Search Results

Search found 36715 results on 1469 pages for 'boost string'.

Page 13/1469 | < Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >

  • Recursive String Function (Java)

    - by Jake Brooks
    Hi, I am trying to design a function that essentially does as follows: String s = "BLAH"; store the following to an array: blah lah bah blh bla bl ba bh ah al So basically what I did there was subtract each letter from it one at a time. Then subtract a combination of two letters at a time, until there's 2 characters remaining. Store each of these generations in an array. Hopefully this makes sense, Jake

    Read the article

  • Problems removing a " from a string

    - by Graeme
    Hi, I have a string that ends with a " (quotation mark) that I want to get rid of. However, because XCode usually requires you to enter the text you wish to remove using stringByReplacingOccurrencesOfString in @"texttoremove" format, you can't use the quotation marks in the space as it thinks you are closing the text. Any ideas on how I can do it? Thanks.

    Read the article

  • Best way to code this, string to map conversion in Groovy

    - by Daxon
    I have a string like def data = "session=234567893egshdjchasd&userId=12345673456&timeOut=1800000" I want to convert it to a map ["session", 234567893egshdjchasd] ["userId", 12345673456] ["timeout", 1800000] This is the current way I am doing it, def map = [:] data.splitEachLine("&"){ it.each{ x -> def object = x.split("=") map.put(object[0], object[1]) } } It works, but is there a more efficient way?

    Read the article

  • Filter string in C

    - by Paul Tarjan
    How can I filter a string in c? I want to remove anything that isn't [a-z0-9_]. int main(int argc, char ** argv) { char* name = argv[1]; // remove anything that isn't [a-z0-9_] printf("%s", name); }

    Read the article

  • String Parsing in C#

    - by Betamoo
    What is the most efficient way to parse a C# string in the form of "(params (abc 1.3)(sdc 2.0)....)" into a struct in the form struct Params { double abc,sdc....; } Thanks EDIT The structure always have the same parameters (number and names).. but the order is not granted..

    Read the article

  • python - remove string from words in an array

    - by tekknolagi
    #!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

    Read the article

  • finding and returning a string with a specified prefix

    - by tipu
    I am close but I am not sure what to do with the restuling match object. If I do p = re.search('[/@.* /]', str) I'll get any words that start with @ and end up with a space. This is what I want. However this returns a Match object that I dont' know what to do with. What's the most computationally efficient way of finding and returning a string which is prefixed with a @? For example, "Hi there @guy" After doing the proper calculations, I would be returned guy

    Read the article

  • Intel turbo boost - in reality

    - by gisek
    I have an Intel i7-3630QM processor in my laptop. Its speed is supposed to be from 2.4 to 3.4 GHz in turbo boost mode. In reality, will it ever run all cores on full speed (3.4GHz mentioned above) at the same time? I heard somewhere that this additional 1GHz is shared between all cores in laptops. If the boost is 1GHz per core it's pretty impressive (over 40% speed up). What does it really look like? How long can a processor run in turbo mode?

    Read the article

  • Split a long JSON string into lines in Ruby

    - by David J.
    First, the background: I'm writing a Ruby app that uses SendGrid to send mass emails. SendGrid uses a custom email header (in JSON format) to set recipients, values to substitute, etc. SendGrid's documentation recommends splitting up the header so that the lines are shorter than 1,000 bytes. My question, then, is this: given a long JSON string, how can I split it into lines < 1,000 so that lines are split at appropriate places (i.e., after a comma) rather than in the middle of a word? This is probably unnecessary, but here's an example of the sort of string I'd like to split: X-SMTPAPI: {"sub": {"pet": ["dog", "cat"]}, "to": ["[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]"]} Thanks in advance for any help you can provide!

    Read the article

  • String.IsNullOrWhiteSpace

    - by Scott Dorman
    An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); }   return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty("   ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; }   Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

    Read the article

  • String replacement problem.

