Search Results

Search found 35976 results on 1440 pages for 'js test driver'.

Page 129/1440 | < Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >

  • Syncronise Server Seconds with JS Clients

    - by imperium2335
    I would like to drive a setTimeout loop based on the time of the server, seconds only. So when the seconds on the server is 30, some function is run on all clients. It is vital that they do not become totally out of sync with the server, as there will be a CRON job running on the server every, say, 45 seconds which is important to the system functioning correctly. It is ok if a client is out by a few seconds with the server, client do not need to be synced to each other. I am using Jquery library. Hope this makes sense!

    Read the article

  • js function to get filename from url

    - by Blankman
    Hi, I have a url like http://www.example.com/blah/th.html I need a javascript function to give me the 'th' value from that. All my urls have the same format (2 letter filenames, with .html extension). I want it to be a safe function, so if someone passes in an empty url it doesn't break. I know how to check for length, but I should be checking for null to right?

    Read the article

  • Query parameter using JS framework ?

    - by Maxim Veksler
    Hi, I seem to not be able to find implementation from the common Ajax libraries (JQuery, mootools, prototypejs...) that would allow the operation of parsing the window.location.href for request parameter. I would expect something like: $P{"param1"} == "param1_value" Am I missing something? p.s. The web does contains implementation examples for such operations

    Read the article

  • how to get the values dynamically in js

    - by jeessy
    hi having problem with my id iam making my website for health product. already we have a 10 products with corresponding amounts in this section customer choose the product through drop down box. in next we are getting service charges from customer by clicking radio buttons. we have a three radio buttons with name=add and three amount value like 5$ 7$ 9$. It is working fine. for example: customer selected 3 produts in the sense that total amount around 20$ after customer clicks this radio button(any) and submit button that amount will add with totally in next page ie 25$ what i want is that radio button amount should add with get payment then display the page dynamically. function checkRadio (frmName, rbGroupName) { var radios = document[frmName].elements[rbGroupName]; for (var i=0; i < radios.length; i++) { if(radios[i].checked) { return true; } } return false; } $(document).ready(function(){ $("input[name='rmr']").click(function() { updatePayment($(this).val()); if (!!$(this).attr("checked") == true) { $("#finalamount").html( parseInt($("#totalamount").val(), 10) * parseInt($(this).val(), 10)); } }); } this code is right or wrong. thanks in adv

    Read the article

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • JS variable scope missunderstanding

    - by meo
    I have a little problem: slideHelpers.total = 4 for (i=1;i <= slideHelpers.total; i++) { $('<a href="#">' + i + '</a>').bind('click', function(){ alert('go to the ' + i + ' slide')}).appendTo('.slideaccess') } the alert gives out 5 what is logic, because when the function click triggers i is actually 5. But i would like to have the same i as in my <a> tag. What is the best way to handle this? I could put i in the data() of the <a> tag for example but i am sure there is a easier way.

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • getting the names of elements in JS/jQuery

    - by Mala
    I have some checkbox inputs like so: <input type="checkbox" name="1" class="filter"/> <input type="checkbox" name="2" class="filter"/> ...etc... I'm trying to write a function where any time a checkbox is selected, it generates a string with all the names concatenated. Here's what I have so far: $('.filter').click(function(event){ var filters = $('.filter').toArray(); var fstr = ""; for (f in filters) { fstr = fstr+","+f.name; } alert(fstr); }); The names keep coming up as 'undefined', though (i.e. the alert returns ,undefined,undefined,undefined,undefined,undefined,undefined). How do I access the names?

    Read the article

  • Is it possible to use template and value at the same time on data-bind?

    - by Anonymous
    I have two sections of code. Code #1: <select data-bind="options: operatingSystems, optionsText: function (item) { return item.Name }, value: selectedOperatingSystem"></select> Code #2: <script type="text/html" id="os-template-detail"> <option data-bind="text: Name" class="body-text"></option> </script> <select data-bind="value: selectedOperatingSystem, template: { name: 'os-template-detail', foreach: operatingSystems }"></select> Both shows data from json correctly. With code #1, it updates the value when I select an item on the list while code #2 does not update anything when I change the item. I am pretty new to Knockout.js and have no idea why Code #2 doesn't work. Is it the limitation of Knockout that preventing me from using template and value at the same time?

    Read the article

  • Backbone inheritance - deep copying

    - by Ed .
    I've seen this question regarding inheritance in Backbone: Backbone.js view inheritance. Useful but doesn't answer my question. The problem I'm experiencing is this: Say I have a class Panel (model in this example); var Panel = Backbone.Model.extend({ defaults : { name : 'my-panel' } }); And then an AdvancedPanel; var AdvancedPanel = Panel.extend({ defaults : { label : 'Click to edit' } }); The following doesn't work: var advancedPanel = new AdvancedPanel(); alert(advancedPanel.get('name')); // Undefined :( JSFiddle here: http://jsfiddle.net/hWmnb/ I guess I can see that I can achieve this myself through some custom extend function that creates a deep copy of the prototype, but this seems like a common thing that people might want from Backbone inheritance, is there a standard way of doing it?

