Search Results

Search found 3409 results on 137 pages for 'distributed computing'.

Page 126/137 | < Previous Page | 122 123 124 125 126 127 128 129 130 131 132 133  | Next Page >

  • Is this scenario in compliance with GPLv3?

    - by Sean Kinsey
    For arguments sake, say that we create a web application , that depends on a GPLv3 licensed component, lets say Ext JS. Based on Section 0 of the license, the common notion is that the entire web application (the client side javascript) falls under the definition of a covered work: A “covered work” means either the unmodified Program or a work based on the Program. and that it will therefor have to be distributed under the same license Ok, so here comes the fun part: This is a short 'program' that is based on Ext JS var myPanel = new Ext.Panel(); The question that arises is: Have I now violated the GPL by not including the source of Ext JS and its license? Ok, so lets take another example <!doctype html> <html> <head> <title>my title</title> <script type="text/javascript" src="http://extjs.cachefly.net/ext-3.2.1/ext-all.js"> </script> <link rel="stylesheet" type="text/css" href="http://extjs.cachefly.net/ext-3.2.1/resources/css/ext-all.css" /> <script type="text/javascript"> var myPanel = new Ext.Panel(); </script> </head> <body> </body> </html> Have I now violated the terms of the GPL? The code conveyed by me to you is in a non-functional state - it will have to be combined with the actual source of Ext JS, which you(your browser) will have to retrieve, from a source made public by someone else to be usable. Now, if the answer to the above is no, how does me conveying this code in visible form differ from the 'invisible' form conveyed by my web server? As a side note, a very similar thing is done in Linux with many projects that depends on less permissive licenses - the user has to retrieve these on its own and make these available for the primary lib/executable. How is this not the same if the user is informed on beforehand that he (the browser) will have to retrieve the needed resources from a different source? Just to make it clear, I'm pro FLOSS, and I have also published a number of projects licensed under more permissive licenses. The reason I'm asking this is that I still haven't found anyone offering a definitive answer to this.

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • With EJB 2.1, is declaring references to resources in ejb-jar.xml required?

    - by zwerd328
    I'm using Weblogic 9.2 with a lot of MDBs. These MDBs access JDBC DataSources and write to both locally and externally managed JMS Destinations using local and foreign XAConnectionFactorys, respectively. Each MDB demarcates a container-managed JTA transaction that should be distributed amongst all of these resources. Below is an excerpt from my ejb-jar.xml for an MDB that consumes from a local Queue called "MyDestination" and produces to an IBM Websphere MQ Queue called "MyOtherDestination". These logical names are linked to physical objects in my weblogic-ejb-jar.xml file. Is it required to use the <resource-ref> and <message-destination-ref> tags to expose the ConnectionFactory and Queue to the MDB? If so, is it required by Weblogic or is it required by the J2EE spec? And for what purpose? For example, is it required to support XA transactionality? I'm already aware of the benefit of decoupling the administered objects from my MDB using names exposed to the naming context of the MDB. Is this the only value added when specifying these tags? In other words, is it acceptable to just reference these objects from my MDB using the InitialContext and the objects' fully-qualified names? <enterprise-bean> <message-driven> <ejb-name>MyMDB</ejb-name> <ejb-class>com.mycompany.MyMessageDrivenBean</ejb-class> <transaction-type>Container</transaction-type> <message-destination-type>javax.jms.Queue</message-destination> <message-destination-link>MyDestination</message-destination-link> <resource-ref> <res-ref-name>jms/myQCF</res-ref-name> <res-type>javax.jms.XAConnectionFactory</res-type> <res-auth>Container</res-auth> </resource-ref> <message-destination-ref> <message-destination-ref-name>jms/myOtherDestination</message-destination-ref-name> <message-destination-type>javax.jms.Queue</message-destination-type> <message-destination-usage>Produces</message-destination-usage> <message-destination-link>MyOtherDestination</message-destination-link> </message-destination-ref> </message-driven> <enterprise-bean>

    Read the article

  • The best way to separate admin functionality from a public site?