    - by fastcodejava
    I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Re: Help with Boost Grammar

    - by Decmac04
    I have redesigned and extended the grammar I asked about earlier as shown below: // BIFAnalyser.cpp : Defines the entry point for the console application. // // /*============================================================================= Copyright (c) Temitope Jos Onunkun 2010 http://www.dcs.kcl.ac.uk/pg/onun/ Use, modification and distribution is subject to the Boost Software License, Version 1.0. (See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) =============================================================================*/ //////////////////////////////////////////////////////////////////////////// // // // B Machine parser using the Boost "Grammar" and "Semantic Actions". // // // //////////////////////////////////////////////////////////////////////////// include include include include include include //////////////////////////////////////////////////////////////////////////// using namespace std; using namespace boost::spirit; //////////////////////////////////////////////////////////////////////////// // // Semantic Actions // //////////////////////////////////////////////////////////////////////////// // // namespace { //semantic action function on individual lexeme void do_noint(char const* start, char const* end) { string str(start, end); if (str != "NAT1") cout << "PUSH(" << str << ')' << endl; } //semantic action function on addition of lexemes void do_add(char const*, char const*) { cout << "ADD" << endl; // for(vector::iterator vi = strVect.begin(); vi < strVect.end(); ++vi) // cout << *vi << " "; } //semantic action function on subtraction of lexemes void do_subt(char const*, char const*) { cout << "SUBTRACT" << endl; } //semantic action function on multiplication of lexemes void do_mult(char const*, char const*) { cout << "\nMULTIPLY" << endl; } //semantic action function on division of lexemes void do_div(char const*, char const*) { cout << "\nDIVIDE" << endl; } // // vector flowTable; //semantic action function on simple substitution void do_sSubst(char const* start, char const* end) { string str(start, end); //use boost tokenizer to break down tokens typedef boost::tokenizer Tokenizer; boost::char_separator sep(" -+/*:=()",0,boost::drop_empty_tokens); // char separator definition Tokenizer tok(str, sep); Tokenizer::iterator tok_iter = tok.begin(); pair dependency; //create a pair object for dependencies //create a vector object to store all tokens vector dx; // int counter = 0; // tracks token position for(tok.begin(); tok_iter != tok.end(); ++tok_iter) //save all tokens in vector { dx.push_back(*tok_iter ); } counter = dx.size(); // vector d_hat; //stores set of dependency pairs string dep; //pairs variables as string object // dependency.first = *tok.begin(); vector FV; for(int unsigned i=1; i < dx.size(); i++) { // if(!atoi(dx.at(i).c_str()) && (dx.at(i) !=" ")) { dependency.second = dx.at(i); dep = dependency.first + "|-" + dependency.second + " "; d_hat.push_back(dep); vector<string> row; row.push_back(dependency.first); //push x_hat into first column of each row for(unsigned int j=0; j<2; j++) { row.push_back(dependency.second);//push an element (column) into the row } flowTable.push_back(row); //Add the row to the main vector } } //displays internal representation of information flow table cout << "\n****************\nDependency Table\n****************\n"; cout << "X_Hat\tDx\tG_Hat\n"; cout << "-----------------------------\n"; for(unsigned int i=0; i < flowTable.size(); i++) { for(unsigned int j=0; j<2; j++) { cout << flowTable[i][j] << "\t "; } if (*tok.begin() != "WHILE" ) //if there are no global flows, cout << "\t{}"; //display empty set cout << "\n"; } cout << "***************\n\n"; for(int unsigned j=0; j < FV.size(); j++) { if(FV.at(j) != dependency.second) dep = dependency.first + "|-" + dependency.second + " "; d_hat.push_back(dep); } cout << "PUSH(" << str << ')' << endl; cout << "\n*******\nDependency pairs\n*******\n"; for(int unsigned i=0; i < d_hat.size(); i++) cout << d_hat.at(i) << "\n...\n"; cout << "\nSIMPLE SUBSTITUTION\n\n"; } //semantic action function on multiple substitution void do_mSubst(char const* start, char const* end) { string str(start, end); cout << "PUSH(" << str << ')' << endl; //cout << "\nMULTIPLE SUBSTITUTION\n\n"; } //semantic action function on unbounded choice substitution void do_mChoice(char const* start, char const* end) { string str(start, end); cout << "PUSH(" << str << ')' << endl; cout << "\nUNBOUNDED CHOICE SUBSTITUTION\n\n"; } void do_logicExpr(char const* start, char const* end) { string str(start, end); //use boost tokenizer to break down tokens typedef boost::tokenizer Tokenizer; boost::char_separator sep(" -+/*=:()<",0,boost::drop_empty_tokens); // char separator definition Tokenizer tok(str, sep); Tokenizer::iterator tok_iter = tok.begin(); //pair dependency; //create a pair object for dependencies //create a vector object to store all tokens vector dx; for(tok.begin(); tok_iter != tok.end(); ++tok_iter) //save all tokens in vector { dx.push_back(*tok_iter ); } for(unsigned int i=0; i cout << "PUSH(" << str << ')' << endl; cout << "\nPREDICATE\n\n"; } void do_predicate(char const* start, char const* end) { string str(start, end); cout << "PUSH(" << str << ')' << endl; cout << "\nMULTIPLE PREDICATE\n\n"; } void do_ifSelectPre(char const* start, char const* end) { string str(start, end); //if cout << "PUSH(" << str << ')' << endl; cout << "\nPROTECTED SUBSTITUTION\n\n"; } //semantic action function on machine substitution void do_machSubst(char const* start, char const* end) { string str(start, end); cout << "PUSH(" << str << ')' << endl; cout << "\nMACHINE SUBSTITUTION\n\n"; } } //////////////////////////////////////////////////////////////////////////// // // Machine Substitution Grammar // //////////////////////////////////////////////////////////////////////////// // Simple substitution grammar parser with integer values removed struct Substitution : public grammar { template struct definition { definition(Substitution const& ) { machine_subst = ( (simple_subst) | (multi_subst) | (if_select_pre_subst) | (unbounded_choice) )[&do_machSubst] ; unbounded_choice = str_p("ANY") ide_list str_p("WHERE") predicate str_p("THEN") machine_subst str_p("END") ; if_select_pre_subst = ( ( str_p("IF") predicate str_p("THEN") machine_subst *( str_p("ELSIF") predicate machine_subst ) !( str_p("ELSE") machine_subst) str_p("END") ) | ( str_p("SELECT") predicate str_p("THEN") machine_subst *( str_p("WHEN") predicate machine_subst ) !( str_p("ELSE") machine_subst) str_p("END")) | ( str_p("PRE") predicate str_p("THEN") machine_subst str_p("END") ) )[&do_ifSelectPre] ; multi_subst = ( (machine_subst) *( ( str_p("||") (machine_subst) ) | ( str_p("[]") (machine_subst) ) ) ) [&do_mSubst] ; simple_subst = (identifier str_p(":=") arith_expr) [&do_sSubst] ; expression = predicate | arith_expr ; predicate = ( (logic_expr) *( ( ch_p('&') (logic_expr) ) | ( str_p("OR") (logic_expr) ) ) )[&do_predicate] ; logic_expr = ( identifier (str_p("<") arith_expr) | (str_p("<") arith_expr) | (str_p("/:") arith_expr) | (str_p("<:") arith_expr) | (str_p("/<:") arith_expr) | (str_p("<<:") arith_expr) | (str_p("/<<:") arith_expr) | (str_p("<=") arith_expr) | (str_p("=") arith_expr) | (str_p("=") arith_expr) | (str_p("=") arith_expr) ) [&do_logicExpr] ; arith_expr = term *( ('+' term)[&do_add] | ('-' term)[&do_subt] ) ; term = factor ( ('' factor)[&do_mult] | ('/' factor)[&do_div] ) ; factor = lexeme_d[( identifier | +digit_p)[&do_noint]] | '(' expression ')' | ('+' factor) ; ide_list = identifier *( ch_p(',') identifier ) ; identifier = alpha_p +( alnum_p | ch_p('_') ) ; } rule machine_subst, unbounded_choice, if_select_pre_subst, multi_subst, simple_subst, expression, predicate, logic_expr, arith_expr, term, factor, ide_list, identifier; rule<ScannerT> const& start() const { return predicate; //return multi_subst; //return machine_subst; } }; }; //////////////////////////////////////////////////////////////////////////// // // Main program // //////////////////////////////////////////////////////////////////////////// int main() { cout << "*********************************\n\n"; cout << "\t\t...Machine Parser...\n\n"; cout << "*********************************\n\n"; // cout << "Type an expression...or [q or Q] to quit\n\n"; string str; int machineCount = 0; char strFilename[256]; //file name store as a string object do { cout << "Please enter a filename...or [q or Q] to quit:\n\n "; //prompt for file name to be input //char strFilename[256]; //file name store as a string object cin strFilename; if(*strFilename == 'q' || *strFilename == 'Q') //termination condition return 0; ifstream inFile(strFilename); // opens file object for reading //output file for truncated machine (operations only) if (inFile.fail()) cerr << "\nUnable to open file for reading.\n" << endl; inFile.unsetf(std::ios::skipws); Substitution elementary_subst; // Simple substitution parser object string next; while (inFile str) { getline(inFile, next); str += next; if (str.empty() || str[0] == 'q' || str[0] == 'Q') break; parse_info< info = parse(str.c_str(), elementary_subst !end_p, space_p); if (info.full) { cout << "\n-------------------------\n"; cout << "Parsing succeeded\n"; cout << "\n-------------------------\n"; } else { cout << "\n-------------------------\n"; cout << "Parsing failed\n"; cout << "stopped at: " << info.stop << "\"\n"; cout << "\n-------------------------\n"; } } } while ( (*strFilename != 'q' || *strFilename !='Q')); return 0; } However, I am experiencing the following unexpected behaviours on testing: The text files I used are: f1.txt, ... containing ...: debt:=(LoanRequest+outstandingLoan1)*20 . f2.txt, ... containing ...: debt:=(LoanRequest+outstandingLoan1)*20 || newDebt := loanammount-paidammount || price := purchasePrice + overhead + bb . f3.txt, ... containing ...: yy < (xx+7+ww) . f4.txt, ... containing ...: yy < (xx+7+ww) & yy : NAT . When I use multi_subst as start rule both files (f1 and f2) are parsed correctly; When I use machine_subst as start rule file f1 parse correctly, while file f2 fails, producing the error: “Parsing failed stopped at: || newDebt := loanammount-paidammount || price := purchasePrice + overhead + bb” When I use predicate as start symbol, file f3 parse correctly, but file f4 yields the error: “ “Parsing failed stopped at: & yy : NAT” Can anyone help with the grammar, please? It appears there are problems with the grammar that I have so far been unable to spot.

