),                     DepthInKm = depthKm.GetValueOrDefault(),                     DepthDesc = depthDesc,                     UtcTime = utcTime,                     LocalTime = localTime                 };             }               return quake;         }           private T GetElementValue<T>(SyndicationItem entry, String name)         {             var el = entry.ElementExtensions.Where(e => e.OuterName == name).FirstOrDefault();             T value = default(T);               if ( el != null )             {                 value = el.GetObject<T>();             }               return value;         }           private double? TryParse(String value)         {             double d;             if ( Double.TryParse(value, out d) )             {                 return d;             }             return null;         }           /// <summary>         /// Gets the feed at the specified URL.         /// </summary>         /// <param name="url">The URL.</param>         /// <returns>A <see cref="SyndicationFeed"/> object.</returns>         public static SyndicationFeed GetFeed(String url)         {             SyndicationFeed feed = null;               try             {                 log.Debug("Loading RSS feed: " + url);                   using ( var reader = XmlReader.Create(url) )                 {                     feed = SyndicationFeed.Load(reader);                 }             }             catch ( Exception ex )             {                 log.Error("Error occurred while loading RSS feed: " + url, ex);             }               return feed;         }     } }   The only method that will be generated in the client side proxy class, EarthquakeContext, will be the GetEarthquakes() method. The reason being that it is the only public instance method and it returns an IQueryable<Earthquake> collection that can be consumed by the client application. GetEarthquakes() calls the static GetFeed(String) method, which utilizes the built in SyndicationFeed API to load the external data feed. You will need to add a reference to the System.ServiceModel.Web library in order to take advantage of the RSS/Atom reader. The API will also allow you to create your own feeds to serve up in your applications. Model I have also created a Model folder and added a new class, Earthquake.cs. The Earthquake object will hold the various properties returned from the Atom feed. Here is a sample of the code for that class. Notice the [Key] attribute on the Id property, which is required by RIA Services to uniquely identify the entity. using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ComponentModel.DataAnnotations;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     [DataContract]     public class Earthquake     {         /// <summary>         /// Gets or sets the id.         /// </summary>         /// <value>The id.</value>         [Key]         [DataMember]         public string Id { get; set; }           /// <summary>         /// Gets or sets the title.         /// </summary>         /// <value>The title.</value>         [DataMember]         public string Title { get; set; }           /// <summary>         /// Gets or sets the summary.         /// </summary>         /// <value>The summary.</value>         [DataMember]         public string Summary { get; set; }           // additional properties omitted     } }   View Model The recent trend to use the MVVM pattern for WPF and Silverlight provides a great way to separate the data and behavior logic out of the user interface layer of your client applications. I have chosen to use the MVVM Light Toolkit for the Earthquake Locator, but there are other options out there if you prefer another library. That said, I went ahead and created a ViewModel folder in the Silverlight project and added a EarthquakeViewModel class that derives from ViewModelBase. Here is the code: using System; using System.Collections.ObjectModel; using System.ComponentModel.Composition; using System.ComponentModel.Composition.Hosting; using Microsoft.Maps.MapControl; using GalaSoft.MvvmLight; using EarthquakeLocator.Web.Model; using EarthquakeLocator.Web.Services;   namespace EarthquakeLocator.ViewModel {     /// <summary>     /// Provides data for views displaying earthquake information.     /// </summary>     public class EarthquakeViewModel : ViewModelBase     {         [Import]         public EarthquakeContext Context;           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         public EarthquakeViewModel()         {             var catalog = new AssemblyCatalog(GetType().Assembly);             var container = new CompositionContainer(catalog);             container.ComposeParts(this);             Initialize();         }           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         /// <param name="context">The context.</param>         public EarthquakeViewModel(EarthquakeContext context)         {             Context = context;             Initialize();         }           private void Initialize()         {             MapCenter = new Location(20, -170);             ZoomLevel = 2;         }           #region Private Methods           private void OnAutoLoadDataChanged()         {             LoadEarthquakes();         }           private void LoadEarthquakes()         {             var query = Context.GetEarthquakesQuery();             Context.Earthquakes.Clear();               Context.Load(query, (op) =>             {                 if ( !op.HasError )                 {                     foreach ( var item in op.Entities )                     {                         Earthquakes.Add(item);                     }                 }             }, null);         }           #endregion Private Methods           #region Properties           private bool autoLoadData;         /// <summary>         /// Gets or sets a value indicating whether to auto load data.         /// </summary>         /// <value><c>true</c> if auto loading data; otherwise, <c>false</c>.</value>         public bool AutoLoadData         {             get { return autoLoadData; }             set             {                 if ( autoLoadData != value )                 {                     autoLoadData = value;                     RaisePropertyChanged("AutoLoadData");                     OnAutoLoadDataChanged();                 }             }         }           private ObservableCollection<Earthquake> earthquakes;         /// <summary>         /// Gets the collection of earthquakes to display.         /// </summary>         /// <value>The collection of earthquakes.</value>         public ObservableCollection<Earthquake> Earthquakes         {             get             {                 if ( earthquakes == null )                 {                     earthquakes = new ObservableCollection<Earthquake>();                 }                   return earthquakes;             }         }           private Location mapCenter;         /// <summary>         /// Gets or sets the map center.         /// </summary>         /// <value>The map center.</value>         public Location MapCenter         {             get { return mapCenter; }             set             {                 if ( mapCenter != value )                 {                     mapCenter = value;                     RaisePropertyChanged("MapCenter");                 }             }         }           private double zoomLevel;         /// <summary>         /// Gets or sets the zoom level.         /// </summary>         /// <value>The zoom level.</value>         public double ZoomLevel         {             get { return zoomLevel; }             set             {                 if ( zoomLevel != value )                 {                     zoomLevel = value;                     RaisePropertyChanged("ZoomLevel");                 }             }         }           #endregion Properties     } }   The EarthquakeViewModel class contains all of the properties that will be bound to by the various controls in our views. Be sure to read through the LoadEarthquakes() method, which handles calling the GetEarthquakes() method in our EarthquakeService via the EarthquakeContext proxy, and also transfers the loaded entities into the view model’s Earthquakes collection. Another thing to notice is what’s going on in the default constructor. I chose to use the Managed Extensibility Framework (MEF) for my composition needs, but you can use any dependency injection library or none at all. To allow the EarthquakeContext class to be discoverable by MEF, I added the following partial class so that I could supply the appropriate [Export] attribute: using System; using System.ComponentModel.Composition;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// The client side proxy for the EarthquakeService class.     /// </summary>     [Export]     public partial class EarthquakeContext     {     } }   One last piece I wanted to point out before moving on to the user interface, I added a client side partial class for the Earthquake entity that contains helper properties that we will bind to later: using System;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     public partial class Earthquake     {         /// <summary>         /// Gets the location based on the current Latitude/Longitude.         /// </summary>         /// <value>The location.</value>         public string Location         {             get { return String.Format("{0},{1}", Latitude, Longitude); }         }           /// <summary>         /// Gets the size based on the Magnitude.         /// </summary>         /// <value>The size.</value>         public double Size         {             get { return (Magnitude * 3); }         }     } }   View Now the fun part! Usually, I would create a Views folder to place all of my View controls in, but I took the easy way out and added the following XAML code to the default MainPage.xaml file. Be sure to add the bing prefix associating the Microsoft.Maps.MapControl namespace after adding the assembly reference to your project. The MVVM Light Toolkit project templates come with a ViewModelLocator class that you can use via a static resource, but I am instantiating the EarthquakeViewModel directly in my user control. I am setting the AutoLoadData property to true as a way to trigger the LoadEarthquakes() method call. The MapItemsControl found within the <bing:Map> control binds its ItemsSource property to the Earthquakes collection of the view model, and since it is an ObservableCollection<T>, we get the automatic two way data binding via the INotifyCollectionChanged interface. <UserControl x:Class="EarthquakeLocator.MainPage"     xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"     xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"     xmlns:d="http://schemas.microsoft.com/expression/blend/2008"     xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"     xmlns:bing="clr-namespace:Microsoft.Maps.MapControl;assembly=Microsoft.Maps.MapControl"     xmlns:vm="clr-namespace:EarthquakeLocator.ViewModel"     mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480" >     <UserControl.Resources>         <DataTemplate x:Key="EarthquakeTemplate">             <Ellipse Fill="Red" Stroke="Black" StrokeThickness="1"                      Width="{Binding Size}" Height="{Binding Size}"                      bing:MapLayer.Position="{Binding Location}"                      bing:MapLayer.PositionOrigin="Center">                 <ToolTipService.ToolTip>                     <StackPanel>                         <TextBlock Text="{Binding Title}" FontSize="14" FontWeight="Bold" />                         <TextBlock Text="{Binding UtcTime}" />                         <TextBlock Text="{Binding LocalTime}" />                         <TextBlock Text="{Binding DepthDesc}" />                     </StackPanel>                 </ToolTipService.ToolTip>             </Ellipse>         </DataTemplate>     </UserControl.Resources>       <UserControl.DataContext>         <vm:EarthquakeViewModel AutoLoadData="True" />     </UserControl.DataContext>       <Grid x:Name="LayoutRoot">           <bing:Map x:Name="map" CredentialsProvider="--Your-Bing-Maps-Key--"                   Center="{Binding MapCenter, Mode=TwoWay}"                   ZoomLevel="{Binding ZoomLevel, Mode=TwoWay}">             <bing:MapItemsControl ItemsSource="{Binding Earthquakes}"                                   ItemTemplate="{StaticResource EarthquakeTemplate}" />         </bing:Map>       </Grid> </UserControl>   The EarthquakeTemplate defines the Ellipse that will represent each earthquake, the Width and Height that are determined by the Magnitude, the Position on the map, and also the tooltip that will appear when we mouse over each data point. Running the application will give us the following result (shown with a tooltip example): That concludes this portion of our show but I plan on implementing additional functionality in later blog posts. Be sure to come back soon to see the next installments in this series. Enjoy!   Additional Resources USGS Earthquake Data Feeds Brad Abrams shows how RIA Services and MVVM can work together

    Read the article

  • Dynamic connection for LINQ to SQL DataContext

    - by Steve Clements
    If for some reason you need to specify a specific connection string for a DataContext, you can of course pass the connection string when you initialise you DataContext object.  A common scenario could be a dev/test/stage/live connection string, but in my case its for either a live or archive database.   I however want the connection string to be handled by the DataContext, there are probably lots of different reasons someone would want to do this…but here are mine. I want the same connection string for all instances of DataContext, but I don’t know what it is yet! I prefer the clean code and ease of not using a constructor parameter. The refactoring of using a constructor parameter could be a nightmare.   So my approach is to create a new partial class for the DataContext and handle empty constructor in there. First from within the LINQ to SQL designer I changed the connection property to None.  This will remove the empty constructor code from the auto generated designer.cs file. Right click on the .dbml file, click View Code and a file and class is created for you! You’ll see the new class created in solutions explorer and the file will open. We are going to be playing with constructors so you need to add the inheritance from System.Data.Linq.DataContext public partial class DataClasses1DataContext : System.Data.Linq.DataContext    {    }   Add the empty constructor and I have added a property that will get my connection string, you will have whatever logic you need to decide and get the connection string you require.  In my case I will be hitting a database, but I have omitted that code. public partial class DataClasses1DataContext : System.Data.Linq.DataContext {    // Connection String Keys - stored in web.config    static string LiveConnectionStringKey = "LiveConnectionString";    static string ArchiveConnectionStringKey = "ArchiveConnectionString";      protected static string ConnectionString    {       get       {          if (DoIWantToUseTheLiveConnection) {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[LiveConnectionStringKey].ConnectionString;          }          else {             return global::System.Configuration.ConfigurationManager.ConnectionStrings[ArchiveConnectionStringKey].ConnectionString;          }       }    }      public DataClasses1DataContext() :       base(ConnectionString, mappingSource)    {       OnCreated();    } }   Now when I new up my DataContext, I can just leave the constructor empty and my partial class will decide which one i need to use. Nice, clean code that can be easily refractored and tested.   Share this post :

    Read the article

  • Fixing the Model Binding issue of ASP.NET MVC 4 and ASP.NET Web API

    - by imran_ku07
            Introduction:                     Yesterday when I was checking ASP.NET forums, I found an important issue/bug in ASP.NET MVC 4 and ASP.NET Web API. The issue is present in System.Web.PrefixContainer class which is used by both ASP.NET MVC and ASP.NET Web API assembly. The details of this issue is available in this thread. This bug can be a breaking change for you if you upgraded your application to ASP.NET MVC 4 and your application model properties using the convention available in the above thread. So, I have created a package which will fix this issue both in ASP.NET MVC and ASP.NET Web API. In this article, I will show you how to use this package.           Description:                     Create or open an ASP.NET MVC 4 project and install ImranB.ModelBindingFix NuGet package. Then, add this using statement on your global.asax.cs file, using ImranB.ModelBindingFix;                     Then, just add this line in Application_Start method,   Fixer.FixModelBindingIssue(); // For fixing only in MVC call this //Fixer.FixMvcModelBindingIssue(); // For fixing only in Web API call this //Fixer.FixWebApiModelBindingIssue(); .                     This line will fix the model binding issue. If you are using Html.Action or Html.RenderAction then you should use Html.FixedAction or Html.FixedRenderAction instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebMvc namespace). If you are using FormDataCollection.ReadAs extension method then you should use FormDataCollection.FixedReadAs instead to avoid this bug(make sure to reference ImranB.ModelBindingFix.SystemWebHttp namespace). The source code of this package is available at github.          Summary:                     There is a small but important issue/bug in ASP.NET MVC 4. In this article, I showed you how to fix this issue/bug by using a package. Hopefully you will enjoy this article too.

    Read the article

  • Camera for 2.5D Game

    - by me--
    I'm hoping someone can explain this to me like I'm 5, because I've been struggling with this for hours and simply cannot understand what I'm doing wrong. I've written a Camera class for my 2.5D game. The intention is to support world and screen spaces like this: The camera is the black thing on the right. The +Z axis is upwards in that image, with -Z heading downwards. As you can see, both world space and screen space have (0, 0) at their top-left. I started writing some unit tests to prove that my camera was working as expected, and that's where things started getting...strange. My tests plot coordinates in world, view, and screen spaces. Eventually I will use image comparison to assert that they are correct, but for now my test just displays the result. The render logic uses Camera.ViewMatrix to transform world space to view space, and Camera.WorldPointToScreen to transform world space to screen space. Here is an example test: [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render(camera, out worldRender, out viewRender, out screenRender, new Vector3(30, 0, 0), new Vector3(30, 40, 0)); this.ShowRenders(camera, worldRender, viewRender, screenRender); } And here's what pops up when I run this test: World space looks OK, although I suspect the z axis is going into the screen instead of towards the viewer. View space has me completely baffled. I was expecting the camera to be sitting above (0, 0) and looking towards the center of the scene. Instead, the z axis seems to be the wrong way around, and the camera is positioned in the opposite corner to what I expect! I suspect screen space will be another thing altogether, but can anyone explain what I'm doing wrong in my Camera class? UPDATE I made some progress in terms of getting things to look visually as I expect, but only through intuition: not an actual understanding of what I'm doing. Any enlightenment would be greatly appreciated. I realized that my view space was flipped both vertically and horizontally compared to what I expected, so I changed my view matrix to scale accordingly: this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom, this.zoom, 1) * Matrix.CreateScale(-1, -1, 1); I could combine the two CreateScale calls, but have left them separate for clarity. Again, I have no idea why this is necessary, but it fixed my view space: But now my screen space needs to be flipped vertically, so I modified my projection matrix accordingly: this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); And this results in what I was expecting from my first attempt: I have also just tried using Camera to render sprites via a SpriteBatch to make sure everything works there too, and it does. But the question remains: why do I need to do all this flipping of axes to get the space coordinates the way I expect? UPDATE 2 I've since improved my rendering logic in my test suite so that it supports geometries and so that lines get lighter the further away they are from the camera. I wanted to do this to avoid optical illusions and to further prove to myself that I'm looking at what I think I am. Here is an example: In this case, I have 3 geometries: a cube, a sphere, and a polyline on the top face of the cube. Notice how the darkening and lightening of the lines correctly identifies those portions of the geometries closer to the camera. If I remove the negative scaling I had to put in, I see: So you can see I'm still in the same boat - I still need those vertical and horizontal flips in my matrices to get things to appear correctly. In the interests of giving people a repro to play with, here is the complete code needed to generate the above. If you want to run via the test harness, just install the xunit package: Camera.cs: using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using System.Diagnostics; public sealed class Camera { private readonly Viewport viewport; private readonly Matrix projectionMatrix; private Matrix? viewMatrix; private Vector3 location; private Vector3 target; private Vector3 up; private float zoom; public Camera(Viewport viewport) { this.viewport = viewport; // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.projectionMatrix = Matrix.CreatePerspectiveFieldOfView(0.7853982f, viewport.AspectRatio, 1, 2) * Matrix.CreateScale(1, -1, 1); // defaults this.location = new Vector3(this.viewport.Width / 2, this.viewport.Height, 100); this.target = new Vector3(this.viewport.Width / 2, this.viewport.Height / 2, 0); this.up = new Vector3(0, 0, 1); this.zoom = 1; } public Viewport Viewport { get { return this.viewport; } } public Vector3 Location { get { return this.location; } set { this.location = value; this.viewMatrix = null; } } public Vector3 Target { get { return this.target; } set { this.target = value; this.viewMatrix = null; } } public Vector3 Up { get { return this.up; } set { this.up = value; this.viewMatrix = null; } } public float Zoom { get { return this.zoom; } set { this.zoom = value; this.viewMatrix = null; } } public Matrix ProjectionMatrix { get { return this.projectionMatrix; } } public Matrix ViewMatrix { get { if (this.viewMatrix == null) { // for an explanation of the negative scaling, see: http://gamedev.stackexchange.com/questions/63409/ this.viewMatrix = Matrix.CreateLookAt(this.location, this.target, this.up) * Matrix.CreateScale(this.zoom) * Matrix.CreateScale(-1, -1, 1); } return this.viewMatrix.Value; } } public Vector2 WorldPointToScreen(Vector3 point) { var result = viewport.Project(point, this.ProjectionMatrix, this.ViewMatrix, Matrix.Identity); return new Vector2(result.X, result.Y); } public void WorldPointsToScreen(Vector3[] points, Vector2[] destination) { Debug.Assert(points != null); Debug.Assert(destination != null); Debug.Assert(points.Length == destination.Length); for (var i = 0; i < points.Length; ++i) { destination[i] = this.WorldPointToScreen(points[i]); } } } CameraFixture.cs: using Microsoft.Xna.Framework.Graphics; using System; using System.Collections.Generic; using System.Linq; using System.Windows; using System.Windows.Controls; using System.Windows.Media; using Xunit; using XNA = Microsoft.Xna.Framework; public sealed class CameraFixture { [Fact] public void foo() { var camera = new Camera(new Viewport(0, 0, 250, 100)); DrawingVisual worldRender; DrawingVisual viewRender; DrawingVisual screenRender; this.Render( camera, out worldRender, out viewRender, out screenRender, new Sphere(30, 15) { WorldMatrix = XNA.Matrix.CreateTranslation(155, 50, 0) }, new Cube(30) { WorldMatrix = XNA.Matrix.CreateTranslation(75, 60, 15) }, new PolyLine(new XNA.Vector3(0, 0, 0), new XNA.Vector3(10, 10, 0), new XNA.Vector3(20, 0, 0), new XNA.Vector3(0, 0, 0)) { WorldMatrix = XNA.Matrix.CreateTranslation(65, 55, 30) }); this.ShowRenders(worldRender, viewRender, screenRender); } #region Supporting Fields private static readonly Pen xAxisPen = new Pen(Brushes.Red, 2); private static readonly Pen yAxisPen = new Pen(Brushes.Green, 2); private static readonly Pen zAxisPen = new Pen(Brushes.Blue, 2); private static readonly Pen viewportPen = new Pen(Brushes.Gray, 1); private static readonly Pen nonScreenSpacePen = new Pen(Brushes.Black, 0.5); private static readonly Color geometryBaseColor = Colors.Black; #endregion #region Supporting Methods private void Render(Camera camera, out DrawingVisual worldRender, out DrawingVisual viewRender, out DrawingVisual screenRender, params Geometry[] geometries) { var worldDrawingVisual = new DrawingVisual(); var viewDrawingVisual = new DrawingVisual(); var screenDrawingVisual = new DrawingVisual(); const int axisLength = 15; using (var worldDrawingContext = worldDrawingVisual.RenderOpen()) using (var viewDrawingContext = viewDrawingVisual.RenderOpen()) using (var screenDrawingContext = screenDrawingVisual.RenderOpen()) { // draw lines around the camera's viewport var viewportBounds = camera.Viewport.Bounds; var viewportLines = new Tuple<int, int, int, int>[] { Tuple.Create(viewportBounds.Left, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Top), Tuple.Create(viewportBounds.Left, viewportBounds.Top, viewportBounds.Right, viewportBounds.Top), Tuple.Create(viewportBounds.Right, viewportBounds.Top, viewportBounds.Right, viewportBounds.Bottom), Tuple.Create(viewportBounds.Right, viewportBounds.Bottom, viewportBounds.Left, viewportBounds.Bottom) }; foreach (var viewportLine in viewportLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item1, viewportLine.Item2, 0)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(viewportLine.Item3, viewportLine.Item4, 0)); worldDrawingContext.DrawLine(viewportPen, new Point(viewportLine.Item1, viewportLine.Item2), new Point(viewportLine.Item3, viewportLine.Item4)); viewDrawingContext.DrawLine(viewportPen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(viewportPen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // draw axes var axisLines = new Tuple<int, int, int, int, int, int, Pen>[] { Tuple.Create(0, 0, 0, axisLength, 0, 0, xAxisPen), Tuple.Create(0, 0, 0, 0, axisLength, 0, yAxisPen), Tuple.Create(0, 0, 0, 0, 0, axisLength, zAxisPen) }; foreach (var axisLine in axisLines) { var viewStart = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3), camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6), camera.ViewMatrix); var screenStart = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item1, axisLine.Item2, axisLine.Item3)); var screenEnd = camera.WorldPointToScreen(new XNA.Vector3(axisLine.Item4, axisLine.Item5, axisLine.Item6)); worldDrawingContext.DrawLine(axisLine.Item7, new Point(axisLine.Item1, axisLine.Item2), new Point(axisLine.Item4, axisLine.Item5)); viewDrawingContext.DrawLine(axisLine.Item7, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); screenDrawingContext.DrawLine(axisLine.Item7, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } // for all points in all geometries to be rendered, find the closest and furthest away from the camera so we can lighten lines that are further away var distancesToAllGeometrySections = from geometry in geometries let geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix from section in geometry.Sections from point in new XNA.Vector3[] { section.Item1, section.Item2 } let viewPoint = XNA.Vector3.Transform(point, geometryViewMatrix) select viewPoint.Length(); var furthestDistance = distancesToAllGeometrySections.Max(); var closestDistance = distancesToAllGeometrySections.Min(); var deltaDistance = Math.Max(0.000001f, furthestDistance - closestDistance); // draw each geometry for (var i = 0; i < geometries.Length; ++i) { var geometry = geometries[i]; // there's probably a more correct name for this, but basically this gets the geometry relative to the camera so we can check how far away each point is from the camera var geometryViewMatrix = geometry.WorldMatrix * camera.ViewMatrix; // we order roughly by those sections furthest from the camera to those closest, so that the closer ones "overwrite" the ones further away var orderedSections = from section in geometry.Sections let startPointRelativeToCamera = XNA.Vector3.Transform(section.Item1, geometryViewMatrix) let endPointRelativeToCamera = XNA.Vector3.Transform(section.Item2, geometryViewMatrix) let startPointDistance = startPointRelativeToCamera.Length() let endPointDistance = endPointRelativeToCamera.Length() orderby (startPointDistance + endPointDistance) descending select new { Section = section, DistanceToStart = startPointDistance, DistanceToEnd = endPointDistance }; foreach (var orderedSection in orderedSections) { var start = XNA.Vector3.Transform(orderedSection.Section.Item1, geometry.WorldMatrix); var end = XNA.Vector3.Transform(orderedSection.Section.Item2, geometry.WorldMatrix); var viewStart = XNA.Vector3.Transform(start, camera.ViewMatrix); var viewEnd = XNA.Vector3.Transform(end, camera.ViewMatrix); worldDrawingContext.DrawLine(nonScreenSpacePen, new Point(start.X, start.Y), new Point(end.X, end.Y)); viewDrawingContext.DrawLine(nonScreenSpacePen, new Point(viewStart.X, viewStart.Y), new Point(viewEnd.X, viewEnd.Y)); // screen rendering is more complicated purely because I wanted geometry to fade the further away it is from the camera // otherwise, it's very hard to tell whether the rendering is actually correct or not var startDistanceRatio = (orderedSection.DistanceToStart - closestDistance) / deltaDistance; var endDistanceRatio = (orderedSection.DistanceToEnd - closestDistance) / deltaDistance; // lerp towards white based on distance from camera, but only to a maximum of 90% var startColor = Lerp(geometryBaseColor, Colors.White, startDistanceRatio * 0.9f); var endColor = Lerp(geometryBaseColor, Colors.White, endDistanceRatio * 0.9f); var screenStart = camera.WorldPointToScreen(start); var screenEnd = camera.WorldPointToScreen(end); var brush = new LinearGradientBrush { StartPoint = new Point(screenStart.X, screenStart.Y), EndPoint = new Point(screenEnd.X, screenEnd.Y), MappingMode = BrushMappingMode.Absolute }; brush.GradientStops.Add(new GradientStop(startColor, 0)); brush.GradientStops.Add(new GradientStop(endColor, 1)); var pen = new Pen(brush, 1); brush.Freeze(); pen.Freeze(); screenDrawingContext.DrawLine(pen, new Point(screenStart.X, screenStart.Y), new Point(screenEnd.X, screenEnd.Y)); } } } worldRender = worldDrawingVisual; viewRender = viewDrawingVisual; screenRender = screenDrawingVisual; } private static float Lerp(float start, float end, float amount) { var difference = end - start; var adjusted = difference * amount; return start + adjusted; } private static Color Lerp(Color color, Color to, float amount) { var sr = color.R; var sg = color.G; var sb = color.B; var er = to.R; var eg = to.G; var eb = to.B; var r = (byte)Lerp(sr, er, amount); var g = (byte)Lerp(sg, eg, amount); var b = (byte)Lerp(sb, eb, amount); return Color.FromArgb(255, r, g, b); } private void ShowRenders(DrawingVisual worldRender, DrawingVisual viewRender, DrawingVisual screenRender) { var itemsControl = new ItemsControl(); itemsControl.Items.Add(new HeaderedContentControl { Header = "World", Content = new DrawingVisualHost(worldRender)}); itemsControl.Items.Add(new HeaderedContentControl { Header = "View", Content = new DrawingVisualHost(viewRender) }); itemsControl.Items.Add(new HeaderedContentControl { Header = "Screen", Content = new DrawingVisualHost(screenRender) }); var window = new Window { Title = "Renders", Content = itemsControl, ShowInTaskbar = true, SizeToContent = SizeToContent.WidthAndHeight }; window.ShowDialog(); } #endregion #region Supporting Types // stupidly simple 3D geometry class, consisting of a series of sections that will be connected by lines private abstract class Geometry { public abstract IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get; } public XNA.Matrix WorldMatrix { get; set; } } private sealed class Line : Geometry { private readonly XNA.Vector3 magnitude; public Line(XNA.Vector3 magnitude) { this.magnitude = magnitude; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { yield return Tuple.Create(XNA.Vector3.Zero, this.magnitude); } } } private sealed class PolyLine : Geometry { private readonly XNA.Vector3[] points; public PolyLine(params XNA.Vector3[] points) { this.points = points; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { if (this.points.Length < 2) { yield break; } var end = this.points[0]; for (var i = 1; i < this.points.Length; ++i) { var start = end; end = this.points[i]; yield return Tuple.Create(start, end); } } } } private sealed class Cube : Geometry { private readonly float size; public Cube(float size) { this.size = size; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var halfSize = this.size / 2; var frontBottomLeft = new XNA.Vector3(-halfSize, halfSize, -halfSize); var frontBottomRight = new XNA.Vector3(halfSize, halfSize, -halfSize); var frontTopLeft = new XNA.Vector3(-halfSize, halfSize, halfSize); var frontTopRight = new XNA.Vector3(halfSize, halfSize, halfSize); var backBottomLeft = new XNA.Vector3(-halfSize, -halfSize, -halfSize); var backBottomRight = new XNA.Vector3(halfSize, -halfSize, -halfSize); var backTopLeft = new XNA.Vector3(-halfSize, -halfSize, halfSize); var backTopRight = new XNA.Vector3(halfSize, -halfSize, halfSize); // front face yield return Tuple.Create(frontBottomLeft, frontBottomRight); yield return Tuple.Create(frontBottomLeft, frontTopLeft); yield return Tuple.Create(frontTopLeft, frontTopRight); yield return Tuple.Create(frontTopRight, frontBottomRight); // left face yield return Tuple.Create(frontTopLeft, backTopLeft); yield return Tuple.Create(backTopLeft, backBottomLeft); yield return Tuple.Create(backBottomLeft, frontBottomLeft); // right face yield return Tuple.Create(frontTopRight, backTopRight); yield return Tuple.Create(backTopRight, backBottomRight); yield return Tuple.Create(backBottomRight, frontBottomRight); // back face yield return Tuple.Create(backBottomLeft, backBottomRight); yield return Tuple.Create(backTopLeft, backTopRight); } } } private sealed class Sphere : Geometry { private readonly float radius; private readonly int subsections; public Sphere(float radius, int subsections) { this.radius = radius; this.subsections = subsections; } public override IEnumerable<Tuple<XNA.Vector3, XNA.Vector3>> Sections { get { var latitudeLines = this.subsections; var longitudeLines = this.subsections; // see http://stackoverflow.com/a/4082020/5380 var results = from latitudeLine in Enumerable.Range(0, latitudeLines) from longitudeLine in Enumerable.Range(0, longitudeLines) let latitudeRatio = latitudeLine / (float)latitudeLines let longitudeRatio = longitudeLine / (float)longitudeLines let nextLatitudeRatio = (latitudeLine + 1) / (float)latitudeLines let nextLongitudeRatio = (longitudeLine + 1) / (float)longitudeLines let z1 = Math.Cos(Math.PI * latitudeRatio) let z2 = Math.Cos(Math.PI * nextLatitudeRatio) let x1 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y1 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Cos(Math.PI * 2 * longitudeRatio) let y2 = Math.Sin(Math.PI * nextLatitudeRatio) * Math.Sin(Math.PI * 2 * longitudeRatio) let x3 = Math.Sin(Math.PI * latitudeRatio) * Math.Cos(Math.PI * 2 * nextLongitudeRatio) let y3 = Math.Sin(Math.PI * latitudeRatio) * Math.Sin(Math.PI * 2 * nextLongitudeRatio) let start = new XNA.Vector3((float)x1 * radius, (float)y1 * radius, (float)z1 * radius) let firstEnd = new XNA.Vector3((float)x2 * radius, (float)y2 * radius, (float)z2 * radius) let secondEnd = new XNA.Vector3((float)x3 * radius, (float)y3 * radius, (float)z1 * radius) select new { First = Tuple.Create(start, firstEnd), Second = Tuple.Create(start, secondEnd) }; foreach (var result in results) { yield return result.First; yield return result.Second; } } } } #endregion }

    Read the article

  • Creating Custom Ajax Control Toolkit Controls

    - by Stephen Walther
    The goal of this blog entry is to explain how you can extend the Ajax Control Toolkit with custom Ajax Control Toolkit controls. I describe how you can create the two halves of an Ajax Control Toolkit control: the server-side control extender and the client-side control behavior. Finally, I explain how you can use the new Ajax Control Toolkit control in a Web Forms page. At the end of this blog entry, there is a link to download a Visual Studio 2010 solution which contains the code for two Ajax Control Toolkit controls: SampleExtender and PopupHelpExtender. The SampleExtender contains the minimum skeleton for creating a new Ajax Control Toolkit control. You can use the SampleExtender as a starting point for your custom Ajax Control Toolkit controls. The PopupHelpExtender control is a super simple custom Ajax Control Toolkit control. This control extender displays a help message when you start typing into a TextBox control. The animated GIF below demonstrates what happens when you click into a TextBox which has been extended with the PopupHelp extender. Here’s a sample of a Web Forms page which uses the control: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="ShowPopupHelp.aspx.cs" Inherits="MyACTControls.Web.Default" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html > <head runat="server"> <title>Show Popup Help</title> </head> <body> <form id="form1" runat="server"> <div> <act:ToolkitScriptManager ID="tsm" runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblSSN" Text="SSN:" AssociatedControlID="txtSSN" runat="server" /> <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" /> <%-- Social Security Number --%> <asp:Label ID="lblPhone" Text="Phone Number:" AssociatedControlID="txtPhone" runat="server" /> <asp:TextBox ID="txtPhone" runat="server" /> <act:PopupHelpExtender id="ph2" TargetControlID="txtPhone" HelpText="Please enter your phone number." runat="server" /> </div> </form> </body> </html> In the page above, the PopupHelp extender is used to extend the functionality of the two TextBox controls. When focus is given to a TextBox control, the popup help message is displayed. An Ajax Control Toolkit control extender consists of two parts: a server-side control extender and a client-side behavior. For example, the PopupHelp extender consists of a server-side PopupHelpExtender control (PopupHelpExtender.cs) and a client-side PopupHelp behavior JavaScript script (PopupHelpBehavior.js). Over the course of this blog entry, I describe how you can create both the server-side extender and the client-side behavior. Writing the Server-Side Code Creating a Control Extender You create a control extender by creating a class that inherits from the abstract ExtenderControlBase class. For example, the PopupHelpExtender control is declared like this: public class PopupHelpExtender: ExtenderControlBase { } The ExtenderControlBase class is part of the Ajax Control Toolkit. This base class contains all of the common server properties and methods of every Ajax Control Toolkit extender control. The ExtenderControlBase class inherits from the ExtenderControl class. The ExtenderControl class is a standard class in the ASP.NET framework located in the System.Web.UI namespace. This class is responsible for generating a client-side behavior. The class generates a call to the Microsoft Ajax Library $create() method which looks like this: <script type="text/javascript"> $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); }); </script> The JavaScript $create() method is part of the Microsoft Ajax Library. The reference for this method can be found here: http://msdn.microsoft.com/en-us/library/bb397487.aspx This method accepts the following parameters: type – The type of client behavior to create. The $create() method above creates a client PopupHelpBehavior. Properties – Enables you to pass initial values for the properties of the client behavior. For example, the initial value of the HelpText property. This is how server property values are passed to the client. Events – Enables you to pass client-side event handlers to the client behavior. References – Enables you to pass references to other client components. Element – The DOM element associated with the client behavior. This will be the DOM element associated with the control being extended such as the txtSSN TextBox. The $create() method is generated for you automatically. You just need to focus on writing the server-side control extender class. Specifying the Target Control All Ajax Control Toolkit extenders inherit a TargetControlID property from the ExtenderControlBase class. This property, the TargetControlID property, points at the control that the extender control extends. For example, the Ajax Control Toolkit TextBoxWatermark control extends a TextBox, the ConfirmButton control extends a Button, and the Calendar control extends a TextBox. You must indicate the type of control which your extender is extending. You indicate the type of control by adding a [TargetControlType] attribute to your control. For example, the PopupHelp extender is declared like this: [TargetControlType(typeof(TextBox))] public class PopupHelpExtender: ExtenderControlBase { } The PopupHelp extender can be used to extend a TextBox control. If you try to use the PopupHelp extender with another type of control then an exception is thrown. If you want to create an extender control which can be used with any type of ASP.NET control (Button, DataView, TextBox or whatever) then use the following attribute: [TargetControlType(typeof(Control))] Decorating Properties with Attributes If you decorate a server-side property with the [ExtenderControlProperty] attribute then the value of the property gets passed to the control’s client-side behavior. The value of the property gets passed to the client through the $create() method discussed above. The PopupHelp control contains the following HelpText property: [ExtenderControlProperty] [RequiredProperty] public string HelpText { get { return GetPropertyValue("HelpText", "Help Text"); } set { SetPropertyValue("HelpText", value); } } The HelpText property determines the help text which pops up when you start typing into a TextBox control. Because the HelpText property is decorated with the [ExtenderControlProperty] attribute, any value assigned to this property on the server is passed to the client automatically. For example, if you declare the PopupHelp extender in a Web Form page like this: <asp:TextBox ID="txtSSN" runat="server" /> <act:PopupHelpExtender id="ph1" TargetControlID="txtSSN" HelpText="Please enter your social security number." runat="server" />   Then the PopupHelpExtender renders the call to the the following Microsoft Ajax Library $create() method: $create(MyACTControls.PopupHelpBehavior, {"HelpText":"Please enter your social security number.","id":"ph1"}, null, null, $get("txtSSN")); You can see this call to the JavaScript $create() method by selecting View Source in your browser. This call to the $create() method calls a method named set_HelpText() automatically and passes the value “Please enter your social security number”. There are several attributes which you can use to decorate server-side properties including: ExtenderControlProperty – When a property is marked with this attribute, the value of the property is passed to the client automatically. ExtenderControlEvent – When a property is marked with this attribute, the property represents a client event handler. Required – When a value is not assigned to this property on the server, an error is displayed. DefaultValue – The default value of the property passed to the client. ClientPropertyName – The name of the corresponding property in the JavaScript behavior. For example, the server-side property is named ID (uppercase) and the client-side property is named id (lower-case). IDReferenceProperty – Applied to properties which refer to the IDs of other controls. URLProperty – Calls ResolveClientURL() to convert from a server-side URL to a URL which can be used on the client. ElementReference – Returns a reference to a DOM element by performing a client $get(). The WebResource, ClientResource, and the RequiredScript Attributes The PopupHelp extender uses three embedded resources named PopupHelpBehavior.js, PopupHelpBehavior.debug.js, and PopupHelpBehavior.css. The first two files are JavaScript files and the final file is a Cascading Style sheet file. These files are compiled as embedded resources. You don’t need to mark them as embedded resources in your Visual Studio solution because they get added to the assembly when the assembly is compiled by a build task. You can see that these files get embedded into the MyACTControls assembly by using Red Gate’s .NET Reflector tool: In order to use these files with the PopupHelp extender, you need to work with both the WebResource and the ClientScriptResource attributes. The PopupHelp extender includes the following three WebResource attributes. [assembly: WebResource("PopupHelp.PopupHelpBehavior.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.debug.js", "text/javascript")] [assembly: WebResource("PopupHelp.PopupHelpBehavior.css", "text/css", PerformSubstitution = true)] These WebResource attributes expose the embedded resource from the assembly so that they can be accessed by using the ScriptResource.axd or WebResource.axd handlers. The first parameter passed to the WebResource attribute is the name of the embedded resource and the second parameter is the content type of the embedded resource. The PopupHelp extender also includes the following ClientScriptResource and ClientCssResource attributes: [ClientScriptResource("MyACTControls.PopupHelpBehavior", "PopupHelp.PopupHelpBehavior.js")] [ClientCssResource("PopupHelp.PopupHelpBehavior.css")] Including these attributes causes the PopupHelp extender to request these resources when you add the PopupHelp extender to a page. If you open View Source in a browser which uses the PopupHelp extender then you will see the following link for the Cascading Style Sheet file: <link href="/WebResource.axd?d=0uONMsWXUuEDG-pbJHAC1kuKiIMteQFkYLmZdkgv7X54TObqYoqVzU4mxvaa4zpn5H9ch0RDwRYKwtO8zM5mKgO6C4WbrbkWWidKR07LD1d4n4i_uNB1mHEvXdZu2Ae5mDdVNDV53znnBojzCzwvSw2&amp;t=634417392021676003" type="text/css" rel="stylesheet" /> You also will see the following script include for the JavaScript file: <script src="/ScriptResource.axd?d=pIS7xcGaqvNLFBvExMBQSp_0xR3mpDfS0QVmmyu1aqDUjF06TrW1jVDyXNDMtBHxpRggLYDvgFTWOsrszflZEDqAcQCg-hDXjun7ON0Ol7EXPQIdOe1GLMceIDv3OeX658-tTq2LGdwXhC1-dE7_6g2&amp;t=ffffffff88a33b59" type="text/javascript"></script> The JavaScrpt file returned by this request to ScriptResource.axd contains the combined scripts for any and all Ajax Control Toolkit controls in a page. By default, the Ajax Control Toolkit combines all of the JavaScript files required by a page into a single JavaScript file. Combining files in this way really speeds up how quickly all of the JavaScript files get delivered from the web server to the browser. So, by default, there will be only one ScriptResource.axd include for all of the JavaScript files required by a page. If you want to disable Script Combining, and create separate links, then disable Script Combining like this: <act:ToolkitScriptManager ID="tsm" runat="server" CombineScripts="false" /> There is one more important attribute used by Ajax Control Toolkit extenders. The PopupHelp behavior uses the following two RequirdScript attributes to load the JavaScript files which are required by the PopupHelp behavior: [RequiredScript(typeof(CommonToolkitScripts), 0)] [RequiredScript(typeof(PopupExtender), 1)] The first parameter of the RequiredScript attribute represents either the string name of a JavaScript file or the type of an Ajax Control Toolkit control. The second parameter represents the order in which the JavaScript files are loaded (This second parameter is needed because .NET attributes are intrinsically unordered). In this case, the RequiredScript attribute will load the JavaScript files associated with the CommonToolkitScripts type and the JavaScript files associated with the PopupExtender in that order. The PopupHelp behavior depends on these JavaScript files. Writing the Client-Side Code The PopupHelp extender uses a client-side behavior written with the Microsoft Ajax Library. Here is the complete code for the client-side behavior: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { Type.registerNamespace('MyACTControls'); MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); Sys.registerComponent(MyACTControls.PopupHelpBehavior, { name: "popupHelp" }); } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })();   In the following sections, we’ll discuss how this client-side behavior works. Wrapping the Behavior for the Script Loader The behavior is wrapped with the following script: (function () { // The unique name of the script registered with the // client script loader var scriptName = "PopupHelpBehavior"; function execute() { // Behavior Content } // execute if (window.Sys && Sys.loader) { Sys.loader.registerScript(scriptName, ["ExtendedBase", "ExtendedCommon"], execute); } else { execute(); } })(); This code is required by the Microsoft Ajax Library Script Loader. You need this code if you plan to use a behavior directly from client-side code and you want to use the Script Loader. If you plan to only use your code in the context of the Ajax Control Toolkit then you can leave out this code. Registering a JavaScript Namespace The PopupHelp behavior is declared within a namespace named MyACTControls. In the code above, this namespace is created with the following registerNamespace() method: Type.registerNamespace('MyACTControls'); JavaScript does not have any built-in way of creating namespaces to prevent naming conflicts. The Microsoft Ajax Library extends JavaScript with support for namespaces. You can learn more about the registerNamespace() method here: http://msdn.microsoft.com/en-us/library/bb397723.aspx Creating the Behavior The actual Popup behavior is created with the following code. MyACTControls.PopupHelpBehavior = function (element) { /// <summary> /// A behavior which displays popup help for a textbox /// </summmary> /// <param name="element" type="Sys.UI.DomElement">The element to attach to</param> MyACTControls.PopupHelpBehavior.initializeBase(this, [element]); this._textbox = Sys.Extended.UI.TextBoxWrapper.get_Wrapper(element); this._cssClass = "ajax__popupHelp"; this._popupBehavior = null; this._popupPosition = Sys.Extended.UI.PositioningMode.BottomLeft; this._popupDiv = null; this._helpText = "Help Text"; this._element$delegates = { focus: Function.createDelegate(this, this._element_onfocus), blur: Function.createDelegate(this, this._element_onblur) }; } MyACTControls.PopupHelpBehavior.prototype = { initialize: function () { MyACTControls.PopupHelpBehavior.callBaseMethod(this, 'initialize'); // Add event handlers for focus and blur var element = this.get_element(); $addHandlers(element, this._element$delegates); }, _ensurePopup: function () { if (!this._popupDiv) { var element = this.get_element(); var id = this.get_id(); this._popupDiv = $common.createElementFromTemplate({ nodeName: "div", properties: { id: id + "_popupDiv" }, cssClasses: ["ajax__popupHelp"] }, element.parentNode); this._popupBehavior = new $create(Sys.Extended.UI.PopupBehavior, { parentElement: element }, {}, {}, this._popupDiv); this._popupBehavior.set_positioningMode(this._popupPosition); } }, get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, _element_onfocus: function (e) { this.show(); }, _element_onblur: function (e) { this.hide(); }, show: function () { this._popupBehavior.show(); }, hide: function () { if (this._popupBehavior) { this._popupBehavior.hide(); } }, dispose: function() { var element = this.get_element(); $clearHandlers(element); if (this._popupBehavior) { this._popupBehavior.dispose(); this._popupBehavior = null; } } }; The code above has two parts. The first part of the code is used to define the constructor function for the PopupHelp behavior. This is a factory method which returns an instance of a PopupHelp behavior: MyACTControls.PopupHelpBehavior = function (element) { } The second part of the code modified the prototype for the PopupHelp behavior: MyACTControls.PopupHelpBehavior.prototype = { } Any code which is particular to a single instance of the PopupHelp behavior should be placed in the constructor function. For example, the default value of the _helpText field is assigned in the constructor function: this._helpText = "Help Text"; Any code which is shared among all instances of the PopupHelp behavior should be added to the PopupHelp behavior’s prototype. For example, the public HelpText property is added to the prototype: get_HelpText: function () { return this._helpText; }, set_HelpText: function (value) { if (this._HelpText != value) { this._helpText = value; this._ensurePopup(); this._popupDiv.innerHTML = value; this.raisePropertyChanged("Text") } }, Registering a JavaScript Class After you create the PopupHelp behavior, you must register the behavior as a class by using the Microsoft Ajax registerClass() method like this: MyACTControls.PopupHelpBehavior.registerClass('MyACTControls.PopupHelpBehavior', Sys.Extended.UI.BehaviorBase); This call to registerClass() registers PopupHelp behavior as a class which derives from the base Sys.Extended.UI.BehaviorBase class. Like the ExtenderControlBase class on the server side, the BehaviorBase class on the client side contains method used by every behavior. The documentation for the BehaviorBase class can be found here: http://msdn.microsoft.com/en-us/library/bb311020.aspx The most important methods and properties of the BehaviorBase class are the following: dispose() – Use this method to clean up all resources used by your behavior. In the case of the PopupHelp behavior, the dispose() method is used to remote the event handlers created by the behavior and disposed the Popup behavior. get_element() -- Use this property to get the DOM element associated with the behavior. In other words, the DOM element which the behavior extends. get_id() – Use this property to the ID of the current behavior. initialize() – Use this method to initialize the behavior. This method is called after all of the properties are set by the $create() method. Creating Debug and Release Scripts You might have noticed that the PopupHelp behavior uses two scripts named PopupHelpBehavior.js and PopupHelpBehavior.debug.js. However, you never create these two scripts. Instead, you only create a single script named PopupHelpBehavior.pre.js. The pre in PopupHelpBehavior.pre.js stands for preprocessor. When you build the Ajax Control Toolkit (or the sample Visual Studio Solution at the end of this blog entry), a build task named JSBuild generates the PopupHelpBehavior.js release script and PopupHelpBehavior.debug.js debug script automatically. The JSBuild preprocessor supports the following directives: #IF #ELSE #ENDIF #INCLUDE #LOCALIZE #DEFINE #UNDEFINE The preprocessor directives are used to mark code which should only appear in the debug version of the script. The directives are used extensively in the Microsoft Ajax Library. For example, the Microsoft Ajax Library Array.contains() method is created like this: $type.contains = function Array$contains(array, item) { //#if DEBUG var e = Function._validateParams(arguments, [ {name: "array", type: Array, elementMayBeNull: true}, {name: "item", mayBeNull: true} ]); if (e) throw e; //#endif return (indexOf(array, item) >= 0); } Notice that you add each of the preprocessor directives inside a JavaScript comment. The comment prevents Visual Studio from getting confused with its Intellisense. The release version, but not the debug version, of the PopupHelpBehavior script is also minified automatically by the Microsoft Ajax Minifier. The minifier is invoked by a build step in the project file. Conclusion The goal of this blog entry was to explain how you can create custom AJAX Control Toolkit controls. In the first part of this blog entry, you learned how to create the server-side portion of an Ajax Control Toolkit control. You learned how to derive a new control from the ExtenderControlBase class and decorate its properties with the necessary attributes. Next, in the second part of this blog entry, you learned how to create the client-side portion of an Ajax Control Toolkit control by creating a client-side behavior with JavaScript. You learned how to use the methods of the Microsoft Ajax Library to extend your client behavior from the BehaviorBase class. Download the Custom ACT Starter Solution

    Read the article

  • Using Durandal to Create Single Page Apps

    - by Stephen.Walther
    A few days ago, I gave a talk on building Single Page Apps on the Microsoft Stack. In that talk, I recommended that people use Knockout, Sammy, and RequireJS to build their presentation layer and use the ASP.NET Web API to expose data from their server. After I gave the talk, several people contacted me and suggested that I investigate a new open-source JavaScript library named Durandal. Durandal stitches together Knockout, Sammy, and RequireJS to make it easier to use these technologies together. In this blog entry, I want to provide a brief walkthrough of using Durandal to create a simple Single Page App. I am going to demonstrate how you can create a simple Movies App which contains (virtual) pages for viewing a list of movies, adding new movies, and viewing movie details. The goal of this blog entry is to give you a sense of what it is like to build apps with Durandal. Installing Durandal First things first. How do you get Durandal? The GitHub project for Durandal is located here: https://github.com/BlueSpire/Durandal The Wiki — located at the GitHub project — contains all of the current documentation for Durandal. Currently, the documentation is a little sparse, but it is enough to get you started. Instead of downloading the Durandal source from GitHub, a better option for getting started with Durandal is to install one of the Durandal NuGet packages. I built the Movies App described in this blog entry by first creating a new ASP.NET MVC 4 Web Application with the Basic Template. Next, I executed the following command from the Package Manager Console: Install-Package Durandal.StarterKit As you can see from the screenshot of the Package Manager Console above, the Durandal Starter Kit package has several dependencies including: · jQuery · Knockout · Sammy · Twitter Bootstrap The Durandal Starter Kit package includes a sample Durandal application. You can get to the Starter Kit app by navigating to the Durandal controller. Unfortunately, when I first tried to run the Starter Kit app, I got an error because the Starter Kit is hard-coded to use a particular version of jQuery which is already out of date. You can fix this issue by modifying the App_Start\DurandalBundleConfig.cs file so it is jQuery version agnostic like this: bundles.Add( new ScriptBundle("~/scripts/vendor") .Include("~/Scripts/jquery-{version}.js") .Include("~/Scripts/knockout-{version}.js") .Include("~/Scripts/sammy-{version}.js") // .Include("~/Scripts/jquery-1.9.0.min.js") // .Include("~/Scripts/knockout-2.2.1.js") // .Include("~/Scripts/sammy-0.7.4.min.js") .Include("~/Scripts/bootstrap.min.js") ); The recommendation is that you create a Durandal app in a folder off your project root named App. The App folder in the Starter Kit contains the following subfolders and files: · durandal – This folder contains the actual durandal JavaScript library. · viewmodels – This folder contains all of your application’s view models. · views – This folder contains all of your application’s views. · main.js — This file contains all of the JavaScript startup code for your app including the client-side routing configuration. · main-built.js – This file contains an optimized version of your application. You need to build this file by using the RequireJS optimizer (unfortunately, before you can run the optimizer, you must first install NodeJS). For the purpose of this blog entry, I wanted to start from scratch when building the Movies app, so I deleted all of these files and folders except for the durandal folder which contains the durandal library. Creating the ASP.NET MVC Controller and View A Durandal app is built using a single server-side ASP.NET MVC controller and ASP.NET MVC view. A Durandal app is a Single Page App. When you navigate between pages, you are not navigating to new pages on the server. Instead, you are loading new virtual pages into the one-and-only-one server-side view. For the Movies app, I created the following ASP.NET MVC Home controller: public class HomeController : Controller { public ActionResult Index() { return View(); } } There is nothing special about the Home controller – it is as basic as it gets. Next, I created the following server-side ASP.NET view. This is the one-and-only server-side view used by the Movies app: @{ Layout = null; } <!DOCTYPE html> <html> <head> <title>Index</title> </head> <body> <div id="applicationHost"> Loading app.... </div> @Scripts.Render("~/scripts/vendor") <script type="text/javascript" src="~/App/durandal/amd/require.js" data-main="/App/main"></script> </body> </html> Notice that I set the Layout property for the view to the value null. If you neglect to do this, then the default ASP.NET MVC layout will be applied to the view and you will get the <!DOCTYPE> and opening and closing <html> tags twice. Next, notice that the view contains a DIV element with the Id applicationHost. This marks the area where virtual pages are loaded. When you navigate from page to page in a Durandal app, HTML page fragments are retrieved from the server and stuck in the applicationHost DIV element. Inside the applicationHost element, you can place any content which you want to display when a Durandal app is starting up. For example, you can create a fancy splash screen. I opted for simply displaying the text “Loading app…”: Next, notice the view above includes a call to the Scripts.Render() helper. This helper renders out all of the JavaScript files required by the Durandal library such as jQuery and Knockout. Remember to fix the App_Start\DurandalBundleConfig.cs as described above or Durandal will attempt to load an old version of jQuery and throw a JavaScript exception and stop working. Your application JavaScript code is not included in the scripts rendered by the Scripts.Render helper. Your application code is loaded dynamically by RequireJS with the help of the following SCRIPT element located at the bottom of the view: <script type="text/javascript" src="~/App/durandal/amd/require.js" data-main="/App/main"></script> The data-main attribute on the SCRIPT element causes RequireJS to load your /app/main.js JavaScript file to kick-off your Durandal app. Creating the Durandal Main.js File The Durandal Main.js JavaScript file, located in your App folder, contains all of the code required to configure the behavior of Durandal. Here’s what the Main.js file looks like in the case of the Movies app: require.config({ paths: { 'text': 'durandal/amd/text' } }); define(function (require) { var app = require('durandal/app'), viewLocator = require('durandal/viewLocator'), system = require('durandal/system'), router = require('durandal/plugins/router'); //>>excludeStart("build", true); system.debug(true); //>>excludeEnd("build"); app.start().then(function () { //Replace 'viewmodels' in the moduleId with 'views' to locate the view. //Look for partial views in a 'views' folder in the root. viewLocator.useConvention(); //configure routing router.useConvention(); router.mapNav("movies/show"); router.mapNav("movies/add"); router.mapNav("movies/details/:id"); app.adaptToDevice(); //Show the app by setting the root view model for our application with a transition. app.setRoot('viewmodels/shell', 'entrance'); }); }); There are three important things to notice about the main.js file above. First, notice that it contains a section which enables debugging which looks like this: //>>excludeStart(“build”, true); system.debug(true); //>>excludeEnd(“build”); This code enables debugging for your Durandal app which is very useful when things go wrong. When you call system.debug(true), Durandal writes out debugging information to your browser JavaScript console. For example, you can use the debugging information to diagnose issues with your client-side routes: (The funny looking //> symbols around the system.debug() call are RequireJS optimizer pragmas). The main.js file is also the place where you configure your client-side routes. In the case of the Movies app, the main.js file is used to configure routes for three page: the movies show, add, and details pages. //configure routing router.useConvention(); router.mapNav("movies/show"); router.mapNav("movies/add"); router.mapNav("movies/details/:id");   The route for movie details includes a route parameter named id. Later, we will use the id parameter to lookup and display the details for the right movie. Finally, the main.js file above contains the following line of code: //Show the app by setting the root view model for our application with a transition. app.setRoot('viewmodels/shell', 'entrance'); This line of code causes Durandal to load up a JavaScript file named shell.js and an HTML fragment named shell.html. I’ll discuss the shell in the next section. Creating the Durandal Shell You can think of the Durandal shell as the layout or master page for a Durandal app. The shell is where you put all of the content which you want to remain constant as a user navigates from virtual page to virtual page. For example, the shell is a great place to put your website logo and navigation links. The Durandal shell is composed from two parts: a JavaScript file and an HTML file. Here’s what the HTML file looks like for the Movies app: <h1>Movies App</h1> <div class="container-fluid page-host"> <!--ko compose: { model: router.activeItem, //wiring the router afterCompose: router.afterCompose, //wiring the router transition:'entrance', //use the 'entrance' transition when switching views cacheViews:true //telling composition to keep views in the dom, and reuse them (only a good idea with singleton view models) }--><!--/ko--> </div> And here is what the JavaScript file looks like: define(function (require) { var router = require('durandal/plugins/router'); return { router: router, activate: function () { return router.activate('movies/show'); } }; }); The JavaScript file contains the view model for the shell. This view model returns the Durandal router so you can access the list of configured routes from your shell. Notice that the JavaScript file includes a function named activate(). This function loads the movies/show page as the first page in the Movies app. If you want to create a different default Durandal page, then pass the name of a different age to the router.activate() method. Creating the Movies Show Page Durandal pages are created out of a view model and a view. The view model contains all of the data and view logic required for the view. The view contains all of the HTML markup for rendering the view model. Let’s start with the movies show page. The movies show page displays a list of movies. The view model for the show page looks like this: define(function (require) { var moviesRepository = require("repositories/moviesRepository"); return { movies: ko.observable(), activate: function() { this.movies(moviesRepository.listMovies()); } }; }); You create a view model by defining a new RequireJS module (see http://requirejs.org). You create a RequireJS module by placing all of your JavaScript code into an anonymous function passed to the RequireJS define() method. A RequireJS module has two parts. You retrieve all of the modules which your module requires at the top of your module. The code above depends on another RequireJS module named repositories/moviesRepository. Next, you return the implementation of your module. The code above returns a JavaScript object which contains a property named movies and a method named activate. The activate() method is a magic method which Durandal calls whenever it activates your view model. Your view model is activated whenever you navigate to a page which uses it. In the code above, the activate() method is used to get the list of movies from the movies repository and assign the list to the view model movies property. The HTML for the movies show page looks like this: <table> <thead> <tr> <th>Title</th><th>Director</th> </tr> </thead> <tbody data-bind="foreach:movies"> <tr> <td data-bind="text:title"></td> <td data-bind="text:director"></td> <td><a data-bind="attr:{href:'#/movies/details/'+id}">Details</a></td> </tr> </tbody> </table> <a href="#/movies/add">Add Movie</a> Notice that this is an HTML fragment. This fragment will be stuffed into the page-host DIV element in the shell.html file which is stuffed, in turn, into the applicationHost DIV element in the server-side MVC view. The HTML markup above contains data-bind attributes used by Knockout to display the list of movies (To learn more about Knockout, visit http://knockoutjs.com). The list of movies from the view model is displayed in an HTML table. Notice that the page includes a link to a page for adding a new movie. The link uses the following URL which starts with a hash: #/movies/add. Because the link starts with a hash, clicking the link does not cause a request back to the server. Instead, you navigate to the movies/add page virtually. Creating the Movies Add Page The movies add page also consists of a view model and view. The add page enables you to add a new movie to the movie database. Here’s the view model for the add page: define(function (require) { var app = require('durandal/app'); var router = require('durandal/plugins/router'); var moviesRepository = require("repositories/moviesRepository"); return { movieToAdd: { title: ko.observable(), director: ko.observable() }, activate: function () { this.movieToAdd.title(""); this.movieToAdd.director(""); this._movieAdded = false; }, canDeactivate: function () { if (this._movieAdded == false) { return app.showMessage('Are you sure you want to leave this page?', 'Navigate', ['Yes', 'No']); } else { return true; } }, addMovie: function () { // Add movie to db moviesRepository.addMovie(ko.toJS(this.movieToAdd)); // flag new movie this._movieAdded = true; // return to list of movies router.navigateTo("#/movies/show"); } }; }); The view model contains one property named movieToAdd which is bound to the add movie form. The view model also has the following three methods: 1. activate() – This method is called by Durandal when you navigate to the add movie page. The activate() method resets the add movie form by clearing out the movie title and director properties. 2. canDeactivate() – This method is called by Durandal when you attempt to navigate away from the add movie page. If you return false then navigation is cancelled. 3. addMovie() – This method executes when the add movie form is submitted. This code adds the new movie to the movie repository. I really like the Durandal canDeactivate() method. In the code above, I use the canDeactivate() method to show a warning to a user if they navigate away from the add movie page – either by clicking the Cancel button or by hitting the browser back button – before submitting the add movie form: The view for the add movie page looks like this: <form data-bind="submit:addMovie"> <fieldset> <legend>Add Movie</legend> <div> <label> Title: <input data-bind="value:movieToAdd.title" required /> </label> </div> <div> <label> Director: <input data-bind="value:movieToAdd.director" required /> </label> </div> <div> <input type="submit" value="Add" /> <a href="#/movies/show">Cancel</a> </div> </fieldset> </form> I am using Knockout to bind the movieToAdd property from the view model to the INPUT elements of the HTML form. Notice that the FORM element includes a data-bind attribute which invokes the addMovie() method from the view model when the HTML form is submitted. Creating the Movies Details Page You navigate to the movies details Page by clicking the Details link which appears next to each movie in the movies show page: The Details links pass the movie ids to the details page: #/movies/details/0 #/movies/details/1 #/movies/details/2 Here’s what the view model for the movies details page looks like: define(function (require) { var router = require('durandal/plugins/router'); var moviesRepository = require("repositories/moviesRepository"); return { movieToShow: { title: ko.observable(), director: ko.observable() }, activate: function (context) { // Grab movie from repository var movie = moviesRepository.getMovie(context.id); // Add to view model this.movieToShow.title(movie.title); this.movieToShow.director(movie.director); } }; }); Notice that the view model activate() method accepts a parameter named context. You can take advantage of the context parameter to retrieve route parameters such as the movie Id. In the code above, the context.id property is used to retrieve the correct movie from the movie repository and the movie is assigned to a property named movieToShow exposed by the view model. The movie details view displays the movieToShow property by taking advantage of Knockout bindings: <div> <h2 data-bind="text:movieToShow.title"></h2> directed by <span data-bind="text:movieToShow.director"></span> </div> Summary The goal of this blog entry was to walkthrough building a simple Single Page App using Durandal and to get a feel for what it is like to use this library. I really like how Durandal stitches together Knockout, Sammy, and RequireJS and establishes patterns for using these libraries to build Single Page Apps. Having a standard pattern which developers on a team can use to build new pages is super valuable. Once you get the hang of it, using Durandal to create new virtual pages is dead simple. Just define a new route, view model, and view and you are done. I also appreciate the fact that Durandal did not attempt to re-invent the wheel and that Durandal leverages existing JavaScript libraries such as Knockout, RequireJS, and Sammy. These existing libraries are powerful libraries and I have already invested a considerable amount of time in learning how to use them. Durandal makes it easier to use these libraries together without losing any of their power. Durandal has some additional interesting features which I have not had a chance to play with yet. For example, you can use the RequireJS optimizer to combine and minify all of a Durandal app’s code. Also, Durandal supports a way to create custom widgets (client-side controls) by composing widgets from a controller and view. You can download the code for the Movies app by clicking the following link (this is a Visual Studio 2012 project): Durandal Movie App

    Read the article

  • Wine is no longer able to initialize OpenGL

    - by nebukadnezzar
    Since a while, wine is no longer able to initialize OpenGL on my 64bit Linux. This is by no means a unique problem to me- Lots of people with nvidia cards running 64bit linux seem to have this problem with wine on oneiric: http://forum.winehq.org/viewtopic.php?p=66856&sid=9d6e5ad628ee6fb6e5ef04577275daed http://forum.pinguyos.com/Thread-Wine-OpenGl-Problem https://bbs.archlinux.org/viewtopic.php?id=137696 And while some launchpad bug reports say one should use this workaround: LD_PRELOAD=/usr/lib32/nvidia-current/libGL.so.1 wine <app> It unfortunately does not solve the problem at all for me; That is, if i'd run CS:S, the game will run just fine for a while, but will abort after some time, including a range of GLSL-related errors. Here the startup errors from simply running steam: + wine steam.exe fixme:process:GetLogicalProcessorInformation ((nil),0x33e488): stub [.. snip ...] fixme:dwmapi:DwmSetWindowAttribute (0x1009a, 3, 0x33d384, 4) stub fixme:dwmapi:DwmSetWindowAttribute (0x1009a, 4, 0x33d374, 4) stub err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! [... this error is being reported a few dozen times, so snip again ...] err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! err:wgl:is_extension_supported No OpenGL extensions found, check if your OpenGL setup is correct! fixme:iphlpapi:NotifyAddrChange (Handle 0x47cdba8, overlapped 0x45dba80): stub fixme:winsock:WSALookupServiceBeginW (0x47cdbc8 0x00000ff0 0x47cdbc4) Stub! [... snip ...] Here are the errors reported while running, and after running (because the log is huge-ish, it's pasted elsewhere): http://paste.ubuntu.com/901925/ Now, 32bit OpenGL works just fine; The 32bit executables of Nexuiz, for example, work just fine. That being said, I'm suspecting that this is a problem of wine itself. I've already manually built the git version of wine, to no avail. So what's going on? Is something broken? How do I check (correctly) whether something is broken? How do I solve this?

    Read the article

  • Tips on Migrating from AquaLogic .NET Accelerator to WebCenter WSRP Producer for .NET

    - by user647124
    This year I embarked on a journey to migrate a group of ASP.NET web applications developed to integrate with WebLogic Portal 9.2 via the AquaLogic® Interaction .NET Application Accelerator 1.0 to instead use the Oracle WebCenter WSRP Producer for .NET and integrated with WebLogic Portal 10.3.4. It has been a very winding path and this blog entry is intended to share both the lessons learned and relevant approaches that led to those learnings. Like most journeys of discovery, it was not a direct path, and there are notes to let you know when it is practical to skip a section if you are in a hurry to get from here to there. For the Curious From the perspective of necessity, this section would be better at the end. If it were there, though, it would probably be read by far fewer people, including those that are actually interested in these types of sections. Those in a hurry may skip past and be none the worst for it in dealing with the hands-on bits of performing a migration from .NET Accelerator to WSRP Producer. For others who want to talk about why they did what they did after they did it, or just want to know for themselves, enjoy. A Brief (and edited) History of the WSRP for .NET Technologies (as Relevant to the this Post) Note: This section is for those who are curious about why the migration path is not as simple as many other Oracle technologies. You can skip this section in its entirety and still be just as competent in performing a migration as if you had read it. The currently deployed architecture that was to be migrated and upgraded achieved initial integration between .NET and J2EE over the WSRP protocol through the use of The AquaLogic Interaction .NET Application Accelerator. The .NET Accelerator allowed the applications that were written in ASP.NET and deployed on a Microsoft Internet Information Server (IIS) to interact with a WebLogic Portal application deployed on a WebLogic (J2EE application) Server (both version 9.2, the state of the art at the time of its creation). At the time this architectural decision for the application was made, both the AquaLogic and WebLogic brands were owned by BEA Systems. The AquaLogic brand included products acquired by BEA through the acquisition of Plumtree, whose flagship product was a portal platform available in both J2EE and .NET versions. As part of this dual technology support an adaptor was created to facilitate the use of WSRP as a communication protocol where customers wished to integrate components from both versions of the Plumtree portal. The adapter evolved over several product generations to include a broad array of both standard and proprietary WSRP integration capabilities. Later, BEA Systems was acquired by Oracle. Over the course of several years Oracle has acquired a large number of portal applications and has taken the strategic direction to migrate users of these myriad (and formerly competitive) products to the Oracle WebCenter technology stack. As part of Oracle’s strategic technology roadmap, older portal products are being schedule for end of life, including the portal products that were part of the BEA acquisition. The .NET Accelerator has been modified over a very long period of time with features driven by users of that product and developed under three different vendors (each a direct competitor in the same solution space prior to merger). The Oracle WebCenter WSRP Producer for .NET was introduced much more recently with the key objective to specifically address the needs of the WebCenter customers developing solutions accessible through both J2EE and .NET platforms utilizing the WSRP specifications. The Oracle Product Development Team also provides these insights on the drivers for developing the WSRP Producer: ***************************************** Support for ASP.NET AJAX. Controls using the ASP.NET AJAX script manager do not function properly in the Application Accelerator for .NET. Support 2 way SSL in WLP. This was not possible with the proxy/bridge set up in the existing Application Accelerator for .NET. Allow developers to code portlets (Web Parts) using the .NET framework rather than a proprietary framework. Developers had to use the Application Accelerator for .NET plug-ins to Visual Studio to manage preferences and profile data. This is now replaced with the .NET Framework Personalization (for preferences) and Profile providers. The WSRP Producer for .NET was created as a new way of developing .NET portlets. It was never designed to be an upgrade path for the Application Accelerator for .NET. .NET developers would create new .NET portlets with the WSRP Producer for .NET and leave any existing .NET portlets running in the Application Accelerator for .NET. ***************************************** The advantage to creating a new solution for WSRP is a product that is far easier for Oracle to maintain and support which in turn improves quality, reliability and maintainability for their customers. No changes to J2EE applications consuming the WSRP portlets previously rendered by the.NET Accelerator is required to migrate from the Aqualogic WSRP solution. For some customers using the .NET Accelerator the challenge is adapting their current .NET applications to work with the WSRP Producer (or any other WSRP adapter as they are proprietary by nature). Part of this adaptation is the need to deploy the .NET applications as a child to the WSRP producer web application as root. Differences between .NET Accelerator and WSRP Producer Note: This section is for those who are curious about why the migration is not as pluggable as something such as changing security providers in WebLogic Server. You can skip this section in its entirety and still be just as competent in performing a migration as if you had read it. The basic terminology used to describe the participating applications in a WSRP environment are the same when applied to either the .NET Accelerator or the WSRP Producer: Producer and Consumer. In both cases the .NET application serves as what is referred to as a WSRP environment as the Producer. The difference lies in how the two adapters create the WSRP translation of the .NET application. The .NET Accelerator, as the name implies, is meant to serve as a quick way of adding WSRP capability to a .NET application. As such, at a high level, the .NET Accelerator behaves as a proxy for requests between the .NET application and the WSRP Consumer. A WSRP request is sent from the consumer to the .NET Accelerator, the.NET Accelerator transforms this request into an ASP.NET request, receives the response, then transforms the response into a WSRP response. The .NET Accelerator is deployed as a stand-alone application on IIS. The WSRP Producer is deployed as a parent application on IIS and all ASP.NET modules that will be made available over WSRP are deployed as children of the WSRP Producer application. In this manner, the WSRP Producer acts more as a Request Filter than a proxy in the WSRP transactions between Producer and Consumer. Highly Recommended Enabling Logging Note: You can skip this section now, but you will most likely want to come back to it later, so why not just read it now? Logging is very helpful in tracking down the causes of any anomalies during testing of migrated portlets. To enable the WSRP Producer logging, update the Application_Start method in the Global.asax.cs for your .NET application by adding log4net.Config.XmlConfigurator.Configure(); IIS logs will usually (in a standard configuration) be in a sub folder under C:\WINDOWS\system32\LogFiles\W3SVC. WSRP Producer logs will be found at C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdefault\Logs\WSRPProducer.log InputTrace.webinfo and OutputTrace.webinfo are located under C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdefault and can be useful in debugging issues related to markup transformations. Things You Must Do Merge Web.Config Note: If you have been skipping all the sections that you can, now is the time to stop and pay attention J Because the existing .NET application will become a sub-application to the WSRP Producer, you will want to merge required settings from the existing Web.Config to the one in the WSRP Producer. Use the WSRP Producer Master Page The Master Page installed for the WSRP Producer provides common, hiddenform fields and JavaScripts to facilitate portlet instance management and display configuration when the child page is being rendered over WSRP. You add the Master Page by including it in the <@ Page declaration with MasterPageFile="~/portlets/Resources/MasterPages/WSRP.Master" . You then replace: <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN" > <HTML> <HEAD> With <asp:Content ID="ContentHead1" ContentPlaceHolderID="wsrphead" Runat="Server"> And </HEAD> <body> <form id="theForm" method="post" runat="server"> With </asp:Content> <asp:Content ID="ContentBody1" ContentPlaceHolderID="Main" Runat="Server"> And finally </form> </body> </HTML> With </asp:Content> In the event you already use Master Pages, adapt your existing Master Pages to be sub masters. See Nested ASP.NET Master Pages for a detailed reference of how to do this. It Happened to Me, It Might Happen to You…Or Not Watch for Use of Session or Request in OnInit In the event the .NET application being modified has pages developed to assume the user has been authenticated in an earlier page request there may be direct or indirect references in the OnInit method to request or session objects that may not have been created yet. This will vary from application to application, so the recommended approach is to test first. If there is an issue with a page running as a WSRP portlet then check for potential references in the OnInit method (including references by methods called within OnInit) to session or request objects. If there are, the simplest solution is to create a new method and then call that method once the necessary object(s) is fully available. I find doing this at the start of the Page_Load method to be the simplest solution. Case Sensitivity .NET languages are not case sensitive, but Java is. This means it is possible to have many variations of SRC= and src= or .JPG and .jpg. The preferred solution is to make these mark up instances all lower case in your .NET application. This will allow the default Rewriter rules in wsrp-producer.xml to work as is. If this is not practical, then make duplicates of any rules where an issue is occurring due to upper or mixed case usage in the .NET application markup and match the case in use with the duplicate rule. For example: <RewriterRule> <LookFor>(href=\"([^\"]+)</LookFor> <ChangeToAbsolute>true</ChangeToAbsolute> <ApplyTo>.axd,.css</ApplyTo> <MakeResource>true</MakeResource> </RewriterRule> May need to be duplicated as: <RewriterRule> <LookFor>(HREF=\"([^\"]+)</LookFor> <ChangeToAbsolute>true</ChangeToAbsolute> <ApplyTo>.axd,.css</ApplyTo> <MakeResource>true</MakeResource> </RewriterRule> While it is possible to write a regular expression that will handle mixed case usage, it would be long and strenous to test and maintain, so the recommendation is to use duplicate rules. Is it Still Relative? Some .NET applications base relative paths with a fixed root location. With the introduction of the WSRP Producer, the root has moved up one level. References to ~/ will need to be updated to ~/portlets and many ../ paths will need another ../ in front. I Can See You But I Can’t Find You This issue was first discovered while debugging modules with code that referenced the form on a page from the code-behind by name and/or id. The initial error presented itself as run-time error that was difficult to interpret over WSRP but seemed clear when run as straight ASP.NET as it indicated that the object with the form name did not exist. Since the form name was no longer valid after implementing the WSRP Master Page, the likely fix seemed to simply update the references in the code. However, as the WSRP Master Page is external to the code, a compile time error resulted: Error      155         The name 'form1' does not exist in the current context                C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdefault\portlets\legacywebsite\module\Screens \Reporting.aspx.cs                51           52           legacywebsite.module Much hair-pulling research later it was discovered that it was the use of the FindControl method causing the issue. FindControl doesn’t work quite as expected once a Master Page has been introduced as the controls become embedded in controls, require a recursion to find them that is not part of the FindControl method. In code where the page form is referenced by name, there are two steps to the solution. First, the form needs to be referenced in code generically with Page.Form. For example, this: ToggleControl ctrl = new ToggleControl(frmManualEntry, FunctionLibrary.ParseArrayLst(userObj.Roles)); Becomes this: ToggleControl ctrl = new ToggleControl(Page.Form, FunctionLibrary.ParseArrayLst(userObj.Roles)); Generally the form id is referenced in most ASP.NET applications as a path to a control on the form. To reach the control once a MasterPage has been added requires an additional method to recurse through the controls collections within the form and find the control ID. The following method (found at Rick Strahl's Web Log) corrects this very nicely: public static Control FindControlRecursive(Control Root, string Id) { if (Root.ID == Id) return Root; foreach (Control Ctl in Root.Controls) { Control FoundCtl = FindControlRecursive(Ctl, Id); if (FoundCtl != null) return FoundCtl; } return null; } Where the form name is not referenced, simply using the FindControlRecursive method in place of FindControl will be all that is necessary. Following the second part of the example referenced earlier, the method called with Page.Form changes its value extraction code block from this: Label lblErrMsg = (Label)frmRef.FindControl("lblBRMsg" To this: Label lblErrMsg = (Label) FunctionLibrary.FindControlRecursive(frmRef, "lblBRMsg" The Master That Won’t Step Aside In most migrations it is preferable to make as few changes as possible. In one case I ran across an existing Master Page that would not function as a sub-Master Page. While it would probably have been educational to trace down why, the expedient process of updating it to take the place of the WSRP Master Page is the route I took. The changes are highlighted below: … <asp:ContentPlaceHolder ID="wsrphead" runat="server"></asp:ContentPlaceHolder> </head> <body leftMargin="0" topMargin="0"> <form id="TheForm" runat="server"> <input type="hidden" name="key" id="key" value="" /> <input type="hidden" name="formactionurl" id="formactionurl" value="" /> <input type="hidden" name="handle" id="handle" value="" /> <asp:ScriptManager ID="ScriptManager1" runat="server" EnablePartialRendering="true" > </asp:ScriptManager> This approach did not work for all existing Master Pages, but fortunately all of the other existing Master Pages I have run across worked fine as a sub-Master to the WSRP Master Page. Moving On In Enterprise Portals, even after you get everything working, the work is not finished. Next you need to get it where everyone will work with it. Migration Planning Providing that the server where IIS is running is adequately sized, it is possible to run both the .NET Accelerator and the WSRP Producer on the same server during the upgrade process. The upgrade can be performed incrementally, i.e., one portlet at a time, if server administration processes support it. Those processes would include the ability to manage a second producer in the consuming portal and to change over individual portlet instances from one provider to the other. If processes or requirements demand that all portlets be cut over at the same time, it needs to be determined if this cut over should include a new producer, updating all of the portlets in the consumer, or if the WSRP Producer portlet configuration must maintain the naming conventions used by the .NET Accelerator and simply change the WSRP end point configured in the consumer. In some enterprises it may even be necessary to maintain the same WSDL end point, at which point the IIS configuration will be where the updates occur. The downside to such a requirement is that it makes rolling back very difficult, should the need arise. Location, Location, Location Not everyone wants the web application to have the descriptively obvious wsrpdefault location, or needs to create a second WSRP site on the same server. The instructions below are from the product team and, while targeted towards making a second site, will work for creating a site with a different name and then remove the old site. You can also change just the name in IIS. Manually Creating a WSRP Producer Site Instructions (NOTE: all executables used are the same ones used by the installer and “wsrpdev” will be the name of the new instance): 1. Copy C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdefault to C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdev. 2. Bring up a command window as an administrator 3. Run C:\Oracle\Middleware\WSRPProducerForDotNet\uninstall_resources\IISAppAccelSiteCreator.exe install WSRPProducers wsrpdev "C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdev" 8678 2.0.50727 4. Run C:\Oracle\Middleware\WSRPProducerForDotNet\uninstall_resources\PermManage.exe add FileSystem C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdev "NETWORK SERVICE" 3 1 5. Run C:\Oracle\Middleware\WSRPProducerForDotNet\uninstall_resources\PermManage.exe add FileSystem C:\Oracle\Middleware\WSRPProducerForDotNet\wsrpdev EVERYONE 1 1 6. Open up C:\Oracle\Middleware\WSRPProducerForDotNet\wsdl\1.0\WSRPService.wsdl and replace wsrpdefault with wsrpdev 7. Open up C:\Oracle\Middleware\WSRPProducerForDotNet\wsdl\2.0\WSRPService.wsdl and replace wsrpdefault with wsrpdev Tests: 1. Bring up a browser on the host itself and go to http://localhost:8678/wsrpdev/wsdl/1.0/WSRPService.wsdl and make sure that the URLs in the XML returned include the wsrpdev changes you made in step 6. 2. Bring up a browser on the host itself and see if the default sample comes up: http://localhost:8678/wsrpdev/portlets/ASPNET_AJAX_sample/default.aspx 3. Register the producer in WLP and test the portlet. Changing the Port used by WSRP Producer The pre-configured port for the WSRP Producer is 8678. You can change this port by updating both the IIS configuration and C:\Oracle\Middleware\WSRPProducerForDotNet\[WSRP_APP_NAME]\wsdl\1.0\WSRPService.wsdl. Do You Need to Migrate? Oracle Premier Support ended in November of 2010 for AquaLogic Interaction .NET Application Accelerator 1.x and Extended Support ends in November 2012 (see http://www.oracle.com/us/support/lifetime-support/lifetime-support-software-342730.html for other related dates). This means that integration with products released after November of 2010 is not supported. If having such support is the policy within your enterprise, you do indeed need to migrate. If changes in your enterprise cause your current solution with the .NET Accelerator to no longer function properly, you may need to migrate. Migration is a choice, and if the goals of your enterprise are to take full advantage of newer technologies then migration is certainly one activity you should be planning for.

    Read the article

  • AspNetCompatibility in WCF Services &ndash; easy to trip up

    - by Rick Strahl
    This isn’t the first time I’ve hit this particular wall: I’m creating a WCF REST service for AJAX callbacks and using the WebScriptServiceHostFactory host factory in the service: <%@ ServiceHost Language="C#" Service="WcfAjax.BasicWcfService" CodeBehind="BasicWcfService.cs" Factory="System.ServiceModel.Activation.WebScriptServiceHostFactory" %>   to avoid all configuration. Because of the Factory that creates the ASP.NET Ajax compatible format via the custom factory implementation I can then remove all of the configuration settings that typically get dumped into the web.config file. However, I do want ASP.NET compatibility so I still leave in: <system.serviceModel> <serviceHostingEnvironment aspNetCompatibilityEnabled="true"/> </system.serviceModel> in the web.config file. This option allows you access to the HttpContext.Current object to effectively give you access to most of the standard ASP.NET request and response features. This is not recommended as a primary practice but it can be useful in some scenarios and in backwards compatibility scenerios with ASP.NET AJAX Web Services. Now, here’s where things get funky. Assuming you have the setting in web.config, If you now declare a service like this: [ServiceContract(Namespace = "DevConnections")] #if DEBUG [ServiceBehavior(IncludeExceptionDetailInFaults = true)] #endif public class BasicWcfService (or by using an interface that defines the service contract) you’ll find that the service will not work when an AJAX call is made against it. You’ll get a 500 error and a System.ServiceModel.ServiceActivationException System error. Worse even with the IncludeExceptionDetailInFaults enabled you get absolutely no indication from WCF what the problem is. So what’s the problem?  The issue is that once you specify aspNetCompatibilityEnabled=”true” in the configuration you *have to* specify the AspNetCompatibilityRequirements attribute and one of the modes that enables or at least allows for it. You need either Required or Allow: [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.Required)] without it the service will simply fail without further warning. It will also fail if you set the attribute value to NotAllowed. The following also causes the service to fail as above: [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.NotAllowed)] This is not totally unreasonable but it’s a difficult issue to debug especially since the configuration setting is global – if you have more than one service and one requires traditional ASP.NET access and one doesn’t then both must have the attribute specified. This is one reason why you’d want to avoid using this functionality unless absolutely necessary. WCF REST provides some basic access to some of the HTTP features after all, although what’s there is severely limited. I also wish that ServiceActivation errors would provide more error information. Getting an Activation error without further info on what actually is wrong is pretty worthless especially when it is a technicality like a mismatched configuration/attribute setting like this.© Rick Strahl, West Wind Technologies, 2005-2010Posted in ASP.NET  WCF  AJAX  

    Read the article

  • Asp.net session on browser close

    - by budugu
    Note: Cross posted from Vijay Kodali's Blog. Permalink How to capture logoff time when user closes browser? Or How to end user session when browser closed? These are some of the frequently asked questions in asp.net forums. In this post I'll show you how to do this when you're building an ASP.NET web application. Before we start, one fact: There is no full-proof technique to catch the browser close event for 100% of time. The trouble lies in the stateless nature of HTTP. The Web server is out of the picture as soon as it finishes sending the page content to the client. After that, all you can rely on is a client side script. Unfortunately, there is no reliable client side event for browser close. Solution: The first thing you need to do is create the web service. I've added web service and named it AsynchronousSave.asmx.    Make this web service accessible from Script, by setting class qualified with the ScriptServiceAttribute attribute...  Add a method (SaveLogOffTime) marked with [WebMethod] attribute. This method simply accepts UserId as a string variable and writes that value and logoff time to text file. But you can pass as many variables as required. You can then use this information for many purposes. To end user session, you can just call Session.Abandon() in the above web method. To enable web service to be called from page’s client side code, add script manager to page. Here i am adding to SessionTest.aspx page When the user closes the browser, onbeforeunload event fires on the client side. Our final step is adding a java script function to that event, which makes web service calls. The code is simple but effective My Code HTML:( SessionTest.aspx ) C#:( SessionTest.aspx.cs ) That’s’ it. Run the application and after browser close, open the text file to see the log off time. The above code works well in IE 7/8. If you have any questions, leave a comment.

    Read the article

< Previous Page | 120 121 122 123 124 125 126 127 128 129 130 131  | Next Page >