    - by AndrewO
    I'm working on a site that's grown both in terms of user-base and functionality to the point where it's becoming evident that some of the admin tasks should be separate from the public website. I was wondering what the best way to do this would be. For example, the site has a large social component to it, and a public sales interface. But at the same time, there's back office tasks, bulk upload processing, dashboards (with long running queries), and customer relations tools in the admin section that I would like to not be effected by spikes in public traffic (or effect the public-facing response time). The site is running on a fairly standard Rails/MySQL/Linux stack, but I think this is more of an architecture problem than an implementation one: mainly, how does one keep the data and business logic in sync between these different applications? Some strategies that I'm evaluating: 1) Create a slave database of the public facing database on another machine. Extract out all of the model and library code so that it can be shared between the applications. Create new controllers and views for the admin interfaces. I have limited experience with replication and am not even sure that it's supposed to be used this way (most of the time I've seen it, it's been for scaling out the read capabilities of the same application, rather than having multiple different ones). I'm also worried about the potential for latency issues if the slave is not on the same network. 2) Create new more task/department-specific applications and use a message oriented middleware to integrate them. I read Enterprise Integration Patterns awhile back and they seemed to advocate this for distributed systems. (Alternatively, in some cases the basic Rails-style RESTful API functionality might suffice.) But, I have nightmares about data synchronization issues and the massive re-architecting that this would entail. 3) Some mixture of the two. For example, the only public information necessary for some of the back office tasks is a read-only completion time or status. Would it make sense to have that on a completely separate system and send the data to public? Meanwhile, the user/group admin functionality would be run on a separate system sharing the database? The downside is, this seems to keep many of the concerns I have with the first two, especially the re-architecting. I'm sure the answers are going to be highly dependent on a site's specific needs, but I'd love to hear success (or failure) stories.

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Technical non-terminating condition in a loop

    - by Snarfblam
    Most of us know that a loop should not have a non-terminating condition. For example, this C# loop has a non-terminating condition: any even value of i. This is an obvious logic error. void CountByTwosStartingAt(byte i) { // If i is even, it never exceeds 254 for(; i < 255; i += 2) { Console.WriteLine(i); } } Sometimes there are edge cases that are extremely unlikeley, but technically constitute non-exiting conditions (stack overflows and out-of-memory errors aside). Suppose you have a function that counts the number of sequential zeros in a stream: int CountZeros(Stream s) { int total = 0; while(s.ReadByte() == 0) total++; return total; } Now, suppose you feed it this thing: class InfiniteEmptyStream:Stream { // ... Other members ... public override int Read(byte[] buffer, int offset, int count) { Array.Clear(buffer, offset, count); // Output zeros return count; // Never returns -1 (end of stream) } } Or more realistically, maybe a stream that returns data from external hardware, which in certain cases might return lots of zeros (such as a game controller sitting on your desk). Either way we have an infinite loop. This particular non-terminating condition stands out, but sometimes they don't. A completely real-world example as in an app I'm writing. An endless stream of zeros will be deserialized into infinite "empty" objects (until the collection class or GC throws an exception because I've exceeded two billion items). But this would be a completely unexpected circumstance (considering my data source). How important is it to have absolutely no non-terminating conditions? How much does this affect "robustness?" Does it matter if they are only "theoretically" non-terminating (is it okay if an exception represents an implicit terminating condition)? Does it matter whether the app is commercial? If it is publicly distributed? Does it matter if the problematic code is in no way accessible through a public interface/API? Edit: One of the primary concerns I have is unforseen logic errors that can create the non-terminating condition. If, as a rule, you ensure there are no non-terminating conditions, you can identify or handle these logic errors more gracefully, but is it worth it? And when? This is a concern orthogonal to trust.