    Read the article

  • What header file is where the boost libray define its own primitive data type?

    - by ronghai
    Recently, I try to use the boost::spirit::qi binary endian parser to parse some binary data depends on the endianness of the Platform. There is a simple example, like following: Using declarations and variables: using boost::spirit::qi::little_word; using boost::spirit::qi::little_dword; using boost::spirit::qi::little_qword; boost::uint16_t us; boost::uint32_t ui; boost::uint64_t ul; Basic usage of the little endian binary parsers: test_parser_attr("\x01\x02", little_word, us); assert(us == 0x0201); test_parser_attr("\x01\x02\x03\x04", little_dword, ui); assert(ui == 0x04030201); test_parser_attr("\x01\x02\x03\x04\x05\x06\x07\x08", little_qword, ul); assert(ul == 0x0807060504030201LL); test_parser("\x01\x02", little_word(0x0201)); test_parser("\x01\x02\x03\x04", little_dword(0x04030201)); test_parser("\x01\x02\x03\x04\x05\x06\x07\x08", little_qword(0x0807060504030201LL)); It works very well. But my questions come, why do we need use some data types like boost::uint16_t, boost::uint32_t here? Can I use unsigned long or unsigned int here? And if I want to parse double or float data type, what boost data type should I use? And please tell me where is boost define the above these types? Thanks a lot.

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to convert a function that returns a int to a function that returns a bool using boost::bind?

    - by user814628
    I have something like the following: struct A{ virtual int derp(){ if(herp()) return 1; else return 0; } void slurp(){ boost::function<bool(int x, int y> purp = /** boost bind derp to match lvalue sig **/; } } Any ideas? I want to create the function prup which basically calls derp and ignores the (x,y) passed in. I need something like bool purp(int x, int y){ return derp(); } but want to avoid creating it as a member function, and rather just create it locally if possible?

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >