Search Results

Search found 10563 results on 423 pages for 'complex numbers'.

Page 13/423 | < Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >

  • Reversible pseudo-random sequence generator

    - by user350651
    I would like some sort of method to create a fairly long sequence of random numbers that I can flip through backwards and forwards. Like a machine with "next" and "previous" buttons, that will give you random numbers. Something like 10-bit resolution (i.e. positive integers in a range from 0 to 1023) is enough, and a sequence of 100k numbers. It's for a simple game-type app, I don't need encryption-strength randomness or anything, but I want it to feel fairly random. I have a limited amount of memory available though, so I can't just generate a chunk of random data and go through it. I need to get the numbers in "interactive time" - I can easily spend a few ms thinking about the next number, but not comfortably much more than that. Eventually it will run on some sort of microcontroller, probably just an Arduino. I could do it with a simple linear congruential generator (LCG). Going forwards is simple, to go backwards I'd have to cache the most recent numbers and store some points at intervals so I can recreate the sequence from there. But maybe there IS some pseudo-random generator that allows you to go both forwards and forwards? It should be possible to hook up two linear feedback shift registers (LFSRs) to roll in different directions, no? Or maybe I can just get by with garbling the index number using a hash function of some sort? I'm going to try that first. Any other ideas?

    Read the article

  • How to add two java.lang.Numbers?

    - by amit.dev
    I have two Numbers. Eg: Number a = 2; Number b = 3; //Following is an error: Number c = a + b; Why arithmetic operations are not supported on Numbers? Anyway how would I add these two numbers in java? (Of course I'm getting them from somewhere and I don't know if they are Integer or float etc).

    Read the article

  • total number of magic square from 9 numbers

    - by Peeyush
    9 numbers need to be arranged in a magic number square. A magic number square is a square of numbers that is arranged such that every row and column has the same sum.(condition for diagonal has been relaxed) For example: 1 2 3 3 2 1 2 2 2 How do we calculate total number of distinct magic square from 9 numbers. Two magic number squares are distinct if they differ in value at one or more positions. For example, there is only one magic number square that can be made of 9 instances of the same number. e.g. for these 9 numbers { 4, 4, 4, 4, 4, 4, 4, 4, 4 }, answer should be 1. Also the complexity should be optimal. Do we need to iterate through all the permutations , discarding if a[0]+a[1]+a[2] %3!=0 such combinations ? moreover how do we remove duplicate magic square?

    Read the article

  • Validating javascript decimal numbers

    - by Click Upvote
    I'm using the following regexp to validate numbers in my javascript file: var valid = (val.match(/^\d+$/)); It works fine for whole numbers like 100, 200, etc, however for things like 1.44, 4.11, etc, it returns false. How can I change it so numbers with a decimal are also accepted?

    Read the article

  • get Phone numbers from android phone

    - by Luca
    Hi! First of all i'm sorry for my english... I've a problem getting phone numbers from contacts. That's my code import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.provider.ContactsContract; import android.widget.SimpleAdapter; import android.widget.Toast; import java.util.ArrayList; import java.util.HashMap; public class TestContacts extends ListActivity { private ArrayList<HashMap<String,String>> list = new ArrayList<HashMap<String,String>>(); private SimpleAdapter numbers; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.contacts); numbers = new SimpleAdapter( this, list, R.layout.main_item_two_line_row, new String[] { "line1","line2" }, new int[] { R.id.text1, R.id.text2 } ); setListAdapter( numbers ); Cursor cursor = getContentResolver().query(ContactsContract.Contacts.CONTENT_URI, null, null, null, null); while (cursor.moveToNext()) { String contactId = cursor.getString(cursor.getColumnIndex( ContactsContract.Contacts._ID)); String hasPhone = cursor.getString(cursor.getColumnIndex( ContactsContract.Contacts.HAS_PHONE_NUMBER)); //check if the contact has a phone number if (Boolean.parseBoolean(hasPhone)) { Cursor phones = getContentResolver().query( ContactsContract.CommonDataKinds.Phone.CONTENT_URI, null, ContactsContract.CommonDataKinds.Phone.CONTACT_ID +" = "+ contactId, null, null); while (phones.moveToNext()) { // Get the phone number!? String contactName = phones.getString( phones.getColumnIndex( ContactsContract.CommonDataKinds.Phone.DISPLAY_NAME)); String phoneNumber = phones.getString( phones.getColumnIndex( ContactsContract.CommonDataKinds.Phone.NUMBER)); Toast.makeText(this, phoneNumber, Toast.LENGTH_LONG).show(); drawContact(contactName, phoneNumber); } phones.close(); } }cursor.close(); } private void drawContact(String name, String number){ HashMap<String,String> item = new HashMap<String,String>(); item.put( "line1",name); item.put( "line2",number); list.add( item ); numbers.notifyDataSetChanged(); } } It'seems that no contact have a phone number (i've added 2 contacts on the emulator and i've tried also on my HTC Desire). The problem is that if (Boolean.parseBoolean(hasPhone)) returns always false.. How can i get correctly phone numbers? I've tried to call drawContact(String name, String number) before the if statement without querying for the phone number, and it worked (it draws two times the name). but on the LinearLayout they are not ordered alphabetically... how can i order alphabetically (similar to the original contacts app)? thank you in advice, Luca

    Read the article

  • Unsigned versus signed numbers as indexes

    - by simendsjo
    Whats the rationale for using signed numbers as indexes in .Net? In Python, you can index from the end of an array by sending negative numbers, but this is not the case in .Net. It's not easy for .Net to add such a feature later as it could break other code perhaps using special rules (yeah, a bad idea, but I guess it happens) on indexing. Not that I have ever have needed to index arrays over 2,147,483,647 in size, but I really cannot understand why they choose signed numbers. Can it be because it's more normal to use signed numbers in code?