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • regular expression on replace method of js not working

    - by user950146
    why this is not working var value = arr[row][col].replace(new RegExp('"', 'g'),'""'); Error : Webpage error details User Agent: Mozilla/4.0 (compatible; MSIE 8.0; Windows NT 6.1; Trident/4.0; SLCC2; .NET CLR 2.0.50727; .NET CLR 3.5.30729; .NET CLR 3.0.30729; Media Center PC 6.0; InfoPath.2; Tablet PC 2.0) Timestamp: Tue, 10 Apr 2012 11:22:01 UTC Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Note: : Error copied directly from debugger of IE8

    Read the article

  • Undefined test not working in javascript.

    - by James South
    I'm getting the error 'foo' is undefined. in my script when i test my function with an undefined parameter. As far as I understand, This shouldn't be happening. My calling code: //var foo var test = peachUI().stringIsNullOrEmpty(foo) ; My function (part of a larger framework). stringIsNullOrEmpty: function (testString) { /// <summary> /// Checks to see if a given string is null or empty. /// </summary> /// <param name="testString" type="String"> /// The string check against. /// </param> /// <returns type="Boolean" /> var $empty = true; if (typeof testString !== "undefined") { if (testString && typeof testString === "string") { if (testString.length > 0) { $empty = false; } } } return $empty; } Any ideas? Please note. I've had a good read of other similar questions before posting this one.

    Read the article

  • Understanding NoSQL Data Modeling - blog application

    - by Rushabh RajeshKumar Padalia
    I am creating an blogging application in Node.js + MongoDB Database. I have used relational Database like MySQL before but this is my first experience with NoSQL database. So I would like to conform my MongoDB data models before I move further. I have decided my blogDB to have 3 collections post_collection - stores information about that article comment_collection - store information about comments on articles user_info_collection - contains user inforamtion PostDB { _"id" : ObjectID(...), "author": "author_name", "Date": new Date(....), "tag" : ["politics" , "war"], "post_title": "My first Article", "post_content": "Big big article" "likes": 23 "access": "public" } CommentDB { "_id" : Objectid(...), "POST": "My First Article", "comment_by": "User_name", "comment": "MY comments" } UserInfoDB { "_id": ObjectID(...), "user": "User_name", "password": "My_password" } I would appreciate your comments.

    Read the article

  • Javascript object encapsulation that tracks changes

    - by Raynos
    Is it possible to create an object container where changes can be tracked Said object is a complex nested object of data. (compliant with JSON). The wrapper allows you to get the object, and save changes, without specifically stating what the changes are Does there exist a design pattern for this kind of encapsulation Deep cloning is not an option since I'm trying to write a wrapper like this to avoid doing just that. The solution of serialization should only be considered if there are no other solutions. An example of use would be var foo = state.get(); // change state state.update(); // or state.save(); client.tell(state.recentChange()); A jsfiddle snippet might help : http://jsfiddle.net/Raynos/kzKEp/ It seems like implementing an internal hash to keep track of changes is the best option. [Edit] To clarify this is actaully done on node.js on the server. The only thing that changes is that the solution can be specific to the V8 implementation.

    Read the article

  • Toastr.js notifications as modal notfication

    - by Maxsteel
    I know it's not what toastr (or toast notifs in general) are meant to be used for, but I want to use them as a modal notification. My idea is following. On toast show: toastr.options.onShown = function() { //Create an overlay on the entire page} Overlay: #overlay { background-color: rgba(0, 0, 0, 0.8); z-index: 999; position: absolute; left: 0; top: 0; width: 100%; height: 100%; display: none; } And on toast close: toastr.options.onHidden = function() { //make overlay go away } Also, I'm setting timeout of toast to 0 so it won't disappear by itself. Question: I want the toast notification to stay atop the overlay and not behind it as overlay will cover everything. How can I do it?

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Get next key-value pair in an object

    - by captainclam
    So, given a key, I want to find the next property in an object. Then, I want to return the value of the NEXT property. I can not rely on the keys to be ordered or sequential (they're uuids). Please see below for trivial example of what I want: var db ={ a: 1, b: 2, c: 3 } var next = function(db, key) { // ??? } next(db, 'a'); // I want 2 next(db, 'b'); // I want 3 I also want a prev() function, but I'm sure it will be the same solution. This seems like such a trivial problem but I can't for the life of me figure out how to do it. Happy for the solution to use underscore.js or be written in coffeescript :)

    Read the article

< Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >