Search Results

Search found 93816 results on 3753 pages for 'nexus one'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 129/3753 | < Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • HTML: Place an image on top of another one

    - by Dimitris Baltas
    Inside a div, there is a picture that should have 10px margin in all directions from the DIV's border. On the left bottom corner of the picture there is an about-image. The picture is only displayed when its loaded in the DOM through jquery. The problem is that the existence of the about-image dislocates the picture downwards as many pixels as the height of the about-image. I am looking for the cleanest possible alternative to keep the picture inside the DIV and still display the about-image on top of it. Setting the picture as background will not work since i need the picture to load at once. Any improvement on the #about css would be greatly appreciated. Below is a full html page that reproduces the issue <html> <head> <title>Troubleshooting :: align the main picture inside the DIV</title> <style type="text/css"> html, body { background-color: #000000; } #about { z-index:2; position:relative; top:82%; left:3%; } #pic { width:100%; height:96%; } #main-content-image { height:100%; margin-right:10px; margin-left:10px; margin-top:10px; margin-bottom:10px; } #main-content { height:490px; border-width: 1px; border-style: solid; border-color: #777777; } #main-content-image.loading { background: url(http://farros.gr/images/ajax-loader2.gif) no-repeat center center; } a { text-decoration: none; text-decoration: none; color: #868686; outline:none; } .hide { display:none; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script> <script type="text/javascript"> <!-- $(document).ready(function(){ $(function () { var img = new Image(); $(img).load(function () { $(this).hide(); $(this).width('100%'); $(this).height('96%'); $('#main-content-image').removeClass('loading').append(this); $(this).fadeIn(); }).error(function () { // notify the user that the image could not be loaded }).attr('src', 'http://farros.gr/images/bg.jpg'); }); }); </script> </head> <body> <div id="main-content"> <div id="main-content-image" class="loading"> <a href="#"><img id="about" src='http://farros.gr/images/about.png' alt='Haris Farros'/></a> </div> </div> </body> </html>

    Read the article

  • Which one is more popular?

    - by atch
    Which of IDE's I'm more likely to meet in an office? Borland or Visual Studio? I wouldn't ask this question here (I could use google and type which is better) only for a reason that in my previous cariere as an engineer I worked (and most of my friends) all the time on AutoCAD not on Microstation even though Microstation had always been better software (stability, conforming to standards, ease of use etc.). Thanks for answers.

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • How do I select the max value from multiple tables in one column

    - by Derick
    I would like to get the last date of records modified. Here is a sample simple SELECT: SELECT t01.name, t01.last_upd date1, t02.last_upd date2, t03.last_upd date3, 'maxof123' maxdate FROM s_org_ext t01, s_org_ext_x t02, s_addr_org t03 WHERE t02.par_row_id(+)= t01.row_id and t03.row_id(+)= t01.pr_addr_id and t01.int_org_flg = 'n'; How can I get column maxdate to display the max of the three dates? Note: no UNION or sub SELECT statements ;)

    Read the article

  • One-Click Application Moving from WinForms to WPF

    - by Tyler
    I have a WinForms app that I recently re-wrote in WPF and I need to release to my end users. I'd like to be able to have the users go to the ClickOnce install point for the WPF application and have their WinForm application removed so they don't have both on their machine What's the best way (read: easiest for users) of accomplishing this? I have thought about creating an prereq command line app to detect the old version and uninstall, but would like to avoid having to write an something like that where it only get's run once.

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • One position right barrel shift using ALU Operators?

    - by Tomek
    I was wondering if there was an efficient way to perform a shift right on an 8 bit binary value using only ALU Operators (NOT, OR, AND, XOR, ADD, SUB) Example: input: 00110101 output: 10011010 I have been able to implement a shift left by just adding the 8 bit binary value with itself since a shift left is equivalent to multiplying by 2. However, I can't think of a way to do this for shift right. The only method I have come up with so far is to just perform 7 left barrel shifts. Is this the only way?

    Read the article

  • Can't find how to import as one object or how to merge

    - by Aaron
    I need write a script in blender that creates some birds which fly around some obstacles. The problem is that I need to import a pretty large Collada model (a building) which consists of multiple objects. The import works fine, but the the building is not seen as 1 object. I need to resize and move this building, but I can only get the last object in the building (which is a camera)... Does anyone know how to merge this building in 1 object, group, variable... so I can resize and move it correctly? Part of the code I used: bpy.ops.wm.collada_import(filepath="C:\\Users\\me\\building.dae") building= bpy.context.object building.scale = (100, 100, 100) building.name = "building"

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Merging two XML files into one XML file using Java

    - by dmurali
    I am stuck with how to proceed with combining two different XML files(which has the same structure). When I was doing some research on it, people say that XML parsers like DOM or StAX will have to be used. But cant I do it with the regular IOStream? I am currently trying to do with the help of IOStream but this is not solving my purpose, its being more complex. For example, What I have tried is; public class GUI { public static void main(String[] args) throws Exception { // Creates file to write to Writer output = null; output = new BufferedWriter(new FileWriter("C:\\merged.xml")); String newline = System.getProperty("line.separator"); output.write(""); // Read in xml file 1 FileInputStream in = new FileInputStream("C:\\1.xml"); BufferedReader br = new BufferedReader(new InputStreamReader(in)); String strLine; while ((strLine = br.readLine()) != null) { if (strLine.contains("<MemoryDump>")){ strLine = strLine.replace("<MemoryDump>", "xmlns:xsi"); } if (strLine.contains("</MemoryDump>")){ strLine = strLine.replace("</MemoryDump>", "xmlns:xsd"); } output.write(newline); output.write(strLine); System.out.println(strLine); } // Read in xml file 2 FileInputStream in = new FileInputStream("C:\\2.xml"); BufferedReader br1 = new BufferedReader(new InputStreamReader(in)); String strLine1; while ((strLine1 = br1.readLine()) != null) { if (strLine1.contains("<MemoryDump>")){ strLine1 = strLine1.replace("<MemoryDump>", ""); } if (strLine1.contains("</MemoryDump>")){ strLine1 = strLine1.replace("</MemoryDump>", ""); } output.write(newline); output.write(strLine1); I request you to kindly let me know how do I proceed with merging two XML files by adding additional content as well. It would be great if you could provide me some example links as well..! Thank You in Advance..! System.out.println(strLine1); } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • In listview,Viewstub cannot be found after the previous one is inflate

    - by user2958132
    I am using some list item layout and in the item layout, there is a Viewstub where I want to put some image in.I don't have the source of list item layout and just know there are some TextViews and ViewStubs in it. My purpose is to find the ViewStub first and set my personal layout and play with it. However, some of the ViewStub cannot be found. public class TJAdapter extends CursorAdapter { .... public void bindView(View view, Context context, Cursor cursor) { ViewStub contentstub = (ViewStub)item.findViewById(R.id.content_stub); if (contentstub == null){ LOG.error("TJ,contentstub is null"); } else { LOG.error("TJ,contentstub is not null"); contentstub.setLayoutResource(R.layout.icon_image); View iconImage = contentstub.inflate(); } .... } public View newView(Context context, Cursor cursor, ViewGroup parent) { final View view = mInflater.inflate(R.layout.list_item, parent, false); bindView(view, context, cursor); } And the log output is like this: TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null I spent a lot of time on it and have no idea why this happens. Can some body help?

    Read the article

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • Handling one-to-many relationship with ZF partialLoop

    - by snaken
    Lets say i'm listing musical artists, each artist has basic information like Name, Age etc. stored in an artist table. They also have entries in an Albums table (album name/album cover etc), referencing the artist table using the artist id as a foreign key. I have the Model_Artist (Artist.php) file: class Model_Artist extends Zend_Db_Table_Abstract { protected $_name = 'artist'; protected $_dependentTables = array('Model_ArtistAlbums'); public function fetchArtistss() { $select = $this->select(); return $this->fetchAll($select); } } and to the Model_ArtistAlbums (ArtistAlbums.php) file class Model_ArtistAlbums extends Zend_Db_Table_Abstract { protected $_name = 'albums'; protected $_referenceMap = array( 'Artists' => array( 'columns' => 'alb_art_id', 'refTableClass' => 'Model_Artist', 'refColumns' => 'art_id' ) ); // etc } in my controller: public function indexAction() { /* THIS WORKS $art = new Model_Artist(); $artRowset = $art->find(1); $art1 = $artRowset->current(); $artalbums = $art1->findDependentRowset('Model_ArtistAlbums'); foreach($artalbums as $album){ echo $album->alb_title."<br>"; } */ $arts = new Model_Artist(); $this->view->artists = $arts->fetchArtists(); } in the view file: $this->partial()->setObjectKey('artist'); echo $this->partialLoop('admin/list-artists.phtml', $this->artists); but with this code in artists/list-artists.phtml: foreach($this->artist->findDependentRowset('albums') as $album): // other stuff endforeach; i get this error: Fatal error: Call to a member function findDependentRowset() on a non-object A var_dump of $this->artist = NULL.

    Read the article

  • MonoRail - Select parent category from one dropdown, show child category dropdown

    - by Justin
    Hey, I'm new to MonoRail and am trying to figure out how to have it so that I can select a parent category in a dropdown then have it show a second dropdown with the categories that are children of the parent. If I were using what I'm used to, ASP.NET MVC, I would have a javascript function that would be called onchange of the first dropdown and would make an ajax call to a controller method (passing in the selected parent category id) that would grab all child categories of that parent category and return them in JSON. Then in the callback javascript function I would eval the JSON and populate the second dropdown with the child categories. How would I do this using MonoRail/jQuery? Here's the code I have so far: $FormHelper.Select("business.category.id", $categories, "%{value='id', text='name', firstoption='Select a Category'}") $FormHelper.Select("business.category.id", $childCategories, "%{value='id', text='name', firstoption='Select a Sub-Category'}") Then in BusinessController.cs: private void AddDataToModels() { PropertyBag["categories"] = CategoryRepository.GetParentCategories(); PropertyBag["childCategories"] = CategoryRepository.GetChildCategories(1); } Thanks for any input on how to approach this! Justin

    Read the article

  • Reading one or more to understand ? [closed]

    - by Tarik
    I love coding and designing applications but there is something annoying me so much. Some times I can't focus and understand what I am reading when learning new code or a new subject or whatever and that really annoys me because It causes me to read again and again and again which really puts me off and frustrate me. Does something like this happen to you or is there some problem with me ?

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 125 126 127 128 129 130 131 132 133 134 135 136  | Next Page >