    Read the article

  • organizing external libraries and include files

    - by stijn
    Over the years my projects use more and more external libraries, and the way I did it starts feeling more and more awkward (although, that has to be said, it does work flawlessly). I use VS on Windows, CMake on others, and CodeComposer for targetting DSPs on Windows. Except for the DSPs, both 32bit and 64bit platforms are used. Here's a sample of what I am doing now; note that as shown, the different external libraries themselves are not always organized in the same way. Some have different lib/include/src folders, others have a single src folder. Some came ready-to-use with static and/or shared libraries, others were built /path/to/projects /projectA /projectB /path/to/apis /apiA /src /include /lib /apiB /include /i386/lib /amd64/lib /path/to/otherapis /apiC /src /path/to/sharedlibs /apiA_x86.lib -->some libs were built in all possible configurations /apiA_x86d.lib /apiA_x64.lib /apiA_x64d.lib /apiA_static_x86.lib /apiB.lib -->other libs have just one import library /path/to/dlls -->most of this directory also gets distributed to clients /apiA_x86.dll and it's in the PATH /apiB.dll Each time I add an external libary, I roughly use this process: build it, if needed, for different configurations (release/debug/platform) copy it's static and/or import libraries to 'sharedlibs' copy it's shared libraries to 'dlls' add an environment variable, eg 'API_A_DIR' that points to the root for ApiA, like '/path/to/apis/apiA' create a VS property sheet and a CMake file to state include path and eventually the library name, like include = '$(API_A_DIR)/Include' and lib = apiA.lib add the propertysheet/cmake file to the project needing the library It's especially step 4 and 5 that are bothering me. I am pretty sure I am not the only one facing this problem, and would like see how others deal with this. I was thinking to get rid of the environment variables per library, and use just one 'API_INCLUDE_DIR' and populating it with the include files in an organized way: /path/to/api/include /apiA /apiB /apiC This way I do not need the include path in the propertysheets nor the environment variables. For libs that are only used on windows I even don't need a propertysheet at all as I can use #pragmas to instruct the linker what library to link to. Also in the code it will be more clear what gets included, and no need for wrappers to include files having the same name but are from different libraries: #include <apiA/header.h> #include <apiB/header.h> #include <apiC_version1/header.h> The withdrawal is off course that I have to copy include files, and possibly** introduce duplicates on the filesystem, but that looks like a minor price to pay, doesn't it? ** actually once libraries are built, the only thing I need from them is the include files and thie libs. Since each of those would have a dedicated directory, the original source tree is not needed anymore so can be deleted..

    Read the article

  • Can I have a workspace that is both a git workspace and a svn workspace?

    - by Troy
    I have checked out now a local working copy of a codebase that lives in an svn repo. It's a big Java project that I use Eclipse to develop in. Eclipse of course builds everything on the fly, in it's own way with all the binaries ending up in [project root]/bin. That's perfectly fine with me, for development, but when the build runs on the build server, it looks quite a lot different (maven build, binaries end up in a different directory structure, etc). Sometimes I need to recreate the build server environment on my local development system to debug the build or what have you, so I usually end up downloading an entirely new working copy into a new workspace and running the build from there (prevents cluttering my development workspace with all the build artifacts and dirtying up the working copy). Of course sometimes I'm interested in running the full build on code that I don't want to check in yet, so I will manually copy over the "development" workspace onto the "build" workspace. Besides taking a lot of extra time copying a lot of files that I don't actually need (just overlaying the new over the old), this also screws up my svn metadata, meaning that I can't check in changes from that "build workspace" working copy, and I often end up having to re-download the code to get it back into a known state. So I'm thinking I make my svn working copy a local git repo, then "check out" the in-development code from the svn working copy/git master, into the local build workspace. Then I can build, revert my changes, have all the advantages of a version controlled working copy in the build workspace. Then if I need to make changes to the build, push those back into the git master (which is also a svn working copy), then check them into the main svn repo. |-------------| |main svn repo| <------- |---------------------| |-------------| |svn working copy | <------- |--------------------| | (svn dev workspace/ | | non-svn-versioned | | git master) | | build workspace | |---------------------| | (git working copy) | |--------------------| Just switching everything to git would obviously be better, but, big company, too many people using svn, too costly to change everything, etc. We're stuck with svn as the main repo for now. BTW, I know there is a maven plugin for Eclipse and everything, I'm mainly interested to know if there is a way to maintain a workspace that is both a git working copy and an svn working copy. Actually any distributed version control system would probably work (hg possibly?). Advice? How does everybody else handle this situation of having a to manage both a "development" build process and a "production" build process?

    Read the article

  • Achieving C# "readonly" behavior in C++

    - by Tommy Fisk
    Hi guys, this is my first question on stack overflow, so be gentle. Let me first explain the exact behavior I would like to see. If you are familiar with C# then you know that declaring a variable as "readonly" allows a programmer to assign some value to that variable exactly once. Further attempts to modify the variable will result in an error. What I am after: I want to make sure that any and all single-ton classes I define can be predictably instantiated exactly once in my program (more details at the bottom). My approach to realizing my goal is to use extern to declare a global reference to the single-ton (which I will later instantiate at a time I choose. What I have sort of looks like this, namespace Global { extern Singleton& mainInstance; // not defined yet, but it will be later! } int main() { // now that the program has started, go ahead and create the singleton object Singleton& Global::mainInstance = Singleton::GetInstance(); // invalid use of qualified name Global::mainInstance = Singleton::GetInstance(); // doesn't work either :( } class Singleton { /* Some details ommited */ public: Singleton& GetInstance() { static Singleton instance; // exists once for the whole program return instance; } } However this does not really work, and I don't know where to go from here. Some details about what I'm up against: I'm concerned about threading as I am working on code that will deal with game logic while communicating with several third-party processes and other processes I will create. Eventually I would have to implement some kind of synchronization so multiple threads could access the information in the Singleton class without worry. Because I don't know what kinds of optimizations I might like to do, or exactly what threading entails (never done a real project using it), I was thinking that being able to predictably control when Singletons were instantiated would be a Good Thing. Imagine if Process A creates Process B, where B contains several Singletons distributed against multiple files and/or libraries. It could be a real nightmare if I can not reliably ensure the order these singleton objects are instantiated (because they could depend on each other, and calling methods on a NULL object is generally a Bad Thing). If I were in C# I would just use the readonly keyword, but is there any way I can implement this (compiler supported) behavior in C++? Is this even a good idea? Thanks for any feedback.

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Hosting a subversion working copy in an remote WebDAV folder

    - by Daniel Baulig
    This might be a bit awkward, but I'll try to explain what I am trying to achieve and what problems I encountered. First of all: whats this about? I am currently trying to set up a distributed working enviroment for developing a web page. My plan was to setup a SVN repository for version control, a live server where the actual live page ist hosted and a development server where I can work on the page. To ease things I intended to not have a local copy of the project on my disk, but to actually work directy on the files, that the development server hosts. For that I setup a WebDAV directory, under devserver.com/workspace, that actually mapped to files served under devserver.com/. So I could connect to devserver.com/workspace, change something and view the results live at devserver.com/. So far this worked perfectly. The next step was to create a SVN repository that would take care of my version control. I intended to be able to checkin to the reposiroty from my development server and at any time, with a small shell script, deploy any revision from the svn to the live server by checking out a copy of the revision into the live server directories. The second part, checking out into the live server, also worked perfectly. The first part though is where problems arose: My workstation is a Windows 7 machine. I connected to the WebDAV share using Windows built-in WebDAV support, which worked quite well. I can create, move, delete, edit, whatever files on my WebDAV share from my Windows machine perfectly. The next step was to checkout a working copy from the SVN (actually hosted at devserver.com/subversion/) into the WebDAV share. In the first try I used the Eclipse plugin subversive. The actual checkout worked fine and I can update and commit stuff to the repository, however, I cannot add any files to the ignore list. It always brings me an error. So I tried the same thing with a complete fresh repository using TortoiseSVN - and again it failed with the same errors. Here is what it says when trying to add files to svnignore: Some of selected resources were not added to ignore. svn: Cannot rename file '\\devserver.com@SSL\DavWWWRoot\workspace\.svn\tmp\dir-props.66fd8936-2701-0010-bb76-472f0b56a5d1.tmp' to '\\devserver.com@SSL\DavWWWRoot\workspace\.svn\tmp\dir-props' This is what apache2 tells me, when I try to add a file to svnignore: [Sun Mar 07 03:54:19 2010] [error] [client xxx.xxx.xxx.xxx] Negotiation: discovered file(s) matching request: /var/www/devserver.com/.svn/tmp/dir-props (None could be negotiated). [Sun Mar 07 03:54:31 2010] [error] [client xxx.xxx.xxx.xxx] (20)Not a directory: The URL contains extraneous path components. The resource could not be identified. [400, #0] Actually both messages are repeated several times. The first one occurs first and is repeated about 5 times and the second comes there after and is repeated propably more than 20 times. If I create a regular file, delete, rename or modify it none of those messages appear in my error.log While writing this question now I was able to add fils to svnignore using TortoiseSVN. However, after that, Eclipse would not let me commit anymore. The error that used to pop up when adding files to svnignore now also shows up while commiting. While searching the web I found some people having this same message appearing because they had files only different in upper- / lower-case naming. I checked my repository and did not find such files. I also read somewhere about people having troubles with WebDAV and file locking, because WebDAV's file locking capabilities seem to be very limited. At some stage I got errors telling me my repository was locked and thus the operations could not be completed. This error though did not appear anymore, since I setup a completely fresh repository and working copy. I would really appreciate any help anyone can provide me in fixing this problem! If there are any more questions feel free to ask. I know this is a somewhat unusual setup. Best regards, Daniel

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • disk-to-disk backup without costly backup redundancy?

    - by AaronLS
    A good backup strategy involves a combination of 1) disconnected backups/snapshots that will not be affected by bugs, viruses, and/or security breaches 2) geographically distributed backups to protect against local disasters 3) testing backups to ensure that they can be restored as needed Generally I take an onsite backup daily, and an offsite backup weekly, and do test restores periodically. In the rare circumstance that I need to restore files, I do some from the local backup. Should a catastrophic event destroy the servers and local backups, then the offsite weekly tape backup would be used to restore the files. I don't need multiple offsite backups with redundancy. I ALREADY HAVE REDUNDANCY THROUGH THE USE OF BOTH LOCAL AND REMOTE BACKUPS. I have recovery blocks and par files with the backups, so I already have protection against a small percentage of corrupt bits. I perform test restores to ensure the backups function properly. Should the remote backups experience a dataloss, I can replace them with one of the local backups. There are historical offsite backups as well, so if a dataloss was not noticed for a few weeks(such as a bug/security breach/virus), the data could be restored from an older backup. By doing this, the only scenario that poses a risk to complete data loss would be one where both the local, remote, and servers all experienced a data loss in the same time period. I'm willing to risk that happening since the odds of that trifecta negligibly small, and the data isn't THAT valuable to me. So I hope I have emphasized that I don't need redundancy in my offsite backups because I have covered all the bases. I know this exact technique is employed by numerous businesses. Of course there are some that take multiple offsite backups, because the data is so incredibly valuable that they don't even want to risk that trifecta disaster, but in the majority of cases the trifecta disaster is an accepted risk. I HAD TO COVER ALL THIS BECAUSE SOME PEOPLE DON'T READ!!! I think I have justified my backup strategy and the majority of businesses who use offsite tape backups do not have any additional redundancy beyond what is mentioned above(recovery blocks, par files, historical snapshots). Now I would like to eliminate the use of tapes for offsite backups, and instead use a backup service. Most however are extremely costly for $/gb/month storage. I don't mind paying for transfer bandwidth, but the cost of storage is way to high. All of them advertise that they maintain backups of the data, and I imagine they use RAID as well. Obviously if you were using them to host servers this would all be necessary, but for my scenario, I am simply replacing my offsite backups with such a service. So there is no need for RAID, and absolutely no value in another layer of backups of backups. My one and only question: "Are there online data-storage/backup services that do not use redundancy or offer backups(backups of my backups) as part of their packages, and thus are more reasonably priced?" NOT my question: "Is this a flawed strategy?" I don't care if you think this is a good strategy or not. I know it pretty standard. Very few people make an extra copy of their offsite backups. They already have local backups that they can use to replace the remote backups if something catastrophic happens at the remote site. Please limit your responses to the question posed. Sorry if I seem a little abrasive, but I had some trolls in my last post who didn't read my requirements nor my question, and were trying to go off answering a totally different question. I made it pretty clear, but didn't try to justify my strategy, because I didn't ask about whether my strategy was justifyable. So I apologize if this was lengthy, as it really didn't need to be, but since there are so many trolls here who try to sidetrack questions by responding without addressing the question at hand.

    Read the article

  • Managing access to multiple linux system

    - by Swartz
    A searched for answers but have found nothing on here... Long story short: a non-profit organization is in dire need of modernizing its infrastructure. First thing is to find an alternatives to managing user accounts on a number of Linux hosts. We have 12 servers (both physical and virtual) and about 50 workstations. We have 500 potential users for these systems. The individual who built and maintained the systems over the years has retired. He wrote his own scripts to manage it all. It still works. No complaints there. However, a lot of the stuff is very manual and error-prone. Code is messy and after updates often needs to be tweaked. Worst part is there is little to no docs written. There are just a few ReadMe's and random notes which may or may not be relevant anymore. So maintenance has become a difficult task. Currently accounts are managed via /etc/passwd on each system. Updates are distributed via cron scripts to correct systems as accounts are added on the "main" server. Some users have to have access to all systems (like a sysadmin account), others need access to shared servers, while others may need access to workstations or only a subset of those. Is there a tool that can help us manage accounts that meets the following requirements? Preferably open source (i.e. free as budget is VERY limited) mainstream (i.e. maintained) preferably has LDAP integration or could be made to interface with LDAP or AD service for user authentication (will be needed in the near future to integrate accounts with other offices) user management (adding, expiring, removing, lockout, etc) allows to manage what systems (or group of systems) each user has access to - not all users are allowed on all systems support for user accounts that could have different homedirs and mounts available depending on what system they are logged into. For example sysadmin logged into "main" server has main://home/sysadmin/ as homedir and has all shared mounts sysadmin logged into staff workstations would have nas://user/s/sysadmin as homedir(different from above) and potentially limited set of mounts, a logged in client would have his/her homedir at different location and no shared mounts. If there is an easy management interface that would be awesome. And if this tool is cross-platform (Linux / MacOS / *nix), that will be a miracle! I have searched the web and so have found nothing suitable. We are open to any suggestions. Thank you. EDIT: This question has been incorrectly marked as a duplicate. The linked to answer only talks about having same homedirs on all systems, whereas we need to have different homedirs based on what system user is currently logged into(MULTIPLE homedirs). Also access needs to be granted only to some machinees not the whole lot. Mods, please understand the full extent of the problem instead of merely marking it as duplicate for points...

    Read the article

  • http.conf setup to simplify using 'localhost:81'

    - by Will
    I'm installing portable wampserver within my dropbox folder so I can access anywhere. I have this achieved and accessible using http://locahost:81 I want to access it by using a different address (dropping the :81 port number) such as http://myothersite. I'm fairly certain I need to add a virtualhosts directove somewhere within this, but I am not Apache experienced! This is the current Apache httpd.conf file: ServerRoot "C:/Users/will/Dropbox/Wampee-2.1-beta-2/bin/apache/apache2.2.17" Listen 81 ServerAdmin admin@localhost ServerName localhost:81 DocumentRoot "C:/Users/will/Dropbox/Wampee-2.1-beta-2/www/" <Directory /> Options FollowSymLinks AllowOverride None Order deny,allow Deny from all </Directory> <Directory "C:/Users/will/Dropbox/Wampee-2.1-beta-2/www/"> Options Indexes FollowSymLinks AllowOverride all # onlineoffline tag - don't remove Order Deny,Allow Deny from all Allow from 127.0.0.1 </Directory> <IfModule dir_module> DirectoryIndex index.php index.php3 index.html index.htm </IfModule> <FilesMatch "^\.ht"> Order allow,deny Deny from all Satisfy All </FilesMatch> ErrorLog "C:/Users/will/Dropbox/Wampee-2.1-beta-2/logs/apache_error.log" LogLevel warn <IfModule log_config_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %>s %b" common <IfModule logio_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> CustomLog "C:/Users/will/Dropbox/Wampee-2.1-beta-2/logs/access.log" common #CustomLog "logs/access.log" combined </IfModule> <IfModule alias_module> ScriptAlias /cgi-bin/ "cgi-bin/" </IfModule> <IfModule cgid_module> #Scriptsock logs/cgisock </IfModule> <Directory "cgi-bin"> AllowOverride None Options None Order allow,deny Allow from all </Directory> DefaultType text/plain <IfModule mime_module> TypesConfig conf/mime.types AddType application/x-compress .Z AddType application/x-gzip .gz .tgz AddType application/x-httpd-php .php AddType application/x-httpd-php .php3 </IfModule> # Server-pool management (MPM specific) #Include conf/extra/httpd-mpm.conf # Multi-language error messages #Include conf/extra/httpd-multilang-errordoc.conf # Fancy directory listings Include conf/extra/httpd-autoindex.conf # Language settings #Include conf/extra/httpd-languages.conf # User home directories #Include conf/extra/httpd-userdir.conf # Real-time info on requests and configuration #Include conf/extra/httpd-info.conf # Virtual hosts #Include conf/extra/httpd-vhosts.conf # Local access to the Apache HTTP Server Manual #Include conf/extra/httpd-manual.conf # Distributed authoring and versioning (WebDAV) #Include conf/extra/httpd-dav.conf # Various default settings #Include conf/extra/httpd-default.conf # Secure (SSL/TLS) connections #Include conf/extra/httpd-ssl.conf # # Note: The following must must be present to support # starting without SSL on platforms with no /dev/random equivalent # but a statically compiled-in mod_ssl. # <IfModule ssl_module> SSLRandomSeed startup builtin SSLRandomSeed connect builtin </IfModule> Include "C:/Users/will/Dropbox/Wampee-2.1-beta-2/alias/*" Include "C:/Users/will/Dropbox/Wampee-2.1-beta-2/MyWebAp ps/etc/alias/*"

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

  • How should I config Apache2.2?

    - by user1607641
    I tried to configure Apache 2.2.17 with PHP5.4 using this manual. But when I restarted my PC and went to http://localhost/phpinfo.php, I received this message: Not Found. The requested URL /phpinfo.php was not found on this server. Here is my httpd.conf - (full version with comments) and a copy with the comments stripped for brevity: ServerRoot "C:/Program Files/Apache2.2" #Listen 12.34.56.78:80 Listen 80 LoadModule actions_module modules/mod_actions.so LoadModule alias_module modules/mod_alias.so LoadModule asis_module modules/mod_asis.so LoadModule auth_basic_module modules/mod_auth_basic.so LoadModule authn_default_module modules/mod_authn_default.so LoadModule authn_file_module modules/mod_authn_file.so LoadModule authz_default_module modules/mod_authz_default.so LoadModule authz_groupfile_module modules/mod_authz_groupfile.so LoadModule authz_host_module modules/mod_authz_host.so LoadModule authz_user_module modules/mod_authz_user.so LoadModule autoindex_module modules/mod_autoindex.so LoadModule cgi_module modules/mod_cgi.so LoadModule dir_module modules/mod_dir.so LoadModule env_module modules/mod_env.so LoadModule include_module modules/mod_include.so LoadModule isapi_module modules/mod_isapi.so LoadModule log_config_module modules/mod_log_config.so LoadModule mime_module modules/mod_mime.so LoadModule negotiation_module modules/mod_negotiation.so LoadModule rewrite_module modules/mod_rewrite.so LoadModule setenvif_module modules/mod_setenvif.so LoadModule php5_module "C:/Languages/PHP/php5apache2_4.dll" # PHP AddHandler application/x-httpd-php .php PHPIniDir "C:/Languages/PHP" <IfModule !mpm_netware_module> <IfModule !mpm_winnt_module> User daemon Group daemon </IfModule> </IfModule> ServerAdmin [email protected] #ServerName localhost:80 DocumentRoot "C:/Sites" <Directory /> Options FollowSymLinks AllowOverride None Order deny,allow Deny from all </Directory> <Directory "C:/Sites"> Options Indexes FollowSymLinks AllowOverride All Order allow,deny Allow from all </Directory> <IfModule dir_module> DirectoryIndex index.php index.html </IfModule> <FilesMatch "^\.ht"> Order allow,deny Deny from all Satisfy All </FilesMatch> ErrorLog "logs/error.log" LogLevel warn <IfModule log_config_module> LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" combined LogFormat "%h %l %u %t \"%r\" %>s %b" common <IfModule logio_module> # You need to enable mod_logio.c to use %I and %O LogFormat "%h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\" %I %O" combinedio </IfModule> CustomLog "logs/access.log" common </IfModule> <IfModule alias_module> ScriptAlias /cgi-bin/ "C:/Program Files/Apache2.2/cgi-bin/" </IfModule> <IfModule cgid_module> #Scriptsock logs/cgisock </IfModule> <Directory "C:/Program Files/Apache2.2/cgi-bin"> AllowOverride None Options None Order allow,deny Allow from all </Directory> DefaultType text/plain <IfModule mime_module> TypesConfig conf/mime.types #AddType application/x-gzip .tgz #AddEncoding x-compress .Z #AddEncoding x-gzip .gz .tgz AddType application/x-compress .Z AddType application/x-gzip .gz .tgz #AddHandler cgi-script .cgi #AddHandler type-map var #AddType text/html .shtml #AddOutputFilter INCLUDES .shtml </IfModule> #MIMEMagicFile conf/magic # Some examples: #ErrorDocument 500 "The server made a boo boo." #ErrorDocument 404 /missing.html #ErrorDocument 404 "/cgi-bin/missing_handler.pl" #ErrorDocument 402 http://localhost/subscription_info.html #MaxRanges unlimited #EnableMMAP off #EnableSendfile off # Server-pool management (MPM specific) #Include conf/extra/httpd-mpm.conf # Multi-language error messages #Include conf/extra/httpd-multilang-errordoc.conf # Fancy directory listings #Include conf/extra/httpd-autoindex.conf # Language settings #Include conf/extra/httpd-languages.conf # User home directories #Include conf/extra/httpd-userdir.conf # Real-time info on requests and configuration #Include conf/extra/httpd-info.conf # Virtual hosts Include conf/extra/httpd-vhosts.conf # Local access to the Apache HTTP Server Manual #Include conf/extra/httpd-manual.conf # Distributed authoring and versioning (WebDAV) #Include conf/extra/httpd-dav.conf # Various default settings #Include conf/extra/httpd-default.conf <IfModule ssl_module> SSLRandomSeed startup builtin SSLRandomSeed connect builtin </IfModule> Directory with sites is C:/Sites and PHP is located at C:/Languages/PHP.

    Read the article

  • Set up lnux box for hosting a-z

    - by microchasm
    I am in the process of reinstalling the OS on a machine that will be used to host a couple of apps for our business. The apps will be local only; access from external clients will be via vpn only. The prior setup used a hosting control panel (Plesk) for most of the admin, and I was looking at using another similar piece of software for the reinstall - but I figured I should finally learn how it all works. I can do most of the things the software would do for me, but am unclear on the symbiosis of it all. This is all an attempt to further distance myself from the land of Configuration Programmer/Programmer, if at all possible. I can't find a full walkthrough anywhere for what I'm looking for, so I thought I'd put up this question, and if people can help me on the way I will edit this with the answers, and document my progress/pitfalls. Hopefully someday this will help someone down the line. The details: CentOS 5.5 x86_64 httpd: Apache/2.2.3 mysql: 5.0.77 (to be upgraded) php: 5.1 (to be upgraded) The requirements: SECURITY!! Secure file transfer Secure client access (SSL Certs and CA) Secure data storage Virtualhosts/multiple subdomains Local email would be nice, but not critical The Steps: Download latest CentOS DVD-iso (torrent worked great for me). Install CentOS: While going through the install, I checked the Server Components option thinking I was going to be using another Plesk-like admin. In hindsight, considering I've decided to try to go my own way, this probably wasn't the best idea. Basic config: Setup users, networking/ip address etc. Yum update/upgrade. Upgrade PHP: To upgrade PHP to the latest version, I had to look to another repo outside CentOS. IUS looks great and I'm happy I found it! cd /tmp #wget http://dl.iuscommunity.org/pub/ius/stable/Redhat/5/x86_64/epel-release-1-1.ius.el5.noarch.rpm #rpm -Uvh epel-release-1-1.ius.el5.noarch.rpm #wget http://dl.iuscommunity.org/pub/ius/stable/Redhat/5/x86_64/ius-release-1-4.ius.el5.noarch.rpm #rpm -Uvh ius-release-1-4.ius.el5.noarch.rpm yum list | grep -w \.ius\. [will list all packages available in the IUS repo] rpm -qa | grep php [will list installed packages needed to be removed. the installed packages need to be removed before you can install the IUS packages otherwise there will be conflicts] #yum shell >remove php-gd php-cli php-odbc php-mbstring php-pdo php php-xml php-common php-ldap php-mysql php-imap Setting up Remove Process >install php53 php53-mcrypt php53-mysql php53-cli php53-common php53-ldap php53-imap php53-devel >transaction solve >transaction run Leaving Shell #php -v PHP 5.3.2 (cli) (built: Apr 6 2010 18:13:45) This process removes the old version of PHP and installs the latest. To upgrade mysql: Pretty much the same process as above with PHP #/etc/init.d/mysqld stop [OK] rpm -qa | grep mysql [installed mysql packages] #yum shell >remove mysql mysql-server Setting up Remove Process >install mysql51 mysql51-server mysql51-devel >transaction solve >transaction run Leaving Shell #service mysqld start [OK] #mysql -v Server version: 5.1.42-ius Distributed by The IUS Community Project The above upgrade instructions courtesy of IUS wiki: http://wiki.iuscommunity.org/Doc/ClientUsageGuide Create a chroot jail to hold sftp user via rssh. This will force SCP/SFTP and will circumvent traditional FTP server setup. #cd /tmp #wget http://dag.wieers.com/rpm/packages/rssh/rssh-2.3.2-1.2.el5.rf.x86_64.rpm #rpm -ivh rssh-2.3.2-1.2.el5.rf.x86_64.rpm #useradd -m -d /home/dev -s /usr/bin/rssh dev #passwd dev Edit /etc/rssh.conf to grant access to SFTP to rssh users. #vi /etc/rssh.conf Uncomment line allowscp This allows me to connect to the machine via SFTP protocol in Transmit (my FTP program of choice; I'm sure it's similar with other FTP apps). Above instructions for SFTP appropriated (with appreciation!) from http://www.cyberciti.biz/tips/linux-unix-restrict-shell-access-with-rssh.html And this is where I'm at. I will keep editing this as I make progress. Any tips on how to Configure virtual interfaces/ip based virtual hosts for SSL, setting up a CA, or anything else would be appreciated.

    Read the article

< Previous Page | 122 123 124 125 126 127 128 129 130 131 132 133  | Next Page >