    Read the article

  • How do you pronounce large hex numbers?

    - by warrenm
    This question might be subjective, but I'm hoping there's some consensus that I just don't know about. Short hex numbers are relatively easy to spell out (e.g., 0xC4A might be "cee-four-ay"). Hex numbers ending with a multiple of three zeros are likewise pretty easy (e.g., 0xC000 might be "cee-thousand"). But is there a concise way to pronounce 0xFFFF0000 or 0xCA000000? Magic numbers like 0xDEADBEEF are popular for their pronounceability, but I'm mostly asking about large-ish, round numbers that seem like they should have a more concise pronunciation.

    Read the article

  • Five unique, random numbers from a subset

    - by tau
    I know similar questions come up a lot and there's probably no definitive answer, but I want to generate five unique random numbers from a subset of numbers that is potentially infinite (maybe 0-20, or 0-1,000,000). The only catch is that I don't want to have to run while loops or fill an array. My current method is to simply generate five random numbers from a subset minus the last five numbers. If any of the numbers match each other, then they go to their respective place at the end of the subset. So if the fourth number matches any other number, it will bet set to the 4th from the last number. Does anyone have a method that is "random enough" and doesn't involve costly loops or arrays? Please keep in mind this a curiosity, not some mission-critical problem. I would appreciate it if everyone didn't post "why are you having this problem?" answers. I am just looking for ideas. Thanks a lot!

    Read the article

  • Using a set of numbers inside a database without creating a temporary table

    - by Zizzencs
    I have a set of numbers and a table in a database with the id (primary key) and text (not null) columns. I would like to create a query that returns all the numbers in the set and the associated text from the table. Unfortunately not all numbers exist in the database's id column, so this won't work: select id, text from table where id in (<set of numbers>) For the non-existing ids the best would be to return null as the text from the query. Is there a way to produce the desired output without first creating a temporary table from the set inside the database? The database engine in use is a Microsoft SQL Server 2008 SP1 but I'd be interested in any solution with any database engine.

    Read the article

  • Javascript Number Random Scrambler

    - by stjowa
    Hi, I need a Javascript random number scrambler for my website. Seems simple, but I can not figure out how to do it. Can anyone help me out? I have the following array of numbers: 1 2 3 4 5 6 7 8 9 I would like to be able to have these numbers scrambled randomly. Like the following: 3 6 4 2 9 5 1 8 7 or 4 1 7 3 5 9 2 6 8 So, specifically, I would like a function that takes in an array of numbers (1 - n) and then returns that same array of numbers - scrambled randomly with different calls to the function. Maybe a noob function, but can't seem to figure it out. Thanks!

    Read the article

  • Unable to Export contents of Data table (with French formatted Numbers ) to XML

    - by Ananth
    I have a data Table with numbers formatted according to the current regional settings. ie ( in French decimal separators are ',' instead of '.' in English). I need to export it to XML. Numbers in XML needs to be formatted according to the current regional settings.But now numbers in XML are formatted in English.Is there any way to make the number formatting in XML according to current regional settings ( or based on the locale of the Data Table) during the exporting process ?

    Read the article

  • Find numbers that equals a sum in an array

    - by valli-R
    I want to find the first set of integers in an array X that the sum equals a given number N. For example: X = {5, 13, 24, 9, 3, 3} N = 28 Solution = {13, 9, 3, 3} Here what I have so far : WARNING, I know it uses global and it is bad,that's not the point of the question. <?php function s($index = 0, $total = 0, $solution = '') { global $numbers; global $sum; echo $index; if($total == 28) { echo '<br/>'.$solution.' = '.$sum.'<br/>'; } elseif($index < count($numbers) && $total != 28) { s($index + 1, $total, $solution); s($index + 1, $total + $numbers[$index], $solution.' '.$numbers[$index]); } } $numbers = array(5, 13, 24, 9, 3, 3); $sum = 28; s(); ?> I don't get how I can stop the process when it finds the solution.. I know I am not far from good solution.. Thanks in advance

    Read the article

  • Haskell. Numbers in binary numbers. words

    - by Katja
    Hi! I need to code words into binary numbers. IN: "BCD..." OUT:1011... I have written already funktion for coding characters into siple numbers IN: 'C' OUT: 3 IN: 'c' OUT: 3 lett2num :: Char -> Int lett2num x | (ord 'A' <= ord x) && (ord x <= ord 'Z') = (ord x - ord 'A') + 1 | (ord 'a' <= ord x) && (ord x <= ord 'z') = (ord x - ord 'a') +1 num2lett :: Int -> Char num2lett n | (n <= ord 'A') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) | (n <= ord 'a') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) I wrote as well function for codind simple numbers into binary. num2bin :: Int->[Int] num2bin 0 = [] num2bin n | n>=0 = n `mod` 2 : (num2bin( n `div` 2)) | otherwise = error but I donw want those binary numbers to be in a list how can I get rid of the lists? Thanks

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

< Previous Page | 9 10 11 12 13 14 15 16 17 18 19 20  | Next Page >